Proc. Nati. Acad. Sci. USA Vol. 89, pp. 9141-9145, October 1992 Biochemistry

Leukotriene A4 hydrolase: Abrogation of the peptidase activity by mutation of glutamic acid-296 ANDERS WETTERHOLM*, JUAN F. MEDINA*, OLOF RXDMARK*, ROBERT SHAPIROt, JESPER Z. HAEGGSTR6M*, BERT L. VALLEEt, AND BENGT SAMUELSSON* *Department of Physiological Chemistry, Karolinska Institutet, Box 60 400, S-104 01 Stockholm, Sweden; and tCenter for Biochemical and Biophysical Science and Medicine, Harvard Medical School, 250 Longwood Avenue, Boston, MA 02115

Contributed by Bengt Samuelsson, May 13, 1992

lase (9, 10). Accordingly, LTA4 hydrolase was found to contain one atom of zinc per enzyme molecule (11-13) and also to exhibit peptidase activity toward synthetic substrates (12-14). The primary function of the metal seems to be catalytic because removal of the zinc atom resulted in loss of both enzymatic activities, which could be restored by addition of stoichiometric amounts of zinc or cobalt (11, 13, 14). In agreement with the sequence predictions, the three zincbinding ligands were identified as His-295 (L1), His-299 (L2), and Glu-318 (L3) by site-directed mutagenesis and zinc analysis (15). Besides the three amino acids involved in zinc coordination, some of the zinc proteases and aminopeptidases, including LTA4 hydrolase, also share a conserved glutamic acid residue in juxtaposition to one (L1) of the primary zinc-binding ligands (ref. 10; Fig. 1). From x-ray crystallographic data, Glu-143 in thermolysin, a typical example of such zinc hydrolases, has been implicated in the proteolytic mechanism of this enzyme (16, 17). In the present study, we replaced Glu-296, the corresponding amino acid in LTA4 hydrolase, with a glutamine or alanine residue, purified the mutated proteins, and studied the effects of these mutations on the enzyme activities.

The metal-binding motif in the sequence of ABSTRACT leukotriene A4 (LTA4) (EC 3.3.2.6), a bifunctional zinc metalloenzyme, contains a glutamic acid that is conserved in several zinc hydrolases. To study its role for the two catalytic activities, Glu-296 in mouse leukotriene A4 hydrolase was replaced by a glutamine or alanine residue by site-directed mutagenesis. Wildtype and mutated cDNAs were expressed four or five times in Escherichia coli, and the resulting proteins were purified to apparent homogeneity. With respect to their epoxide hydrolase activities-i.e., the conversion of LTA4 into leukotriene B4-the mutated enzymes [Gln296]LTA4 hydrolase and [Ala296]LTA4 hydrolase exhibited specific activities of 1070 ± 160 and 90 ± 30 nmol of LTB4 per mg of protein per min (mean + SD; n = 4 or 5), respectively, corresponding to 150% and 15% of unmutated enzyme. In contrast, when the mutated proteins were assayed for peptidase activity toward alanine-4-nitroanilide, they were found to be virtually inactive (c0.2% of unmutated enzyme). To serve as a positive control, we also replaced Ser-298 with an alanine residue, which resulted in a protein ([Ala]LTA4 hydrolase) with catalytic properties almost indistnguishable from the wild-type enzyme. Substitution of Glu-296 by glutamine or alanine was also carried out with human LTA4 hydrolase, and the mutated human enzymes displayed specific activ. ities similar to the corresponding mouse proteins. Zinc analyses of the purified mouse and human proteins confirmed that the mutations did not significantly influence their zinc content. In conclusion, the results of the present study indicate a direct catalytic role for Glu-296 in the peptidase reaction of LTA4 hydrolase, where it presumably acts as a base to polarize water, whereas its function, if any, is apparently not essential in the epoxide hydrolase reaction.

