Biochimicaet BiophysicaActa, 1089(1991)339-344 © 1991 ElsevierScience PublishersB.V. 0167-4781/91/$03.50 ADONIS 01674781q100172B
339
BBAEXP 92268
Identification of the promoter region of the rat protein phosphatase 2Aa gene Y o s h i n o r i K i t a g a w a *, H i r o s h i S h i m a , K a z u n o r i S a s a k i a n d M i n a k o N a g a o Carcinogenesis Dicision, National Cancer Center Research Institute, Tokyo (Japan)
(Received24 January 1991)
Key words: Protein phosphatasc2A: Catalyticsubunit; GC box:CAT assay:CRE sequence We have cloned a genomic fragment containing the promoter region of the rat protein phosphatase 2 A a gene (PP.2Aa). A 1.6 kb fragment of the 5' flanking region was sequenced. Three major transcriptional initiation sites were identified by the primer extension method using rat liver mRNA and found to he located 225, 222 and 220 bases upstream of the translational initiation site, respectively. Bacterial ehioramphenicol acetyltransferasc (CAT) assay revealed that a 503 bp Sinai fragment containing the transcriptional initiation sites had promoter activity, which was stronger than that of the SV40 early promoter on the pSV2CAT plasmid when intreduced into NIH3T3 cells. Deletion of a 119 bp Sa¢ll fragment decreased its promoter activity considerably. The ln'omoter region has an extremely high GC content and does not contain either a 'TATA box' or a 'CAAT box' suggesting that this promoter can be classified as that of a 'house keeping' gene, although there is only one typical GC-box (GC~CGG) immediately preceding the transcriptional initiation sites. There is a 10 base pair palindrome, $'-GTGACGTEAC-3', 26 base pairs upstream of the + 1 transcriptional initiation site, which is highly conserved in many other genes, whose expression is regulated by cAMP. The promoter activity was shown to he increased by ferslmlin treatment (10 /tM) in NIH3T3 cells.
Introduction Protein phosphatase 2A (PP-2A) is one of four major serine-threonine specific protein phosphatascs [1] and has been isolated in various forms composed of catalytic and several regulatory subunits from various mammalian tissues [2]. cDNA cloning of the catalytic subunit of PP-2A from various mammalian eDNA libraries revealed the existence of two genes, PP-2A,~ and PP-2A[3 for homologous catalytic subunits [2-4]. In previous studies we found that the levels of transcripts of PP-2Aa and PP*2A~ differed in different tissues and cells [5]. Both genes were highly expressed in brain, and PP-2A/] was suggested to be involved in rat spermatogenesis [5].
* On leaveof absence from Health Science Laboratory,Institute for Fundamental Research, Suntory Research Center, Wakayamadai, Osaka, Japan. Correspondence: H. Shima. Carcinogenesis Division. National Cancer Center Research Institute, !-I, Tsukiji 5-Chome Chuo-ku, Tokyo 104, Japan.
The expressions of PP-2Aa and PP-2A/3 were greatly increased in rat liver tumors induced by food mutagens, 2-amino-3-me t hylimidazo[4,5-f ]quinoline (IQ) [4] and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MelQx) [6]. These findings suggest that the regulation of PP-2Aa and PP-2A[3 expression is altered in some cases of hepato-carcinogenesis. We observed that the expression level of PP-2Aa also increased during liver regeneration after partial hepatectomy (unpublished data). In this study we cloned a promoter region of the rat PP-2Aa gene to examine the transcriptional regulation of this gene. Materials and Methods
Screening of a genomic library. High molecular weight DNA was isolated from the liver of a 6-week-old male Fischer 344 rat (Charles River Japan Inc., Kanagawa) as described [7], and was partially digested with Mbol. The digest was fractionated on a linear density gradient of 10-40% sucrose. Fractions containing 10 to 20 kb fragments were pooled, and the fragments were ligated to the ADASH arms digested with BamHl and
340 HindIIl (Stratagene, San Diego). The resulting library was screened with an RNA probe corresponding to the first 0.25 kb fragment of PP-2Aa cDNA (5' end to the first Pcull site) transcribed from the T3 promoter in Bluescript vector and then with a 0.68 kb PculI fragment of the PP-2Aa cDNA coding region [3]. Plaque hybridization with the [ot-32p]UMP labeled RNA probe was performed overnight at 42°C in a solution of 50% formamide, 5 x SSC, 50 mM Tris-HCI (pH 7.5), 0.1% (w/v) sodium pyrophosphate, 1% sodium dodecyl sulfate (SDS), 0.2% polyvinylpyrrolidone (M, 400000), 5 mM EDTA and 150/zg/ml denatured salmon sperm DNA. Filters were washed at 55°C twice in 2 × SSC, 0.1% SDS for 15 min each and twice in 0.1 x SSC, 0.1% SDS for 15 min each. The conditions used with the nick-translated cDNA probe were as described previously [4]. Clones that gave positive reactions with both probes were isolated. Subcloning and sequencing, pA25 DNA was digested with PvulI and the resulting fragments were subcloned into the EcoRV site in Bluescript pKSM13 + vector (Stratagene, San Diego) (Fig. 1). On colony hybridization with the same RNA probe as for screening the genomic library, a clone that contained a 3.1 kb Pcull fragment spanning the ADASH arm was obtained (pC2). A 1.6 kb genomic fragment obtained by EcoRl digestion of pC2 was subcloned into the EcoRl site of Bluescript vector (pE8). Nucleotide sequences were determined directly on alkaline denatured supercoiled plasmid DNA by the dideoxy chain-termination method [8,9] with synthetic oligonucleotide primers. For resolution of compressions in the G-C rich regions, dITP or 7-deaza-dGTP [10] was used instead