Bioscience, Biotechnology, and Biochemistry
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA Kenji Oda, Takayuki Kohchi & Kanji Ohyama To cite this article: Kenji Oda, Takayuki Kohchi & Kanji Ohyama (1992) Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA, Bioscience, Biotechnology, and Biochemistry, 56:1, 132-135, DOI: 10.1271/bbb.56.132 To link to this article: http://dx.doi.org/10.1271/bbb.56.132
Published online: 12 Jun 2014.
Submit your article to this journal
Article views: 8
View related articles
Citing articles: 14 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [117.255.234.86]
Date: 05 November 2015, At: 12:47
Biosci. Biotech. Biochem., 56 (1), 132-135, 1992
Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA Kenji ODA, Takayuki KOHCHI,* and Kanji OHYAMA** Laboratory of Plant Molecular Biology, Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kyoto 606-01, Japan Received September 3, 1991
Downloaded by [117.255.234.86] at 12:47 05 November 2015
A cosmid library and physical maps of mitochondrial DNA (mtDNA) from a liverwort, Marchantia polymorpha, were constructed using the cosmid clones. Electrophoresis profile and the physical maps indicated that the liverwort mtDNA was approximately 183 kb long, the smallest among plant mtDNAs, and that it consisted of a single circular molecule. Southern hybridization analysis showed that genes typical to the mitochondrial genome existed in a single copy, and also that there was no incorporation of chloroplast DNA fragments into the mitochondrial genome.
Mitochondria contain their own genetic system. Although mitochondrial genomes of animal and fungi have been well studied, investigation on plant mitochondrial genomes is hampered by their enormous size and complexity of structure. Its size ranges from about 200 kb in Brassica species 1 ) to over 2000 kb in muskmelon,2) which are much larger than those of mammals (16kb in human 3 ») and fungi (approximately 80 kb in yeast 4 ) and 94 kb in Podospora 5 »). A complicated multipartite organization due to very frequent homologous recombination between several sets of long repetitive sequences has been reported in mitochondrial genomes of higher plants. Mitochondrial DNA (218 kb) of Brassica campestris was first demonstrated to have 2 kb repetitive sequences and to form a tripartite structure with subgenomic circles 135 kb and 83 kb long. 6 ) Genome organization is more complicated in maize. A postulated master circle of 570 kb with five pairs of tandem repeats and one set of inverted repeats produces a great number of subgenomic circles. 7) It has been reported that the mitochondrial genome of white mustard (B. hirta) exists in the form of a single circular molecule (208 kb) by physical mapping analysis with restricted fragments. 8) However they do not demonstrate that the mitochondrial genome has a single copy of each gene. In addition complicated structure of plant mitochondrial genome is caused by sequences highly homologous to the chloroplast genome. The maize mitochondrial genome was first reported to contain a region homologous to 12 kb of an inverted repeat of the chloroplast genome. 9 ) Subsequently the RuBisCO large subunit gene of the chloroplast genome was found in the mitochondrial genome. 10 ) Such 'promiscuous DNA' has been found in the mitochondrial genomes of all plants studied, and high sequence similarity (more than 90%) between them suggests recent transfer events of genetic informtion from the chloroplast to the mitochondrial genome. In this report, we show that the mitochondrial genome of liverwort was the smallest genome among land plants with a single circular molecule, that genes typical to the mitochondrial genome were present once, and that there was no incorporation of "* **
exogenous DNA from the chloroplast genome.