MATERIALS AND METHODS LTA4 methyl ester (Merck Frosst Labs, Pointe Claire, PQ, Canada) was saponified in tetrahydrofuran with 1 M LiOH (6% vol/vol) for 48 hr at 4°C. Alanine-, leucine-, lysine-, valine-, methionine-, proline-, glycine-, and y-glutamyl-4nitroanilide were from Sigma. 4-Nitroaniline was from Merck. T7 sequencing kit, restriction endonucleases, and nucleic acid-modifying enzymes were purchased from Pharmacia. Vent DNA polymerase was from New England Biolabs. Oligonucleotides were synthesized by Scandinavian Gene Synthesis (Koping, Sweden). Site-Directed Mutagenesis of LTA4 Hydrolase cDNA and Expression in Escherichia coli. Mutations of recombinant mouse LTA4 hydrolase (a fusion protein with 10 additional amino acids at its N terminus; see ref. 8) were carried out by PCR mutagenesis as described (15). Primers A and B were JF21 and JF27 (15). Primer C, the mutagenetic primer (5' -* 3', site mutation underlined), was one of the following: JF26 [d(CAAATATCTCATAGCTGGACAGG)] for [Gln296]LTA4 hydrolase, which for simplicity we call E296Q in single letter code for the Glu-296 -+ Gln amino acid change); JF36 [d(GCAATATCTCATAGCTGGACAGG)] for [Ala296]LTA4 hydrolase, which we call E296A for the Glu-296 -- Ala amino

Leukotriene A4 (LTA4) hydrolase (EC 3.3.2.6) is a key enzyme in the biosynthesis of leukotrienes and catalyzes the hydrolysis of the unstable epoxide LTA4 [5(S)-trans-5,6-

oxido-7,9-trans-11,14-cis-eicosatetraenoic acid] into the proinflammatory substance leukotriene B4 [LTB4; 5(S), 12(R)-dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid] (1). The formation of LTA4 is in turn catalyzed by the enzyme 5-lipoxygenase and involves the dioxygenation of arachidonic acid with subsequent epoxide formation. LTA4 hydrolase has been purified from a variety of sources as a soluble, monomeric protein of Mr 69 kDa (for reviews, see refs. 2 and 3). The enzyme is inactivated by the substrate LTA4, an effect that seems directly coupled to the enzyme catalysis (4). The cDNAs coding for the human and mouse enzymes have been cloned, sequenced, and expressed in Escherichia coli (5-8). Recently, sequence comparisons with certain zinc metalloenzymes-e.g., thermolysin and aminopeptidase M-revealed the presence of a zinc-binding motif in LTA4 hydro-

Abbreviations: LTA4, leukotriene A4, 5(S)-trans-5,6-oxido-7,9-trans11,14-cis-eicosatetraenoic acid; LTB4, leukotriene B4, 5(S),12(R)dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid; PGB1, prostaglandin B1; RT, room temperature; E296Q, [Gln296]LTA4 hydrolase; hE296Q, human E296Q; E296A, [Ala29]LTA4 hydrolase; hE296A, human E296A; S298A, [Ala2%]LTA4 hydrolase; H295Y, [Tyr295]LTA4 hydrolase.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

9141

9142

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Wetterholm et al. Li

Thermolysin

V V A

L2

HE L T HA V T 142

Leukotriene A4 hydrolase

V I A

146

H E i S H SW T 295

Aminopeptidase M

V I A

299

H E L A H QW F 388

Neutral endopeptidase

392

V I G H E I TH G F D 583 587

L3

G A I N E A I S D 166

F W L N E G H T V 318

L W L N E G F A S 411

N T L G E N I A D 646

FIG. 1. Comparison of the zinc binding regions of thermolysin and LTA4 hydrolase, with the proposed zinc sites of neutral endopeptidase and aminopeptidase M. Adapted from ref. 10.

acid change; and JF39 [d(GAAATAGCTCATAGCTGGACAGG)] for [AlaW]LTA4 hydrolase, which we call S298A for the Ser-298

-*

Ala amino acid

change-all phosphorylated

at

their 5' end. Primer D was JF13 [d(AATCAGCAACAATCAGTTCCT)], a reverse primer matching nucleotides 1856-1836 (according to the cDNA numbering in ref. 8). E296Q was also constructed with JF24 [d(GATGCATGCTGGCTTTATGC)] as primer D, which yields an isoform of the enzyme with a lysine instead of an arginine residue in position 592 ([Gln29

,

Lys592]LTA4 hydrolase) (8). For the construction of [Tyr295]LTA4 hydrolase, which

we

call H295Y for the His-295

-+

Tyr

change, see ref. 15. Mutagenesis of human LTA4 hydrolase was performed as described by Taylor et al. (18), using the oligonucleotides (5'