of dGTP. Primer extension analysis. A 30met single stranded DNA, 5 ' - C T C C G C A G T G C T C G G C C G C C G G C CGCT-GTG-3', corresponding to the region from + 47 to + 76 (P2 in Fig. 2), was synthesized as a primer and end-labeled using [3,-32P]ATP and T4 polynucleotide kinase. A sample of 6 / z g of poly(A) + RNA from rat liver or 10 # g of yeast tRNA and 0.3 pmol of the end-labele~i primer were denatured at 90°C for 5 min and then incubated at 60°C for 1 h in 20/~1 of buffer containing 10 mM Tris-HC! (pH 8.0), 1 mM EDTA and 0.25 M KCI. Hybridization was carried out at room temperature for 1.5 h. Then primer extension was performed in 75 mM KCI, 0.25 mM EDTA, 10 mM MgCI2, 25 mM Tris-HC! (pH 8.0), 10 mM DTI', 0.5 mM each of the four dNTPs, 100 /~g/ml of actinomycin o-mannitol, and 23 units of reverse transcriptase of AMV in a final volume of 80/LI. The DNA products were precipitated with ethanol and separated on a sequencing gel alongside a dideoxy sequencing ladder priming from the same primer used for primer extension experiments (Fig. 3A). Northern blot analysis. Samples of 5/zg of poly(A) + RNA isolated from rat liver were fractionated in 1.0%
formaldehyde-agarose gel and transferred to a nitrocellulose filter; 34 and 30mer single stranded DNAs complementary to P1 and P2 sequences, respectively (Fig. 2), were end-labeled using [y-32p]ATP and T4 polynucleotide kinase and used as probes (Fig. 3B). Plasmid constructions for CAT assay. Smal fragments of 0.50 and 0.53 kb of pE8 were ligated with the HindIIl linker and subcloned into a unique HindIIl site of pSV00CAT [11] to construct pS31 (in the sense direction to the cat gene) and pS33 (in the antisense direction to the cat gene), respectively. A 1.5 kb HindII! fragment of pE8 (there is a HindlIl site in the T3 promoter of Bluescript vector) was ligated to pSV00CAT to construct pS12 (in the sense direction to the cat gene), pSI2 was completely digested with EcoRV (in which the site is present just upstream of the ~tindIll site of polylinker of Biuescript vector), partially digested with SmaI and self-ligated to obtain psi2-1 and pS12-5, pS12AXSa and pS31ASa were made from pS12-5 and pS31 by deletion of a 0.7 kb XbaI-Sacll fragment and a 119 bp SacII fragment, respectively. All constructs are shown in Fig. 4A. DNA transfection and CAT assay. NIH3T3 cells were maintained in Duibecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum. Cells (0.5.106) were transfected with 10 ~g of plasmid/10 cm Petri dish by the calcium phosphate precipitation technique [12] and incubated with or without forskolin. Cell lysates were prepared 48 h after transfection. The reaction mixture for CAT assay contained 0.2 /~Ci of [14C]-chloramphenicol, 0.47 M Tris-HC! (pH 7.8), 0.53 mM acetyl-CoA and a cell lysate. Reaction mixtures contained the same amounts of protein, which were determined with a Bio-Rad protein assay system. Labeled chloramphenicol and acetylated derivatives were separated by ascending silica gel thin layer chromatography (CHCI3/methanol , 95:5)(Fig. 4B and Fig. 5).
Results Isolation of the 5' flanking region of the rat PP-2Aa gene To isolate the 5' flanking region of the PP-2Aa gene, we used two probes, an RNA probe corresponding to the 5' most 0.25 kb fragment of PP-2Aa eDNA (5' end to the first Pt,ull site) and a eDNA probe of the consecutive 0.68 kb PvulI fragment of the coding region [3]. Since the RNA probe contained 0.2 kb of the G-C rich 5' non-coding region (GC content, 82%), it hybridized non-specifically to many clones when used to screen 2.105 independent clones of a rat liver genomic library. Therefore, we next screened the genomic library with the 0.68 kb cDNA fragment. Three independent genomic clones, pA4, pal5 and pA25, that hybridized with both probes were isolated. Restriction analysis of these three clones revealed that their 5'
341 0
5
I
'
110
15 Kb
3.3 kb, that the c D N A probe also hybridized to the Y most Xbal fragment of 1.9 kb (see Fig. 1), and none to the other fragments. These findings indicated the presence of an intron of more than 8 kb in the middle portion of the cloned fragment. Within the 3.3 kb Xbal fragment, the 5' most X b a l - P c u l l fragment (1.6 kb) hybridized with the 0.25 kb R N A probe and the consecutive Pt•ull fragment hybridized with the 0.68 kb c D N A probe• We subcloned the 5' most 1.6 kb fragment of p,~25 (pE8, Fig. l). Nucleotide sequencing of this fragment (Fig. 2) revealed that the sequence of the 3' end of the 0.25 kb fragment was completely identical with that of the 5' end of the 0.25 kb fragment of c D N A used as a template of the R N A probe.
I
pk4, pA.15
p~s
pea
~....~, ~ ,~V :
~"
i
H
f
~
~
~
X
i
~
I
H
0.5Kb
[El
It~cDN A end
Fig. 1. Structure of the 5' region of the rat PP-24a gene. The maps of three genomic fragments cloned into ADASH vector (p,~4, pM5 and pA25) are shown at the top. The dark box represents the region that was hybridized with the RNA probe, corresponding to the first 0.25 kb fragment of PP-2,4. eDNA and the 0.68 kb l~,ull fragment of PP-2Aa eDNA coding region. The light box indicates the region that hybridized only with the 0.68 kb cDNA fragment. The region containing the promoter in pA25 was subcloned into blueseripl pKSM+ 13 plasmid vector (pC2 and pES). T3 and T7 in boxes indicate the promoter regions for T3 and 1"7 polymerases on bluescript vector. The broken lines on maps of pA25 and pC2 represent the fragments from ADASH vector. The 5' end of PP-2.4e eDNA is indicated by an arrow. Restriction sites: B, BamHI; E, EcoRI; H.