Materials and Methods Isolation and cloning of liverwort mtDNA. Liverwort mtDNA was isolated from 2 or 3-week-old suspension culture of cells originally provided by Ono. 11) The cells were washed two times with 2% sucrose and one time with homogenization buffer (0.4 Mmannitol, 1mM EDTA, 0.1 % BSA, 0.6% polyvinylpolypyrrolidone, and 0.1 M Hepes-KOH, pH 7.5). After disrupting the cells by a French press, the cell homogenates were filtrated through Miracloth. Nuclei and chloroplasts were removed by two centrifugations at 1,000 x g for 5 min. Mitochondria were precipitated by centrifugation at 19,000 x g for 15 min, suspended gently in DNase buffer (O.4M mannitol, 10mM MgC1 2, and 50mM Hepes-KOH, pH 7.5), and incubated with 50.ugjml DNase I (Sigma) for 1 hour at 4°C to digest contaminating nuclear and chloroplast DNA. Dilution buffer (0.4 Mmannitol, 0.1% BSA, and 20mM Hepes-KOH, pH 7.5) was added, and mitochondria were precipitated by centrifugation at 19,000 x g for 15min and resuspended in the dilution buffer. Mitochondrial suspension was layered on the top of Percoll stepwise gradients (5%, 28%, 45%, and 60% Percoll in the buffer containing 0.25 M sucrose, 0.2% BSA, and 20mM Hepes-KOH, pH 7.5) and spun at 13,500rpm for 30min in a Beckman SW40Ti rotor. The mitochondria fraction was obtained from the interface betweem the second and third gradiens. To remove Percoll, 20 times the volume of the dilution buffer was added, then mitochondria were pelleted by centrifugation at 19,000 x g for 15 min. The final pellet was resuspended in lysis buffer (2% Sarkosyl, 20mM EDTA, and 50mM Tris-HCl, pH 8.0). Mitochondrial DNA was purified by equilibrium centrifugation in CsCl-ethidium bromide gradients. 12 ) Mitochondrial DNA was partially digested with MboI restriction endonuclease and restricted fragments from 30 to 45 kb were obtained by sucrose gradient (10-40%) centrifugation at 26,000 rpm for 24hours in a Hitachi RPS40T rotor. The fragments were dephosphorylated and ligated to the BamHI site of a cosmid vector, pHC79, followed by packaging with Gigapack Gold (Stratagene) and transfected to the E. coli strain HB 101. Labeling of DNA and Southern hybridization. DNA fragments were fractionated in 0.6% agarose gel and transferred to a nylon membrane (Gene screen plus, New England Nuclear, or Zeta-Probe blotting membrane, BIO-RAD). DNA probes were labeled by a random primed DNA labeling kit (Boehringer Mannheim) using [iX- 32 PJdCTP (> 3000 Cij mmol, Amersham) or by T4 polynucleotide kinase (Takara) using [y32PJdATP (5000 Cijmmol, Amersham). Southern hybridization was done at 42°C in 6 x SSC containing 5 x Denhardt's reagent, 200.ugjml calf thymus DNA, 0.5% SDS, and 50% formamide. Slot-blot hydridization was done overnight at 42°C in 50mM Tris-HCl (pH 7.0) buffer containing 5 x SSC, 1 x Denhardt's reagent, 200.ugjml calf thymus DNA, 0.1 %
Present address: Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114, U.S.A. To whom correspondence should be addressed.
NII-Electronic Library Service
Liverwort Mitochondrial DNA
133
SDS, 10% dextran sulfate, and 50% formamide. Filters wre washed in 2 x SSC containing 0.1 % SDS at room temperature for 30 min, and then in 1 x SSC containing 0.1 % SDS at 37°C for 30 min.
Results and Discussion Electrophoresis profile
Liverwort mtDNA digested with KpnI, PstI, and XhoI restriction endonucleases were electrophoresed through a 0.5% agarose gel in TBE buffer (90 mM Tris-bo rate and 2 mM EDTA, pH 8.0). They showed a simple profile of restriction fragments (Fig. 1). The XhoI digested fragments were resolved into at least 20 bands in gel electrophoresis. Bright bands in ethidium bromide staining were found to consist of two or three different fragments by cloning and mapping analysis described below.· This profile implies liverwort mtDNA has no large repetitive sequences in the genome structure.
Downloaded by [117.255.234.86] at 12:47 05 November 2015
A clone library and physica l maps
1
2
3
4
(kb)
23.1 9.4
6.6 4.4
....
•
•
•
2.3 2.0
1.35 1.08 0.87 0.60
To construct a physical map, a cosmid library was • established from a partial Mbo I digest ofliverwort mtDNA . More than 300 cosmids were analyzed at random. The Xho I restriction patterns of the cosmid clones were compared by electrophoresis with that of a XhoI digest of the mtDNA . Twelve overlapping clones were selected. The physical maps were constructed from the single and double digests with Fig. 1. Restriction Patterns of Liverwort mtDNA. KpnI, PstI, and XhoI restriction endonucleases. The over- Liverwort mtDNA was restricted with endonuclease KpnI (lane 2), PstI (lane 3), lapping maps formed a single linkage group and the 12 XhoI (lane 4), electrophoresed in 0.5% agarose gel, and stained with ethjd)um bromide. Lane I indicates the size markers (the mixture of ,1,DNA digested with clones covered over 99% of visible restriction fragments. Hind III and tjJXI74 RF-DNA digested with HaeIII endonuclease). Asterisks and double asterisks indicate double and triple bands, respectively. A small part of either the 5.0 kb Kpn I fragment, or the 21 kb PstI fragment, or the 7.6kb XhoI fragment could not be cloned in a cosmid vector. Therefore we cloned the 5.0 kb KpnI fragment directly from mtDNA fragments to pBluescriptII KS + (Fig. 2). The complete physical map suggests that the liverwort genome was found as a single circular molecule 183 kb long indicating no frequent intramolecular recombination in liverwort mitochondria as seen in the mitochondria of higher plants. Electron microscopic analysis has been done to confirm the single circular structure of the mtDNA. 13 ) We have observed the mixtures of linear, unexpanded, and open circular molecules. We are not able to detect any different size of circular molecule generated by homolgous recombination or also any mitochondrial circular plasmid-like DNA in the liverwort mitochondrial DNA preparation. The average size of observed circular molecules estimated by comparing to a plasmid DNA, pMP768 (l0,079 bp) added as a size marker, is 184.4 ± 0.5 kb (average of 11 molecules), which is nearly equal to the size calculated from the hysical map (Fig. 2). One of the interesting feature of the plant mitochondrial genome is a multipartite structure caused by homologous recombination between direct and/or inverted repeated sequences. Judging from electron microscopic observation described previously and the constructed map, the liverwort mtDNA seems unlikely to have frequently homologous recombination. This indicates either that the liverwort Cox'" mtDNA does not have long repetitive sequences capable of Fig. 2. Physical Maps of Liverwort mtDNA and Clones Complet ely recombination or that the liverwort mitochondria do not Covering the mtDNA. have a recombination system. Arrows with numbers inside the map indicate cosmid clones cK3, cK228, cK7, cK278, cK1I9, cK114, and cK78, and a plasmid clone pLK161. Approxim ate locations of the mitochondrial genes (see nomenclature for genes in Table I) are indicated outside the map.