--

3', mutated bases underlined): d(AT-

GAGATATTTGATGTGCAAT) for human E296Q (hE296Q) and d(ATGAGATATTQCATGTGCAAT) for human E296A (hE296A). Mutated proteins were expressed in E. coli (JM 101) transformed with the corresponding mutated plasmid, as described (15). Sequence analysis of the entire cDNA inserts confirmed that no alterations of the protein primary structures, other than the desired mutations, had occurred. Purification ofRecombinant LTA4 Hydrolase. Both mutated and unmutated proteins were purified essentially as described (13). The procedure involved precipitations, anion exchange, hydrophobic interaction, and chromatofocusing chromatographies and resulted in apparently homogeneous proteins. The yield was -0.5-1 mg of protein per liter of cell culture. After the final purification step, the buffer was changed to 10 mM Tris chloride (pH 8) by repeated centrifugation on a Centricon-30 microconcentrator (Amicon), and the protein was stored at 4°C. SDS/PAGE was performed on a Phast system (Pharmacia) with 10-15% gradient gels. Bands of protein were visualized by staining with Coomassie brilliant blue. Protein concentrations were determined by the Bradford method (19) with bovine serum albumin as standard. Determinations of Enzyme Activities. Specific epoxide hydrolase activities (i.e., the hydrolysis of the epoxide LTA4 into LTB4) of wild-type and mutated enzymes were determined at room temperature (RT) from duplicate incubations of enzyme (2.5-26 jig in 100 ,ul of 50 mM Hepes or Tris chloride, pH 8) with 30-60 ,uM LTA4 added in 1 ,lI of tetrahydrofuran. After 15 s, the reaction was quenched with 200 .ul of methanol, and the internal standard, prostaglandin B1 (PGB1; Upjohn), was added. The samples were acidified to pH 3 with 0.1 M HCl immediately before reverse-phase HPLC analysis, which was performed on a column (RadialPak C18 cartridge, 100 x 5 mm; Waters) eluted with a mixture

of acetonitrile/methanol/water/acetic acid, 29:34:39:0.01 (vol/vol), at a flow rate of 0.8 ml/min. The absorbance of the eluate was monitored continuously at 270 nm. Quantitations of LTB4 were made by measurements of peak height ratios between LTB4 and PGB1 as described (20). The specific peptidase activities were determined spectrophotometrically essentially as described (21) in 50 mM Tris chloride (pH 7.5) containing 100 mM NaCI. The assays were performed in the wells of a microtiterplate by incubating the enzyme (1-26 pug) with 1 mM alanine4-nitroanilide in 250 !tl buffer at RT. The formation of product (4-nitroaniline) was measured as the increase in absorbance at 405 nm by using a multiscan spectrophotometer, MCC/340 (Labsystems, Helsinki). Quantitations were made from a standard curve obtained with known amounts of 4-nitroaniline in 50 mM Tris chloride (pH 8). Spontaneous hydrolysis of the substrate was corrected for by subtracting the absorbance of control incubations without enzyme. Reaction rates were calculated from the increase in A405 over the first 20 min (unmutated enzymes and S298A) or 4-5 hr (E2%Q, E2%A, H295Y, hE296Q, and hE296A) of incubation. Zinc Analyses. Prior to zinc analyses, the proteins were washed by repeated ultrafiltration on a Centricon-30 microconcentrator by using 5-10 mM Tris chloride (pH 8) prepared from reagent grade Tris and Milli-Q water (WatersMillipore). Zinc determinations were performed by electrothermal atomic absorption spectrometry with a Perkin-Elmer model 5000 atomic absorption spectrophotometer equipped with a HGA 500 graphite furnace, as described (15). The result obtained for each batch of enzyme is an average of duplicate determinations on two different dilutions of sample. Protein concentrations were determined by amino acid analysis with the Pico Tag (Waters/Millipore) methodology.

RESULTS Glu-296 in recombinant mouse LTA4 hydrolase was substituted by a glutamine or alanine residue by site-directed mutagenesis, and the resulting cDNAs were expressed in E. coli. Four or five batches (obtained from separate expressions) of wild-type and mutated proteins E296Q and E296A were purified to apparent homogeneity and assayed for epoxide hydrolase and peptidase activity (Fig. 2). For each batch, the specific activity was calculated from one to seven analyses. E296Q (2.5 ,ug) was found to convert LTA4 into LTB4 with a specific activity of 1070 + 160 nmol of LTB4 per mg of protein per min (mean + SD, n = 5) corresponding to 150%o of the unmutated enzyme, which exhibited a specific activity of 700 + 90 nmol/mg per min (n = 5) (Table 1).