Determination o f the transcriptional initiation site by primer extension A single-stranded 30mer D N A corresponding to 1'2 (Fig. 2) was used as a primer for primer extension reactions• Poly(A) + R N A isolated from rat liver was used as a template. Three major extended D N A products of 71, 73 and 76 nucleotides in length were identified (Fig. 3A). From this result, the 5' most proximal major cap site was denoted as nucleotide + 1 (Fig. 2). Several minor cap sites may exist within the region from - 2 0 to + 1, since faint bands of some longer nucleotides were also observed. By Northern blot analysis of poly(A) + R N A from rat liver, with the P2 30mer probe (Fig. 2), 2.0 and 2.7 kb transcripts of the PP-2Aa gene were detected (Fig.
Hindlll; Pv, Pcull; S, Sinai; X, Xbal. ends were identical and that p,~4 and p a l 5 were completely identical clones with the length of 13 kb, while pA25 was about 2 kb longer at the 3' end than the others (Fig. 1). Southern blot analysis of pA25 demonstrated that the R N A and c D N A probes used for genomic screening both hybri,qzed to the 5' most XbaI fragment of .
.
.
.
-1300
.
.
.
.
.
GATCT6AGGTACTTT6TTCCGGAA•ACTAGTGGGAGGTACC•ACTAGAGACAG•AGAATTGGT•AAGCCAGTTCTT•TGGCCAAGCAGGTTGTCCTGGATAAAAGAGGATTCTCATCAGT . . . . -1200 . . . . . . . GCCATTTGTGGATGGGGCCACTGAGGCCATCTAAAG•TTGTGGGTCAGGGTGTCTTCTGAACCCTCTGAGCTGTGTCTTCTCCAGTGTGTGACAGGCTTGACTTTCCCACAGTAGAGCTA • . -Ii00 . . . . . . . GATCAGCTCTTGCCTTG••CTTCATGGATAA•TATCCTTTGGCTTCTATA•CT•TCAAACTATGGAGGAAAC•AGTGT•TTCCATC•ATTC••TTTC•AGC•AGGAAAGTT•AAG•TCCA "000 -900 ~CTGsG~AGCAG~CTTTTTG~TG6ATAA~CCCT~TAT~CT~TAAG~ATC~AAT6TGGT~AAGAGTTGACsCT~TGTAcAGCTAAGTATcT~TT6~ATsAAGACAGTGCAGTGTGAAc . . . . . -800 . • ACGTTTCACAA~CCCCAGAAGAGATTTATAACCAGGTCAAAGGCCGATCCTTAAGAATATCAGCTTCCTTTACAGACCACGCAGTAGTTGCTTCTACCAGCATC~GAACACAGCCCTGGC
• . -500 . . . . . . . GAGCCTGCAATGGCCAGAGGTGGAGAAGGTCACTCCAGGCAGCCTGCCACTAAGA~TCGGTTCTT~TCCCCAAAGATGTGGGGCT[CCTTGCGGTTCCCATGGCTGCTGGACAAAGCG -400 . . . . . T . -300 TTAAGGTTGCTTTTAGTCATCAGGCTGCCAGACCCCGGGCCACATCTGAGAAGTATCATCCAGCGGCCTTCCAGAAACAACAGGTCAAAG•GA•CCAGACCTCAC•TACACGGACTGCTC
• •
CC .
SmaI . . . . . . . -200 . • • ATGCG6CAAGTCTGCGCAGGCGCCCTGCTGAG~CTGGGGCT~cAGGAATA~CGGGGTA~GCCG~TTCCAGCACT~CGCTTGCT~CGACTC~CTTCTTCCCTTCCCCCCCGCCACCT~. . . . . . -100 . . . . . CGC GGAGGACCACGCCCCAAAAG•GAAGCCACTTCCTTTGGCAGTCAGCTTCGCTGCGCCTGCGCCTGGGCTCCACAGT•CGCAGcTCTGGGTCCCGGCCCCACTCC•TCGCCCTCCCC CGC~ Pt = sac~ +! GC~GCTCCCTGACGCCGGCGTG~CGTCACCACGC C[GGGcGGCCGCCATTACAGAAAGCCGAGTCCC~AGCTAGGGCGAGCGGAGGAGGA~G~AGCG~CCGGc~GCC~AGCAcT~CG~A ~ C * * * ~ c D N A end P2
sac~ 100 ~CGAGCCAGC°GGCCGGCGCCAGCGCCCAGCA°CC°CCTGGGG~CGCAGGAAG~ACcCCG~GGAGCGGCGGCGGCGT°T°C~T~TG°cCCG°°TGCGG~CGGCGGCGCGGGAGCA~C°CA
$maI M
Fig.
2.
Nucleotide sequence of the
5'
D
E
K
L
F
T
K
E
L
D
Q
W
I
E
Q
region of the rat PP-2A. gene. Nucleotides marked with stare represent the major transcriptmnal initiation
sites determined by primer e~ension. The 5' most proximal major cap site is denoted as nucleotide + 1. The locat~ns of the opposite strands of oligonucleotide PI and P2 used as probes for No.hem blot analysis are underlined. Three sets of direct repeam are shown by arrows. Two sets of dire~ repeats at the Sacll sites are shown by double arrows. The ten base pair pafindrom~ sequence is shown by a pair of arrows (head to head). The potential Spl binding site is shown by an open bo¢ The coding region is indMated by the sin@e Mt~m of amino acids.
342 B.
A.
A.
X I
S '
Sa Sa I I
S II '-. . . . . . . . =- mRNA
-I~
pS12.5 pS12-1 pS31
F
P1
pS33 pS12AXSa
P2
pS311Sa
B.
i
\i
~
~'
i
e
•
O
O
e
0
0
•
7
2.0 Kb
,
P2
Fig. 3. Determination of the transcriptional initiation sites by primer extension experiments (A) and Northern blot analysis (B). (A) Primer extension was performed with a 30mer oligonucleotide P2. The primer-extended DNA products were separated on a sequence gel alongside a didcoxy sequencing ladder (G, A, T, C) priming from the same primer. Samples of 6 /.tg of poly(A)+ RNA from a rat liver (lane I) and 10/~g of yeast tRNA (lane 2) were used as templates. Primer alone was also applied to the gel (lane 3). The sequence around the position of the three major cap sites which are marked with stars, is shown. (B) A sample of 5/tg of poly(A)+ RNA from rat liver was blotted and hybridized with oligonucleotides PI and P2. The position corresponding to the region PI is al~ indicated beside the sequencing ladder in A.