NII-Electronic Library Service
134
K. ODA,
Table I.
T.
KOHCHI,
and K.
OHYAMA
Hybridization Probes Used in Gene Mapping
Genes
Probes
Sources
rrn18 rrn26 atpA atp6 coxI coxII coxIIl
1.1 kb AvaI fragment 1.8 kb EcoRI fragment 1.5kb EcoRI-HindIII fragment 1.5 kb NheI fragment AGCATGTGCCCATCACTCCAGCAATGGCACCG 0.8 kb HpaI-PstI fragment 1.1 kb EcoRI-PstI fragment
3
3
4 7
8
9b
10
Wheat, Quetier, personal communication Pea, Nakamura, personal communication Pea, Morikami and Nakamura 14 ) Oenothera, Shuster and Brennicke 15 ) Oenothera, Hiesel et al. 16 ) Oenothera, Hiesel and Brennicke 17 ) Oenothera, Hiesel et al. 16 )
Downloaded by [117.255.234.86] at 12:47 05 November 2015
3a
X501
3
2
1
4
5
7
6
Fig. 3. Southern Hybridization Analysis of Liverwort mtDNA Digested with XhoI Endonuclease with Different Probes (see Table I). Lanes 1 to 7 indicate hybridization patterns with probes; rrnI8 (lane 1) and rrn26 (lane 2) genes for small and large subunits of ribosomal RNA, atpA (lane 3) and atp6 (lane 4) genes for IX and 6 subunits of ATPase complex, and cox! (lane 5), coxll (lane 6), and coxllI (lane 7) genes for subunits I, II, and III, respectively, of cytochrome c oxidase complex. Left lanes of each indicate the patterns stained with ethidium bromide. The gene for IX subunit of ATPase complex was separated into two Xh4 and Xh7 fragments (see the text).
Fig. 5. Summary of Slot-blot Hybridization of Chloroplast Plasmid DNA with 32P-Labeled Liverwort mtDNA. Plasmid clones (shadowed), pMP323, pMP389, pMP376, and pMP055 containing chloroplast ribosomal RNA genes, were hybridized with liverwort mtDNA.
control
713 452 228 314 227 220 217 209 222 801 795 773 768 X601 X501 389
pMP802 323 699 152 151 103 101 102 171 703 721 055 376·
310 727
1
2
3
Gene organization
The mitochondrial genes were located on the physical map of liverwort mtDNA by heterologous hybridization. Liverwort mtDNA was digested with three restriction endonucleases, Kpn I, Pst I, and Xho I, used in mapping analysis and hybridized with clones containing known genes of other plants listed in Table I. Figure 3 shows only the analysis of Southern hybridization of Xho I fragments. All the probes were obviously hybridized with a single site (Fig. 3a-t) except for the atpA probe that hydridized with two continuous Xh4 and Xh7 fragments, indicating also a single copy of the atpA gene. Two rRNA genes (rrn18 and rrn26) as well as two cytochrome c oxidase genes (coxIl and coxIl/) were closely linked in the physical maps (Fig. 2). The two pairs possibly form operons, although neither are clustered in most plant mitochondrial genomes. 18, 19)
1
2
3
Fig. 4. Slot-blot Hybridization of Chloroplast Plasmid Clones with 32P-Labeled Liverwort mtDNA. Numbers indicate chloroplast plasmid c1ones. 20 ) Lanes 1 to 3 indicate the increasing amounts of blotted chloroplast plasmid DNA (6, 25, and 100 ng per 1kb length of plasmid DNA put on the filters, respectively). In the control, lane 1 is mtDNA blotted (lOng), and lanes 2 and 3 are plasmid pUC18 blotted (68ng and 270ng, respectively).