Biochemistry: Wetterholm et al. 1

2

3

4

Proc. Natl. Acad. Sci. USA 89 (1992) 5

94.0 67.0

43.0-o 30.0

20.1 -' 14.4 ; FIG. 2. SDS/PAGE of purified mutated and wild-type recombinant mouse LTA4 hydrolase proteins. The mutated proteins S298A

(lane 2), E2%A (lane 3), and E296Q (lane 4) and wild-type mouse LTA4 hydrolase (lane 5) (0.5 ,ug each) were electrophoresed on a Phast-Gradient gel 10-15 (Pharmacia Phast System) and stained with Coomassie brilliant blue. The molecular mass markers (lane 1) were phosphorylase b (94.0 kDa), bovine serum albumin (67.0 kDa), ovalbumin (43.0 kDa), carbonic anhydrase (30.0 kDa), soybean trypsin inhibitor (20.1 kDa), and a-lactalbumin (14.4 kDa).

Replacement of Glu-296 by an alanine residue resulted in a protein (E296A) with significantly reduced albeit clearly detectable epoxide hydrolase activity. From incubations of 10 ,ug of E296A, this activity was calculated to be 90 30 nmol/mg per min (n = 4, Table 1). When 1 ,g of unmutated enzyme was incubated for 20 min with alanine4-nitroanilide, the peptidase activity was calculated to be 280 60 nmol of 4-nitroaniline per mg of protein per min (n = 5). Under somewhat different conditions (10-25 ,ug of protein and 4-5 hr of incubation), E2%Q and E2%A hydrolyzed alanine-4-nitroanilide with specific activities of 0.6 0.8 and 0.4 0.4 nmol/mg per min (n = 4-5, Table 1). E296Q was also essentially inactive towards leucine-, lysine-, valine-, methionine-, proline-, glycine-, and y-glutamyl4nitroanilide (data not shown). In contrast to the effects of mutagenetic replacements at position 2%, replacement of Ser-298 with an alanine residue resulted in a mutated protein (S298A) that had intact epoxide hydrolase activity and retained 75% of the peptidase activity (Table 1). Another previously constructed mutant H295Y, in ±

±

±

±

9143

which one of the zinc binding ligands (His-295) has been replaced with a tyrosine residue, did not exhibit any significant epoxide hydrolase or peptidase activity (0.01% and 80%o, but this effect was perhaps not unexpected considering the chemical differences between alanine and glutamic acid-e.g., polarity and length of the side chain. Nevertheless, we cannot exclude that Glu-296 in some way participates in the epoxide hydrolase reaction, although this particular amino acid is not a prerequisite for catalysis. Further studies with additional mutagenetic replacements at position 296 may clarify this point. When the zinc site of LTA4 hydrolase was identified and the catalytic role of the zinc atom for the epoxide hydrolase and peptidase activities was established (9-15), it seemed likely that the catalytic site was one and the same for both activities. This view was further strengthened by the observations that both activities were susceptible to inactivation by LTA4 and could be inhibited by bestatin and captopril, an inhibitor of angiotensin converting enzyme (12-14, 23, 24). However, in at least two ways the activities differ, indicating that the catalytically important amino acids are not identical for the peptidase and epoxide hydrolase reactions. First, we have observed that the peptidase activity is stimulated by several halides and other monovalent anions, most notably chloride and thiocyanate, in a fashion that suggests the presence of an anion binding site (25). The epoxide hydrolase activity was not stimulated by chloride but rather slightly inhibited. Second, the results of the present study indicate that Glu-296 (and particularly its carboxyl moiety) has a His 295 G}lu 296

His 299

Base

0I

Glu

0

H

^^OH HC NH.-

NH

-

C~ C-g-

H N

(\

/N2

H

CH3

(

Protondonor

FIG. 3. Putative reaction mechanism for the hydrolysis of ala-

nine-4-nitroanilide by LTA4 hydrolase, based on the models presented in refs. 16 and 17.