3B). Neither transcript of PP-2Aa was d e t e c t e d (Fig. 3B), with the P1 3 4 m e t probe corresponding to the region from - 7 2 to - 1 0 5 (Fig. 2). A 1.0 kb EcoRISmaI fragment of pE8 also detected n o transcript (data not shown). T h e s e results suggested that the length difference between the two kinds of transcripts of the PP-Z4a ( ~ 0.7 kb) is not due to the different initiation site but by o t h e r mechanisms such as poly(A) addition or alternative splicing. Usually the p r o m o t e r is localized within 110 base pairs u p s t r e a m from the transcriptional initiation site [13]. T h e putative p r o m o t e r region of the rat PP-2Aa gene has no ' T A T A box' o r ' C A A T box'. This region has a high G - C c o n t e n t (80% in t h e + 1 to - 1 0 0 region a n d 74% in the + 1 to - 2 0 0 region) a n d a unique potential binding site, G G G C G G , for the cellular transcription factor S p l [14] at position - 1 0 . A 10-base palindrome, 5 ' - G T G A C G T C A C - 3 ' , which is
e
e
e
e
e--:.
0
Fig. 4. Structures of promoter-CAT plasmids and their CAT activity. (A) The map of the genomic fragment in pE8 is shown at the top. Vectors for CAT assay were constructed on pSV00CAT as described in Materials and Methods. The orientations and lengths of fragments ligated to the cat gene are shown by arrows. Restriction sites: H, Hindlll: Sa. Sacll; S, Sinai: X, Xbal. B, Samples of 10 #g of plasmid DNAs were transfected into NIH3T3 cells (0.5- l06 cells/10 cm Petri dish) and their lysates were assayed for CAT activity. CM, chloramphenicol highly conserved in many o t h e r genes whose expressions are regulated by c A M P [15], is located at position - 26.
Identification of the promoter region by CAT a,;say T o define the p r o m o t e r region of the cloned fragment, we p r e p a r e d several constructs with D N A fragm e n t s of pE8 into the Hindlll site of pSV00CAT, as shown in Fig, 4A. pS12-5, containing a 1.3 kb HindIIlSma I f r a g m e n t of p E 8 (from nucleotide position - 1211 to + 134) showed significant C A T activity in N I H 3 T 3 cells (3-times that of pSV2CAT), pS12-1, containing the u p s t r e a m 0.8 kb region of this f r a g m e n t (position - 1 2 1 1 to - 3 7 0 ) , showed n o C A T activity, but pS31, pS12.5 I
pS31 II
I
ooeooe-c. f0rsk0lin 0 10 100 0 I0 100 ttH Fig. 5. Effect of forskolin on CAT activity of pS12-5 and pS31 in N1H3T3 cells. Plates containing 0.5-10' cells were transfected with l0/tg of pS12-5 and pS31. Transfected cells were treated with 10 or 100/zM forskolin or ethanol vehicle as a control for 43 h.
343 containing the downstream 0.5 ":b region (position - 3 6 9 to + 134), conferred more than half as much CAT activity as pS12-5. To define the essential region for promoter activity, we prepared deletion derivatives of pS12-5 and pS31. Deletion of the 0.7 kb Xbal-SacII fragment from pS12-5 (pS12AXSa)decreased the CAT activity significantly. The same degree of decrease in CAT activity was also observed on deletion of the 119 bp Sacll fragment from pS31 (pS31ASa). These results were confirmed by three independent experiments using two sets of different preparation of plasmids and suggest that the essential region for promoter activity of the PP-2Aa gene is in the 119 bp Sacll fragment (from position - 162 to - 44). pS12AXSa and pS31ASa still retained weak promoter activity, which contained a putative GC-box immediately upstream of the transcriptional initiation sites, pS33 contains the 0.53 kb Sinai fragment in the opposite orientation to the cat gene and showed a weak promoter activity, as in the case of pSI2AXSa and pS31ASa.