Hybridization to choroplast DNA clones
It has been reported that very high homologous sequences with ctDNA are inserted into mitochondrial genomes of plants. 9 ,10) To find whether inter-organelle sequnces exist between the liverwort mitochondrial and chloroplast genomes, we did slot-blot hybridization of liverwort mtDNA to clones covering the entire region of
NII-Electronic Library Service
Liverwort Mitochondrial DNA
135
to the mitochondrial fragments having 18S and 26S rRNA genes (Fig. 6). This indicates that the liverwort mitochondrial genome contained no detectable ctDNA fragments. Acknowledgments. This research was partly supported by a Grant-inAid for Scientific Research in Priority Areas from the Ministry of Education, Science, and Culture of Japan and by a research grant from the Yamada Science Foundation.
265 (Xh10)
References 1) 2)
185
(Xh13a) 3)
4) 5)
Downloaded by [117.255.234.86] at 12:47 05 November 2015
6) 7)
12 Fig. 6. Southern Hybridization of XhoI-digested Liverwort mtDNA with a Probe of the Mixture of the Chloroplast Plasmid Clones (pMP323, pMP389, pMP376, and pMP055) Containing Liverwort Chloroplast Ribosomal RNA Genes. Hybridized bands, 10th and 13th XhoI fragments of liverwort mtDNA, were fragments containing mitochondrial ribosomal RNA genes (26S and 18S, respectively) (see also lanes I and 2 in Fig. 3). Lane 1 is a pattern of XhoI-digested fragments stained with ethidivm bromide.
liverwort ctDNA. 20 ) Positive signals were detected in four clones; pMP389, pMP376, pMP055, and pMP323 (Fig. 4 and 5). The four clones contained either the 16S or 23S rRNA gene of the chloroplast genome. To confirm a possibility that the signals were caused by sequence conservation between mitochondrial and chloroplast rRNA genes, we hybridized the mixture of four clones having ct-rRNA genes as probes to the liverwort mtDNA digested with the Xho I enzyme used in the mapping. They hybridized
8) 9) 10) 11) 12)
13)
14) 15) 16) 17) 18) 19) 20)
P. Lebacq and F. Vedel, Plant Science Lett., 23, 1-9 (1981). B. L. Ward, R. S. Anderson, and A. J. Bendich, Cell, 25, 793-803 (1981). S. Anderson, A. T. Bankier, B. G. Barrell, M. H. L. de Bruijn, A. R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlich, B. A. Roe, F. Sanger, P. H. Schreier, A. J. H. Smith, R. Staden, and I. G. Young, Nature, 290, 457-465 (1981). M. de Zamaroczy and G. Bernardi, Gene, 37, 1-17 (1985). D. J. Cummings, K. L. McNally, 1. M. Domenico, and E. T. Matsuura, Curro Genet., 17, 375-402 (1990). J. D. Palmer and C. R. Shields, Nature, 307, 437-440 (1984). D. M. Lonsdale, T. P. Hodge, and C. M.-R. Fauron, Nucl. Acids Res., 12,9249-9261 (1984). 1. D. Palmer and L. A. Herbon, ,Curro Genet., ll, 565-570 (1987). D. B. Stem and D. M. Lonsdale, Nature, 299, 698-702 (1982). D. M. Lonsdale, T. P. Hodge, C. J. Howe, and D. B. Stem, Cell, 34, 1007-1014 (1983). K. 000, K. Ohyama, and O. L. Gamborg, Plant Sci. Lett., 14, 225-229 (1979). T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual" Cold Spring Harbor Labortory Press, Cold Spring Harbor, NY., 1982, pp. 93-94. K. Oda, K. Yamato, E. Ohta, Y. Nakamura, M. Takemura, N. Nozato, K. Akashi, T. Kanegae, Y. Ogura, T. Kohchi, and K. Ohyama, J. Mol. Bioi., in press. A. Morikami and K. Nakamura,J. Biochem., 101,967-976(1987). W. Schuster and A. Brennicke, Nucl. Acids Res., 15,9092 (1987). R. Hiesel, W. Schobel, W. Schuster, and A. Brennicke, EMBO J., 6,29-34 (1987). R. Hiesel and A. Brennicke, EMBO J., 2, 2173-2178 (1983). K. J. Newton, Ann. Rev. Plant Physiol., Plant Mol. Bioi., 39,503-532 (1988). T. Brears and D. M. Lonsdale, Mol. Gen. Genet., 214, 514-522 (1988). K. Ohyama, H. Fukuzawa, T. Kohchi, T. Sano, S. Sano, H. Shirai, K. Umesono, Y. Shiki, M. Takeuchi, Z. Chang, S. Aota, H. Inokuchi, and H. Ozeki, J. Mol. Bioi., 203, 281-298 (1988).