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Wetterholm et al. unique role in the peptidase mechanism but not in the epoxide hydrolase mechanism. Defined as all structural elements of the protein that participate in the catalytic reaction, the active sites thus seem to be overlapping rather than identical. In conclusion, the results of the present study establish an essential role of Glu-296 for the peptidase activity of LTA4 hydrolase. Furthermore, the relatively modest effects of mutations on the epoxide hydrolase activity suggest that Glu-296 has not been conserved to allow the biosynthesis of LTB4 from LTA4 but rather to maintain or develop some other biochemical function, yet to be identified. Since this glutamic acid residue and the binding motif of the catalytic zinc atom are shared between a number of zinc proteases and aminopeptidases (10), the implications of our results may pertain to other members of these enzyme families. We are greatly indebted to Ms. Eva Ohlson and Ms. Agneta Nordberg for excellent technical assistance. We also thank Dr. A. W. Ford-Hutchinson (Merck Frosst Labs) for the generous gift of LTA4. This project was financially supported by the Swedish Medical Research Council (03X-217), Stiftelsen Lars Hiertas minne and 0. E. & Edla Johanssons foundations, and Svenska Sillskapet f6r Medicinsk Forskning. 1. Samuelsson, B. (1983) Science 220, 568-575. 2. Samuelsson, B. & Funk, C. D. (1989) J. Biol. Chem. 264, 19469-19472. 3. RAdmark, 0. & Haeggstrom, J. (1990) Adv. Prostaglandin Thromboxane Leukotriene Res. 20, 35-45. 4. Orning, L., Jones, D. A. & Fitzpatrick, F. A. (1990) J. Biol. Chem. 265, 14911-14916. 5. Funk, C. D., Ridmark, O., Fu, J. Y., Matsumoto, T., J6rnvall, H., Shimizu, T. & Samuelsson, B. (1987) Proc. Natl. Acad. Sci. USA 84, 6677-6681. 6. Minami, M., Ohno, S., Kawasaki, H., Radmark, O., Samuelsson, B., Jornvall, H., Shimizu, T., Seyama, Y. & Suzuki, K. (1987) J. Biol. Chem. 262, 13873-13876. 7. Minami, M., Minami, Y., Emori, Y., Kawasaki, H., Ohno, S.,

8.

9. 10. 11.

9145

Suzuki, K., Ohishi, N., Shimizu, T. & Seyama, Y. (1988) FEBS Lett. 229, 279-282. Medina, J. F., Radmark, O., Funk, C. D. & Haeggstrom, J. Z. (1991) Biochem. Biophys. Res. Commun. 176, 1516-1524. Malfroy, B., Kado-Fong, H., Gros, C., Giros, B., Schwartz, J.-C. & Hellmiss, R. (1989) Biochem. Biophys. Res. Commun. 161, 236-241. Vallee, B. L. & Auld, D. S. (1990) Biochemistry 29, 5647-5659. Haeggstrom, J. Z., Wetterholm, A., Shapiro, R., Vallee, B. L. & Samuelsson, B. (1990) Biochem. Biophys. Res. Commun.

172, %5-970. 12. Minami, M., Ohishi, N., Mutoh, H., Izumi, T., Bito, H., Wada, H., Seyama, Y., Toh, H. & Shimizu, T. (1990) Biochem. Biophys. Res. Commun. 173, 620-626. 13. Wetterholm, A., Medina, J. F., Radmark, O., Shapiro, R., Haeggstrom, J. Z., Vallee, B. L. & Samuelsson, B. (1991) Biochim. Biophys. Acta 1080, 96-102. 14. Haeggstrom, J. Z., Wetterholm, A., Vallee, B. L. & Samuelsson, B. (1990) Biochem. Biophys. Res. Commun. 173, 431-437. 15. Medina, J. F., Wetterholm, A., Radmark, O., Shapiro, R., Haeggstrom, J. Z., Vallee, B. L. & Samuelsson, B. (1991) Proc. Natl. Acad. Sci. USA 88, 7620-7624. 16. Pangburn, M. K. & Walsh, K. A. (1975) Biochemistry 14, 4050-4054. 17. Kester, W. R. & Matthews, B. W. (1977) Biochemistry 16, 2506-2516. 18. Taylor, J. W., Ott, J. & Eckstein, F. (1985) Nucleic Acids Res. 13, 8764-8785. 19. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254. 20. Radmark, O., Shimizu, T., Jornvall, H. & Samuelsson, B. (1984) J. Biol. Chem. 259, 12339-12345. 21. Sjostrom, H., Nortn, O., Jeppesen, L., Staun, M., Svensson, B. & Christiansen, L. (1978) Eur. J. Biochem. 88, 503-511. 22. Devault, A., Nault, C., Zollinger, M., Fournie-Zaluski, M.-C., Roques, B. P., Crine, P. & Boileau, G. (1988) J. Biol. Chem. 263, 4033-4040. 23. Orning, L., Krivi, G. & Fitzpatrick, F. A. (1991) J. Biol. Chem. 266, 1375-1378. 24. Orning, L., Krivi, G., Bild, J., Aykent, S. & Fitzpatrick, F. A. (1991) J. Biol. Chem. 266, 16507-16511. 25. Wetterholm, A. & Haeggstrom, J. Z. (1992) Biochim. Biophys. Acta 1123, 275-281.