Regulation of transcription of the PPo2,4a gene by cAMP Since we found a 10-base palindrome, 5'-GTGACGTCAC-3', we examined whether the expression of the PP-2Aa gene is regulated by cAMP. NIH3T3 cells transfected with pS12-5 and pS31 were treated with forskolin, a direct activator of adenylate cyclase, for 43 h and then harvested. The CAT activities derived from pS12-5 and pS31 were induced 2.5- and 1.7-fold, respectively, by treatment with 10 ~tM/orskolin (Fig. 5). Discussion
in this study we isolated the 5' region of the rat PP-2Aa gene and identified the promoter regi~rl of this gene. The promoter region has no ' T A T A bo~" or ' C A A T box' and has an extremely high G-C cont.ent, suggesting that this promoter can be classified as that of a 'house keeping' gene. Since this promoter has no ' T A T A box', initiation of transcription occurred at several sites about 220 base pairs upstream of the translational initiation site, as observed with many 'house-keeping' genes. There is a GC-box (GGGCGG), possible Spl binding site, immediately preceding the transcriptional initiation site ( - 1 0 ) and the fragment containing this sequence was found to have promoter activity even when ligated in the opposite orientation to the cat gene (pS33 in Fig. 4), suggesting that this GC-box is functional and provides a basal transcription level. Deletion of the 119 bp SaclI fragment ( - 1 6 2 to - 4 4 ) from 0.5 kb Smal fragment decreased its promoter activity, more than 90%. Possibly the GC rich region(s) in the Sacll fragment is regulated by ETF, which binds to GC-box as well as GC-rich sequences
not recognized by SPI [16] or some other unknown transcriptional activator(s) that binds to specific GC rich sequences. At the two Sacll sites, there are two direct repeats of 12 nucleotides (CCCTCCCCGCGG), which can be a candidate for ETF binding sequence [16]. Within the Sacli fragment, a sequence of GGGCTCC, which exists as three direct repeats in the region of - 3 5 0 to - 5 0 , resides, although roles of this motif in promoter activity is not known. There is a 10 bp palindrome, 5'-GTGACGTCAC-3', 26 bp upstream of the transcriptional initiation site, which is highly conserved in many genes [15]. The heptanucleotide motif 5'-TGACGTCA-3' in this 10 bp palindrome has been proposed to be a consensus sequence for CREB, a cAMP response element binding protein [17] and ATF, a cellular transcription factor [18]. Promoters of a wide variety of genes such as those for somatostatin [15], proenkephalin [19], a-gonadotropin [20], fibronectin [21], c-los [22], adenovirus 5 E2-E4 [23-25], adenovirus 2 major late genes [26,27], HTLV-I LTR [23] and HTLV-I! LTR [22] contain a similar motif and are known to be regulated by cAMP. The activity of PP-1 can be inhibited by cAMP through the action of inhibitor-I which is activated by the cAMP-dependent protein kinase [28]. However, little is known about the regulation of PP-2A activity by cAMP. We found that the PP-2Aa promoter contained CRE and its activity was increased by forskolin. More experimental evidence is needed to establish the regulation; however, these findings suggest that cAMP regulates not only phosphorylation but also dephosphorylation mediated by both PP-I and PP-2A. We found previously that the treatment of raf and retll transformants with 10 nM okadaic acid, which is a potent inhibitor of PP-1 and PP-2A [29,30], resulted in reversion into flat morphology of these transformants [31]. The IC5o value of okadaic acid is 20 nM for the purified catalytic subunits of the PP-I and much less for PP-2A in vitro [30]. Thus, inhibition of some reaction(s) catalyzed by PP-2A may result in flat reversion of malignant cells. Recently, a 36 kDa cellular protein known to be associated with polyoma virus middle T and small t antigens was found to be identical to the catalytic subunit of PP-2A [32]. These findings suggest that PP-2A is involved in malignant transformation. We have reported that the PP-2Aa mRNA level is increased in rat liver tumors induced by IQ [4] and MelQx [6] and in regenerating liver (unpublished data). Therefore, it is important to determine the mechanism causing increase in the mRNA level of PP-2,4a. Possibly the specific GC rich sequences or CRE sequence found in the promoter region are involved in transcriptional activation in liver tumors and regenerating liver. Studies are also required on whether the increase of mRNA results in increase in the protein level, and the nature of the substrates in liver tumors.
344
Acknowledgments T h i s s t u d y w a s s u p p o r t e d by a G r a n t - i n - A i d f r o m the Ministry of Education, Science and Culture of Japan and a grant from the Ministry of Health and W e l f a r e for a C o m p r e h e n s i v e 1 0 - Y e a r S t r a t e g y o f C a n c e r C o n t r o l , J a p a n . K. Sasaki w a s t h e r e c i p i e n t o f a Research Resident Fellowship from the Foundation for P r o m o t i o n o f C a n c e r R e s e a r c h . W e also t h a n k D r s . H. Y o s h i z u m i a n d Y. S u w a o f t h e S u n t o r y R e s e a r c h C e n t e r for t h e s u p p o r t o f this study.
References I lngebrit~n, T.S. and Cohen, P. (1983) Science 221,331-338. 2 Cohen, P. (1989) Annu. Rev. Biochem. 58, 453-508. 3 Kitagawa, Y., Tahira, T., lkeda, !., Kikuchi. K., Tsuiki, S., Sugimura, T. and Nagao, M. (1988) Biochim. Biophys. Acta 951, 123-129. 4 Kitagawa, Y., Sakai. R., Tahira, T., Tsuda, H., ito, N., Sugimura, T. and Nagao, M. (1988) Biochem. Biophys. Res. Comman. 157, 821-827. 5 Kitagawa. Y., Sasaki, K., Shima, H., Shibuya, M., Yanagida, M., Sugimura, T. and Nagao, M. (1990) Bioehem. Biophys. Res. Commun. 171,230-235. 6 Sasaki, K., Shima, H., Kitagawa, Y., lrino, S., Sugimura, T. and Nagao, M. (1990) Jpn. J. Cancer Res. 170. 169-175. 7 Pel!icer, A., Wigler, M., Axel. R. and Silverstein, S. (1978) Cell 14, 133-141. 8 Chert, E. J. and Seeburg, P. H. (1985) DNA 4, 165-170. 9 Sanger, F., Nicklen, S. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74. 5463-5467. 10 Mizusawa, S., Nishimura, S. and Seela. F. (1986) Nucleic Acids Res. 14, 1319-1324. 11 Araki, E., Shimada, F., Shichiri, M., Mori, M. and Ebina, Y, (1988) Nucleic Acids Res. 16, 1627.