NII-Electronic Library Service
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA Kenji Oda, Takayuki Kohchi & Kanji Ohyama To cite this article: Kenji Oda, Takayuki Kohchi & Kanji Ohyama (1992) Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA, Bioscience, Biotechnology, and Biochemistry, 56:1, 132-135, DOI: 10.1271/bbb.56.132 To link to this article: http://dx.doi.org/10.1271/bbb.56.132
Published online: 12 Jun 2014.
Submit your article to this journal
Article views: 8
View related articles
Citing articles: 14 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [117.255.234.86]
Date: 05 November 2015, At: 12:47
Biosci. Biotech. Biochem., 56 (1), 132-135, 1992
Mitochondrial DNA of Marchantia polymorpha as a Single Circular Form with no Incorporation of Foreign DNA Kenji ODA, Takayuki KOHCHI,* and Kanji OHYAMA** Laboratory of Plant Molecular Biology, Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, Kyoto 606-01, Japan Received September 3, 1991
Downloaded by [117.255.234.86] at 12:47 05 November 2015
A cosmid library and physical maps of mitochondrial DNA (mtDNA) from a liverwort, Marchantia polymorpha, were constructed using the cosmid clones. Electrophoresis profile and the physical maps indicated that the liverwort mtDNA was approximately 183 kb long, the smallest among plant mtDNAs, and that it consisted of a single circular molecule. Southern hybridization analysis showed that genes typical to the mitochondrial genome existed in a single copy, and also that there was no incorporation of chloroplast DNA fragments into the mitochondrial genome.
Mitochondria contain their own genetic system. Although mitochondrial genomes of animal and fungi have been well studied, investigation on plant mitochondrial genomes is hampered by their enormous size and complexity of structure. Its size ranges from about 200 kb in Brassica species 1 ) to over 2000 kb in muskmelon,2) which are much larger than those of mammals (16kb in human 3 ») and fungi (approximately 80 kb in yeast 4 ) and 94 kb in Podospora 5 »). A complicated multipartite organization due to very frequent homologous recombination between several sets of long repetitive sequences has been reported in mitochondrial genomes of higher plants. Mitochondrial DNA (218 kb) of Brassica campestris was first demonstrated to have 2 kb repetitive sequences and to form a tripartite structure with subgenomic circles 135 kb and 83 kb long. 6 ) Genome organization is more complicated in maize. A postulated master circle of 570 kb with five pairs of tandem repeats and one set of inverted repeats produces a great number of subgenomic circles. 7) It has been reported that the mitochondrial genome of white mustard (B. hirta) exists in the form of a single circular molecule (208 kb) by physical mapping analysis with restricted fragments. 8) However they do not demonstrate that the mitochondrial genome has a single copy of each gene. In addition complicated structure of plant mitochondrial genome is caused by sequences highly homologous to the chloroplast genome. The maize mitochondrial genome was first reported to contain a region homologous to 12 kb of an inverted repeat of the chloroplast genome. 9 ) Subsequently the RuBisCO large subunit gene of the chloroplast genome was found in the mitochondrial genome. 10 ) Such 'promiscuous DNA' has been found in the mitochondrial genomes of all plants studied, and high sequence similarity (more than 90%) between them suggests recent transfer events of genetic informtion from the chloroplast to the mitochondrial genome. In this report, we show that the mitochondrial genome of liverwort was the smallest genome among land plants with a single circular molecule, that genes typical to the mitochondrial genome were present once, and that there was no incorporation of "* **
exogenous DNA from the chloroplast genome.