12 Graham, M. A. and Van der Eb, A. (1973) Virology 52, 456-45729. 13 Maniatis, T., Goodbourn, S. and Fischer, J.A. (1987) Science 236, 1238-1245. 14 Dynan, W.S. and Tjian. R. (1985) Nature 316, 774-778. 15 Montminy, M~R., Sevarino, K.A., Wagner, J,A., Mandel, G. and Goodman, R.H. (1986) Proc. Natl. Acad. Sci. USA 83, 6682-6686. 16 Kageyama, R., Merlino, G.T. and Pastan, !. (1989)J. Biol. Chert. 264, 15508-15514. 17 Montminy, M.R. and Bilezikjian, L.M. (1987) Nature 328, 175178. 18 Lee, K.A.W., Hal, T.Y., SivaRaman, L., Thimmappaya, B., Hurst, H.C., Jones, N.C. and Green, M. (1987) Proc. Natl. Acad. Sci. USA 84, 8355-8359. 19 Terao, M., Watanabe, Y., Mishina, M. and Numa, S. 0983) EMBO J. 2, 2223-2228. 20 Darnell, R.B. and Boime, 1. (1985) Mol. Cell. Biol. 5, 3157-3167. 21 Jones, N.C., Rigby. P.W.J. and Ziff, E.W. (1988) Genes Dev. 2. 267-281. 22 Van Beveren, C., Van Straaten, F., Curran, T., Muiller, R. and Verma, I.M. (1983) Cell 32, 1241-1255. 23 Berk, A.J. (1986) Annu. Rev. Genet. 20, 45-79. 24 Hurst, H.C. and Jones, N.C. (1987) Genes and Dev. 1, 1132-1145. 25 Hanaka, S., Nishigaki, T., Sharp, P.A. and Handa, H. (1987) Mol. Cell. Biol. 7, 2578-2587. 26 Sawagodo, M. and Roeder. R.G. (1985) Cell 43, 165-175. 27 Carthew, R.W.. Chodosh, L.A. and Sharp. P.A. (1985) Cell 43, 439-448. 28 Cohen, P. (1985) Eur. J. Biochen'. 151,439-448. 29 Bialojan, C. and Takai, A. (1988) Biochem. J. 256, 283-290. 30 Haystead, T.AJ., Sire, A.T.R., Carling, D., Honnor, R.C., Tsukitani, Y., Cohen, P. and Hardie, D.G. (1989) Nature 337, 78-81. 31 Sakai, R., lkeda, I., Kitani, H., Fujiki, H., Takaku, F., Rupp, U., Sugimura, T. and Nagao, M. (1989) Proc. Natl. Acad. Sci. USA 86, 9946-9950. 32 Pallas, D.C., Shahrik, L.K., Martin, B.L., Jaspers, S., Miller, T.B.. Brautigan, D.L. and Roberts, T.M. (1990) Cell, 60, 167-176.
339
BBAEXP 92268
Identification of the promoter region of the rat protein phosphatase 2Aa gene Y o s h i n o r i K i t a g a w a *, H i r o s h i S h i m a , K a z u n o r i S a s a k i a n d M i n a k o N a g a o Carcinogenesis Dicision, National Cancer Center Research Institute, Tokyo (Japan)
(Received24 January 1991)
Key words: Protein phosphatasc2A: Catalyticsubunit; GC box:CAT assay:CRE sequence We have cloned a genomic fragment containing the promoter region of the rat protein phosphatase 2 A a gene (PP.2Aa). A 1.6 kb fragment of the 5' flanking region was sequenced. Three major transcriptional initiation sites were identified by the primer extension method using rat liver mRNA and found to he located 225, 222 and 220 bases upstream of the translational initiation site, respectively. Bacterial ehioramphenicol acetyltransferasc (CAT) assay revealed that a 503 bp Sinai fragment containing the transcriptional initiation sites had promoter activity, which was stronger than that of the SV40 early promoter on the pSV2CAT plasmid when intreduced into NIH3T3 cells. Deletion of a 119 bp Sa¢ll fragment decreased its promoter activity considerably. The ln'omoter region has an extremely high GC content and does not contain either a 'TATA box' or a 'CAAT box' suggesting that this promoter can be classified as that of a 'house keeping' gene, although there is only one typical GC-box (GC~CGG) immediately preceding the transcriptional initiation sites. There is a 10 base pair palindrome, $'-GTGACGTEAC-3', 26 base pairs upstream of the + 1 transcriptional initiation site, which is highly conserved in many other genes, whose expression is regulated by cAMP. The promoter activity was shown to he increased by ferslmlin treatment (10 /tM) in NIH3T3 cells.
Introduction Protein phosphatase 2A (PP-2A) is one of four major serine-threonine specific protein phosphatascs [1] and has been isolated in various forms composed of catalytic and several regulatory subunits from various mammalian tissues [2]. cDNA cloning of the catalytic subunit of PP-2A from various mammalian eDNA libraries revealed the existence of two genes, PP-2A,~ and PP-2A[3 for homologous catalytic subunits [2-4]. In previous studies we found that the levels of transcripts of PP-2Aa and PP*2A~ differed in different tissues and cells [5]. Both genes were highly expressed in brain, and PP-2A/] was suggested to be involved in rat spermatogenesis [5].
* On leaveof absence from Health Science Laboratory,Institute for Fundamental Research, Suntory Research Center, Wakayamadai, Osaka, Japan. Correspondence: H. Shima. Carcinogenesis Division. National Cancer Center Research Institute, !-I, Tsukiji 5-Chome Chuo-ku, Tokyo 104, Japan.