Materials and Methods Isolation and cloning of liverwort mtDNA. Liverwort mtDNA was isolated from 2 or 3-week-old suspension culture of cells originally provided by Ono. 11) The cells were washed two times with 2% sucrose and one time with homogenization buffer (0.4 Mmannitol, 1mM EDTA, 0.1 % BSA, 0.6% polyvinylpolypyrrolidone, and 0.1 M Hepes-KOH, pH 7.5). After disrupting the cells by a French press, the cell homogenates were filtrated through Miracloth. Nuclei and chloroplasts were removed by two centrifugations at 1,000 x g for 5 min. Mitochondria were precipitated by centrifugation at 19,000 x g for 15 min, suspended gently in DNase buffer (O.4M mannitol, 10mM MgC1 2, and 50mM Hepes-KOH, pH 7.5), and incubated with 50.ugjml DNase I (Sigma) for 1 hour at 4°C to digest contaminating nuclear and chloroplast DNA. Dilution buffer (0.4 Mmannitol, 0.1% BSA, and 20mM Hepes-KOH, pH 7.5) was added, and mitochondria were precipitated by centrifugation at 19,000 x g for 15min and resuspended in the dilution buffer. Mitochondrial suspension was layered on the top of Percoll stepwise gradients (5%, 28%, 45%, and 60% Percoll in the buffer containing 0.25 M sucrose, 0.2% BSA, and 20mM Hepes-KOH, pH 7.5) and spun at 13,500rpm for 30min in a Beckman SW40Ti rotor. The mitochondria fraction was obtained from the interface betweem the second and third gradiens. To remove Percoll, 20 times the volume of the dilution buffer was added, then mitochondria were pelleted by centrifugation at 19,000 x g for 15 min. The final pellet was resuspended in lysis buffer (2% Sarkosyl, 20mM EDTA, and 50mM Tris-HCl, pH 8.0). Mitochondrial DNA was purified by equilibrium centrifugation in CsCl-ethidium bromide gradients. 12 ) Mitochondrial DNA was partially digested with MboI restriction endonuclease and restricted fragments from 30 to 45 kb were obtained by sucrose gradient (10-40%) centrifugation at 26,000 rpm for 24hours in a Hitachi RPS40T rotor. The fragments were dephosphorylated and ligated to the BamHI site of a cosmid vector, pHC79, followed by packaging with Gigapack Gold (Stratagene) and transfected to the E. coli strain HB 101. Labeling of DNA and Southern hybridization. DNA fragments were fractionated in 0.6% agarose gel and transferred to a nylon membrane (Gene screen plus, New England Nuclear, or Zeta-Probe blotting membrane, BIO-RAD). DNA probes were labeled by a random primed DNA labeling kit (Boehringer Mannheim) using [iX- 32 PJdCTP (> 3000 Cij mmol, Amersham) or by T4 polynucleotide kinase (Takara) using [y32PJdATP (5000 Cijmmol, Amersham). Southern hybridization was done at 42°C in 6 x SSC containing 5 x Denhardt's reagent, 200.ugjml calf thymus DNA, 0.5% SDS, and 50% formamide. Slot-blot hydridization was done overnight at 42°C in 50mM Tris-HCl (pH 7.0) buffer containing 5 x SSC, 1 x Denhardt's reagent, 200.ugjml calf thymus DNA, 0.1 %
Present address: Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114, U.S.A. To whom correspondence should be addressed.
NII-Electronic Library Service
Liverwort Mitochondrial DNA
133
SDS, 10% dextran sulfate, and 50% formamide. Filters wre washed in 2 x SSC containing 0.1 % SDS at room temperature for 30 min, and then in 1 x SSC containing 0.1 % SDS at 37°C for 30 min.
Results and Discussion Electrophoresis profile
Liverwort mtDNA digested with KpnI, PstI, and XhoI restriction endonucleases were electrophoresed through a 0.5% agarose gel in TBE buffer (90 mM Tris-bo rate and 2 mM EDTA, pH 8.0). They showed a simple profile of restriction fragments (Fig. 1). The XhoI digested fragments were resolved into at least 20 bands in gel electrophoresis. Bright bands in ethidium bromide staining were found to consist of two or three different fragments by cloning and mapping analysis described below.· This profile implies liverwort mtDNA has no large repetitive sequences in the genome structure.
Downloaded by [117.255.234.86] at 12:47 05 November 2015
A clone library and physica l maps
1
2
3
4
(kb)
23.1 9.4
6.6 4.4
....
•
•
•
2.3 2.0
1.35 1.08 0.87 0.60
To construct a physical map, a cosmid library was • established from a partial Mbo I digest ofliverwort mtDNA . More than 300 cosmids were analyzed at random. The Xho I restriction patterns of the cosmid clones were compared by electrophoresis with that of a XhoI digest of the mtDNA . Twelve overlapping clones were selected. The physical maps were constructed from the single and double digests with Fig. 1. Restriction Patterns of Liverwort mtDNA. KpnI, PstI, and XhoI restriction endonucleases. The over- Liverwort mtDNA was restricted with endonuclease KpnI (lane 2), PstI (lane 3), lapping maps formed a single linkage group and the 12 XhoI (lane 4), electrophoresed in 0.5% agarose gel, and stained with ethjd)um bromide. Lane I indicates the size markers (the mixture of ,1,DNA digested with clones covered over 99% of visible restriction fragments. Hind III and tjJXI74 RF-DNA digested with HaeIII endonuclease). Asterisks and double asterisks indicate double and triple bands, respectively. A small part of either the 5.0 kb Kpn I fragment, or the 21 kb PstI fragment, or the 7.6kb XhoI fragment could not be cloned in a cosmid vector. Therefore we cloned the 5.0 kb KpnI fragment directly from mtDNA fragments to pBluescriptII KS + (Fig. 2). The complete physical map suggests that the liverwort genome was found as a single circular molecule 183 kb long indicating no frequent intramolecular recombination in liverwort mitochondria as seen in the mitochondria of higher plants. Electron microscopic analysis has been done to confirm the single circular structure of the mtDNA. 13 ) We have observed the mixtures of linear, unexpanded, and open circular molecules. We are not able to detect any different size of circular molecule generated by homolgous recombination or also any mitochondrial circular plasmid-like DNA in the liverwort mitochondrial DNA preparation. The average size of observed circular molecules estimated by comparing to a plasmid DNA, pMP768 (l0,079 bp) added as a size marker, is 184.4 ± 0.5 kb (average of 11 molecules), which is nearly equal to the size calculated from the hysical map (Fig. 2). One of the interesting feature of the plant mitochondrial genome is a multipartite structure caused by homologous recombination between direct and/or inverted repeated sequences. Judging from electron microscopic observation described previously and the constructed map, the liverwort mtDNA seems unlikely to have frequently homologous recombination. This indicates either that the liverwort Cox'" mtDNA does not have long repetitive sequences capable of Fig. 2. Physical Maps of Liverwort mtDNA and Clones Complet ely recombination or that the liverwort mitochondria do not Covering the mtDNA. have a recombination system. Arrows with numbers inside the map indicate cosmid clones cK3, cK228, cK7, cK278, cK1I9, cK114, and cK78, and a plasmid clone pLK161. Approxim ate locations of the mitochondrial genes (see nomenclature for genes in Table I) are indicated outside the map.