The expressions of PP-2Aa and PP-2A/3 were greatly increased in rat liver tumors induced by food mutagens, 2-amino-3-me t hylimidazo[4,5-f ]quinoline (IQ) [4] and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MelQx) [6]. These findings suggest that the regulation of PP-2Aa and PP-2A[3 expression is altered in some cases of hepato-carcinogenesis. We observed that the expression level of PP-2Aa also increased during liver regeneration after partial hepatectomy (unpublished data). In this study we cloned a promoter region of the rat PP-2Aa gene to examine the transcriptional regulation of this gene. Materials and Methods
Screening of a genomic library. High molecular weight DNA was isolated from the liver of a 6-week-old male Fischer 344 rat (Charles River Japan Inc., Kanagawa) as described [7], and was partially digested with Mbol. The digest was fractionated on a linear density gradient of 10-40% sucrose. Fractions containing 10 to 20 kb fragments were pooled, and the fragments were ligated to the ADASH arms digested with BamHl and
340 HindIIl (Stratagene, San Diego). The resulting library was screened with an RNA probe corresponding to the first 0.25 kb fragment of PP-2Aa cDNA (5' end to the first Pcull site) transcribed from the T3 promoter in Bluescript vector and then with a 0.68 kb PculI fragment of the PP-2Aa cDNA coding region [3]. Plaque hybridization with the [ot-32p]UMP labeled RNA probe was performed overnight at 42°C in a solution of 50% formamide, 5 x SSC, 50 mM Tris-HCI (pH 7.5), 0.1% (w/v) sodium pyrophosphate, 1% sodium dodecyl sulfate (SDS), 0.2% polyvinylpyrrolidone (M, 400000), 5 mM EDTA and 150/zg/ml denatured salmon sperm DNA. Filters were washed at 55°C twice in 2 × SSC, 0.1% SDS for 15 min each and twice in 0.1 x SSC, 0.1% SDS for 15 min each. The conditions used with the nick-translated cDNA probe were as described previously [4]. Clones that gave positive reactions with both probes were isolated. Subcloning and sequencing, pA25 DNA was digested with PvulI and the resulting fragments were subcloned into the EcoRV site in Bluescript pKSM13 + vector (Stratagene, San Diego) (Fig. 1). On colony hybridization with the same RNA probe as for screening the genomic library, a clone that contained a 3.1 kb Pcull fragment spanning the ADASH arm was obtained (pC2). A 1.6 kb genomic fragment obtained by EcoRl digestion of pC2 was subcloned into the EcoRl site of Bluescript vector (pE8). Nucleotide sequences were determined directly on alkaline denatured supercoiled plasmid DNA by the dideoxy chain-termination method [8,9] with synthetic oligonucleotide primers. For resolution of compressions in the G-C rich regions, dITP or 7-deaza-dGTP [10] was used instead of dGTP. Primer extension analysis. A 30met single stranded DNA, 5 ' - C T C C G C A G T G C T C G G C C G C C G G C CGCT-GTG-3', corresponding to the region from + 47 to + 76 (P2 in Fig. 2), was synthesized as a primer and end-labeled using [3,-32P]ATP and T4 polynucleotide kinase. A sample of 6 / z g of poly(A) + RNA from rat liver or 10 # g of yeast tRNA and 0.3 pmol of the end-labele~i primer were denatured at 90°C for 5 min and then incubated at 60°C for 1 h in 20/~1 of buffer containing 10 mM Tris-HC! (pH 8.0), 1 mM EDTA and 0.25 M KCI. Hybridization was carried out at room temperature for 1.5 h. Then primer extension was performed in 75 mM KCI, 0.25 mM EDTA, 10 mM MgCI2, 25 mM Tris-HC! (pH 8.0), 10 mM DTI', 0.5 mM each of the four dNTPs, 100 /~g/ml of actinomycin o-mannitol, and 23 units of reverse transcriptase of AMV in a final volume of 80/LI. The DNA products were precipitated with ethanol and separated on a sequencing gel alongside a dideoxy sequencing ladder priming from the same primer used for primer extension experiments (Fig. 3A). Northern blot analysis. Samples of 5/zg of poly(A) + RNA isolated from rat liver were fractionated in 1.0%
formaldehyde-agarose gel and transferred to a nitrocellulose filter; 34 and 30mer single stranded DNAs complementary to P1 and P2 sequences, respectively (Fig. 2), were end-labeled using [y-32p]ATP and T4 polynucleotide kinase and used as probes (Fig. 3B). Plasmid constructions for CAT assay. Smal fragments of 0.50 and 0.53 kb of pE8 were ligated with the HindIIl linker and subcloned into a unique HindIIl site of pSV00CAT [11] to construct pS31 (in the sense direction to the cat gene) and pS33 (in the antisense direction to the cat gene), respectively. A 1.5 kb HindII! fragment of pE8 (there is a HindlIl site in the T3 promoter of Bluescript vector) was ligated to pSV00CAT to construct pS12 (in the sense direction to the cat gene), pSI2 was completely digested with EcoRV (in which the site is present just upstream of the ~tindIll site of polylinker of Biuescript vector), partially digested with SmaI and self-ligated to obtain psi2-1 and pS12-5, pS12AXSa and pS31ASa were made from pS12-5 and pS31 by deletion of a 0.7 kb XbaI-Sacll fragment and a 119 bp SacII fragment, respectively. All constructs are shown in Fig. 4A. DNA transfection and CAT assay. NIH3T3 cells were maintained in Duibecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum. Cells (0.5.106) were transfected with 10 ~g of plasmid/10 cm Petri dish by the calcium phosphate precipitation technique [12] and incubated with or without forskolin. Cell lysates were prepared 48 h after transfection. The reaction mixture for CAT assay contained 0.2 /~Ci of [14C]-chloramphenicol, 0.47 M Tris-HC! (pH 7.8), 0.53 mM acetyl-CoA and a cell lysate. Reaction mixtures contained the same amounts of protein, which were determined with a Bio-Rad protein assay system. Labeled chloramphenicol and acetylated derivatives were separated by ascending silica gel thin layer chromatography (CHCI3/methanol , 95:5)(Fig. 4B and Fig. 5).
Results Isolation of the 5' flanking region of the rat PP-2Aa gene To isolate the 5' flanking region of the PP-2Aa gene, we used two probes, an RNA probe corresponding to the 5' most 0.25 kb fragment of PP-2Aa eDNA (5' end to the first Pt,ull site) and a eDNA probe of the consecutive 0.68 kb PvulI fragment of the coding region [3]. Since the RNA probe contained 0.2 kb of the G-C rich 5' non-coding region (GC content, 82%), it hybridized non-specifically to many clones when used to screen 2.105 independent clones of a rat liver genomic library. Therefore, we next screened the genomic library with the 0.68 kb cDNA fragment. Three independent genomic clones, pA4, pal5 and pA25, that hybridized with both probes were isolated. Restriction analysis of these three clones revealed that their 5'
341 0
5
I
'
110
15 Kb
3.3 kb, that the c D N A probe also hybridized to the Y most Xbal fragment of 1.9 kb (see Fig. 1), and none to the other fragments. These findings indicated the presence of an intron of more than 8 kb in the middle portion of the cloned fragment. Within the 3.3 kb Xbal fragment, the 5' most X b a l - P c u l l fragment (1.6 kb) hybridized with the 0.25 kb R N A probe and the consecutive Pt•ull fragment hybridized with the 0.68 kb c D N A probe• We subcloned the 5' most 1.6 kb fragment of p,~25 (pE8, Fig. l). Nucleotide sequencing of this fragment (Fig. 2) revealed that the sequence of the 3' end of the 0.25 kb fragment was completely identical with that of the 5' end of the 0.25 kb fragment of c D N A used as a template of the R N A probe.