NII-Electronic Library Service
134
K. ODA,
Table I.
T.
KOHCHI,
and K.
OHYAMA
Hybridization Probes Used in Gene Mapping
Genes
Probes
Sources
rrn18 rrn26 atpA atp6 coxI coxII coxIIl
1.1 kb AvaI fragment 1.8 kb EcoRI fragment 1.5kb EcoRI-HindIII fragment 1.5 kb NheI fragment AGCATGTGCCCATCACTCCAGCAATGGCACCG 0.8 kb HpaI-PstI fragment 1.1 kb EcoRI-PstI fragment
3
3
4 7
8
9b
10
Wheat, Quetier, personal communication Pea, Nakamura, personal communication Pea, Morikami and Nakamura 14 ) Oenothera, Shuster and Brennicke 15 ) Oenothera, Hiesel et al. 16 ) Oenothera, Hiesel and Brennicke 17 ) Oenothera, Hiesel et al. 16 )
Downloaded by [117.255.234.86] at 12:47 05 November 2015
3a
X501
3
2
1
4
5
7
6
Fig. 3. Southern Hybridization Analysis of Liverwort mtDNA Digested with XhoI Endonuclease with Different Probes (see Table I). Lanes 1 to 7 indicate hybridization patterns with probes; rrnI8 (lane 1) and rrn26 (lane 2) genes for small and large subunits of ribosomal RNA, atpA (lane 3) and atp6 (lane 4) genes for IX and 6 subunits of ATPase complex, and cox! (lane 5), coxll (lane 6), and coxllI (lane 7) genes for subunits I, II, and III, respectively, of cytochrome c oxidase complex. Left lanes of each indicate the patterns stained with ethidium bromide. The gene for IX subunit of ATPase complex was separated into two Xh4 and Xh7 fragments (see the text).
Fig. 5. Summary of Slot-blot Hybridization of Chloroplast Plasmid DNA with 32P-Labeled Liverwort mtDNA. Plasmid clones (shadowed), pMP323, pMP389, pMP376, and pMP055 containing chloroplast ribosomal RNA genes, were hybridized with liverwort mtDNA.
control
713 452 228 314 227 220 217 209 222 801 795 773 768 X601 X501 389
pMP802 323 699 152 151 103 101 102 171 703 721 055 376·
310 727
1
2
3
Gene organization
The mitochondrial genes were located on the physical map of liverwort mtDNA by heterologous hybridization. Liverwort mtDNA was digested with three restriction endonucleases, Kpn I, Pst I, and Xho I, used in mapping analysis and hybridized with clones containing known genes of other plants listed in Table I. Figure 3 shows only the analysis of Southern hybridization of Xho I fragments. All the probes were obviously hybridized with a single site (Fig. 3a-t) except for the atpA probe that hydridized with two continuous Xh4 and Xh7 fragments, indicating also a single copy of the atpA gene. Two rRNA genes (rrn18 and rrn26) as well as two cytochrome c oxidase genes (coxIl and coxIl/) were closely linked in the physical maps (Fig. 2). The two pairs possibly form operons, although neither are clustered in most plant mitochondrial genomes. 18, 19)
1
2
3
Fig. 4. Slot-blot Hybridization of Chloroplast Plasmid Clones with 32P-Labeled Liverwort mtDNA. Numbers indicate chloroplast plasmid c1ones. 20 ) Lanes 1 to 3 indicate the increasing amounts of blotted chloroplast plasmid DNA (6, 25, and 100 ng per 1kb length of plasmid DNA put on the filters, respectively). In the control, lane 1 is mtDNA blotted (lOng), and lanes 2 and 3 are plasmid pUC18 blotted (68ng and 270ng, respectively).
Hybridization to choroplast DNA clones
It has been reported that very high homologous sequences with ctDNA are inserted into mitochondrial genomes of plants. 9 ,10) To find whether inter-organelle sequnces exist between the liverwort mitochondrial and chloroplast genomes, we did slot-blot hybridization of liverwort mtDNA to clones covering the entire region of
NII-Electronic Library Service
Liverwort Mitochondrial DNA
135
to the mitochondrial fragments having 18S and 26S rRNA genes (Fig. 6). This indicates that the liverwort mitochondrial genome contained no detectable ctDNA fragments. Acknowledgments. This research was partly supported by a Grant-inAid for Scientific Research in Priority Areas from the Ministry of Education, Science, and Culture of Japan and by a research grant from the Yamada Science Foundation.
265 (Xh10)
References 1) 2)
185
(Xh13a) 3)
4) 5)
Downloaded by [117.255.234.86] at 12:47 05 November 2015
6) 7)
12 Fig. 6. Southern Hybridization of XhoI-digested Liverwort mtDNA with a Probe of the Mixture of the Chloroplast Plasmid Clones (pMP323, pMP389, pMP376, and pMP055) Containing Liverwort Chloroplast Ribosomal RNA Genes. Hybridized bands, 10th and 13th XhoI fragments of liverwort mtDNA, were fragments containing mitochondrial ribosomal RNA genes (26S and 18S, respectively) (see also lanes I and 2 in Fig. 3). Lane 1 is a pattern of XhoI-digested fragments stained with ethidivm bromide.
liverwort ctDNA. 20 ) Positive signals were detected in four clones; pMP389, pMP376, pMP055, and pMP323 (Fig. 4 and 5). The four clones contained either the 16S or 23S rRNA gene of the chloroplast genome. To confirm a possibility that the signals were caused by sequence conservation between mitochondrial and chloroplast rRNA genes, we hybridized the mixture of four clones having ct-rRNA genes as probes to the liverwort mtDNA digested with the Xho I enzyme used in the mapping. They hybridized
8) 9) 10) 11) 12)
13)
14) 15) 16) 17) 18) 19) 20)
P. Lebacq and F. Vedel, Plant Science Lett., 23, 1-9 (1981). B. L. Ward, R. S. Anderson, and A. J. Bendich, Cell, 25, 793-803 (1981). S. Anderson, A. T. Bankier, B. G. Barrell, M. H. L. de Bruijn, A. R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlich, B. A. Roe, F. Sanger, P. H. Schreier, A. J. H. Smith, R. Staden, and I. G. Young, Nature, 290, 457-465 (1981). M. de Zamaroczy and G. Bernardi, Gene, 37, 1-17 (1985). D. J. Cummings, K. L. McNally, 1. M. Domenico, and E. T. Matsuura, Curro Genet., 17, 375-402 (1990). J. D. Palmer and C. R. Shields, Nature, 307, 437-440 (1984). D. M. Lonsdale, T. P. Hodge, and C. M.-R. Fauron, Nucl. Acids Res., 12,9249-9261 (1984). 1. D. Palmer and L. A. Herbon, ,Curro Genet., ll, 565-570 (1987). D. B. Stem and D. M. Lonsdale, Nature, 299, 698-702 (1982). D. M. Lonsdale, T. P. Hodge, C. J. Howe, and D. B. Stem, Cell, 34, 1007-1014 (1983). K. 000, K. Ohyama, and O. L. Gamborg, Plant Sci. Lett., 14, 225-229 (1979). T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual" Cold Spring Harbor Labortory Press, Cold Spring Harbor, NY., 1982, pp. 93-94. K. Oda, K. Yamato, E. Ohta, Y. Nakamura, M. Takemura, N. Nozato, K. Akashi, T. Kanegae, Y. Ogura, T. Kohchi, and K. Ohyama, J. Mol. Bioi., in press. A. Morikami and K. Nakamura,J. Biochem., 101,967-976(1987). W. Schuster and A. Brennicke, Nucl. Acids Res., 15,9092 (1987). R. Hiesel, W. Schobel, W. Schuster, and A. Brennicke, EMBO J., 6,29-34 (1987). R. Hiesel and A. Brennicke, EMBO J., 2, 2173-2178 (1983). K. J. Newton, Ann. Rev. Plant Physiol., Plant Mol. Bioi., 39,503-532 (1988). T. Brears and D. M. Lonsdale, Mol. Gen. Genet., 214, 514-522 (1988). K. Ohyama, H. Fukuzawa, T. Kohchi, T. Sano, S. Sano, H. Shirai, K. Umesono, Y. Shiki, M. Takeuchi, Z. Chang, S. Aota, H. Inokuchi, and H. Ozeki, J. Mol. Bioi., 203, 281-298 (1988).
NII-Electronic Library Service