I
pk4, pA.15
p~s
pea
~....~, ~ ,~V :
~"
i
H
f
~
~
~
X
i
~
I
H
0.5Kb
[El
It~cDN A end
Fig. 1. Structure of the 5' region of the rat PP-24a gene. The maps of three genomic fragments cloned into ADASH vector (p,~4, pM5 and pA25) are shown at the top. The dark box represents the region that was hybridized with the RNA probe, corresponding to the first 0.25 kb fragment of PP-2,4. eDNA and the 0.68 kb l~,ull fragment of PP-2Aa eDNA coding region. The light box indicates the region that hybridized only with the 0.68 kb cDNA fragment. The region containing the promoter in pA25 was subcloned into blueseripl pKSM+ 13 plasmid vector (pC2 and pES). T3 and T7 in boxes indicate the promoter regions for T3 and 1"7 polymerases on bluescript vector. The broken lines on maps of pA25 and pC2 represent the fragments from ADASH vector. The 5' end of PP-2.4e eDNA is indicated by an arrow. Restriction sites: B, BamHI; E, EcoRI; H.
Determination o f the transcriptional initiation site by primer extension A single-stranded 30mer D N A corresponding to 1'2 (Fig. 2) was used as a primer for primer extension reactions• Poly(A) + R N A isolated from rat liver was used as a template. Three major extended D N A products of 71, 73 and 76 nucleotides in length were identified (Fig. 3A). From this result, the 5' most proximal major cap site was denoted as nucleotide + 1 (Fig. 2). Several minor cap sites may exist within the region from - 2 0 to + 1, since faint bands of some longer nucleotides were also observed. By Northern blot analysis of poly(A) + R N A from rat liver, with the P2 30mer probe (Fig. 2), 2.0 and 2.7 kb transcripts of the PP-2Aa gene were detected (Fig.
Hindlll; Pv, Pcull; S, Sinai; X, Xbal. ends were identical and that p,~4 and p a l 5 were completely identical clones with the length of 13 kb, while pA25 was about 2 kb longer at the 3' end than the others (Fig. 1). Southern blot analysis of pA25 demonstrated that the R N A and c D N A probes used for genomic screening both hybri,qzed to the 5' most XbaI fragment of .
.
.
.
-1300
.
.
.
.
.
GATCT6AGGTACTTT6TTCCGGAA•ACTAGTGGGAGGTACC•ACTAGAGACAG•AGAATTGGT•AAGCCAGTTCTT•TGGCCAAGCAGGTTGTCCTGGATAAAAGAGGATTCTCATCAGT . . . . -1200 . . . . . . . GCCATTTGTGGATGGGGCCACTGAGGCCATCTAAAG•TTGTGGGTCAGGGTGTCTTCTGAACCCTCTGAGCTGTGTCTTCTCCAGTGTGTGACAGGCTTGACTTTCCCACAGTAGAGCTA • . -Ii00 . . . . . . . GATCAGCTCTTGCCTTG••CTTCATGGATAA•TATCCTTTGGCTTCTATA•CT•TCAAACTATGGAGGAAAC•AGTGT•TTCCATC•ATTC••TTTC•AGC•AGGAAAGTT•AAG•TCCA "000 -900 ~CTGsG~AGCAG~CTTTTTG~TG6ATAA~CCCT~TAT~CT~TAAG~ATC~AAT6TGGT~AAGAGTTGACsCT~TGTAcAGCTAAGTATcT~TT6~ATsAAGACAGTGCAGTGTGAAc . . . . . -800 . • ACGTTTCACAA~CCCCAGAAGAGATTTATAACCAGGTCAAAGGCCGATCCTTAAGAATATCAGCTTCCTTTACAGACCACGCAGTAGTTGCTTCTACCAGCATC~GAACACAGCCCTGGC
• . -500 . . . . . . . GAGCCTGCAATGGCCAGAGGTGGAGAAGGTCACTCCAGGCAGCCTGCCACTAAGA~TCGGTTCTT~TCCCCAAAGATGTGGGGCT[CCTTGCGGTTCCCATGGCTGCTGGACAAAGCG -400 . . . . . T . -300 TTAAGGTTGCTTTTAGTCATCAGGCTGCCAGACCCCGGGCCACATCTGAGAAGTATCATCCAGCGGCCTTCCAGAAACAACAGGTCAAAG•GA•CCAGACCTCAC•TACACGGACTGCTC
• •
CC .
SmaI . . . . . . . -200 . • • ATGCG6CAAGTCTGCGCAGGCGCCCTGCTGAG~CTGGGGCT~cAGGAATA~CGGGGTA~GCCG~TTCCAGCACT~CGCTTGCT~CGACTC~CTTCTTCCCTTCCCCCCCGCCACCT~. . . . . . -100 . . . . . CGC GGAGGACCACGCCCCAAAAG•GAAGCCACTTCCTTTGGCAGTCAGCTTCGCTGCGCCTGCGCCTGGGCTCCACAGT•CGCAGcTCTGGGTCCCGGCCCCACTCC•TCGCCCTCCCC CGC~ Pt = sac~ +! GC~GCTCCCTGACGCCGGCGTG~CGTCACCACGC C[GGGcGGCCGCCATTACAGAAAGCCGAGTCCC~AGCTAGGGCGAGCGGAGGAGGA~G~AGCG~CCGGc~GCC~AGCAcT~CG~A ~ C * * * ~ c D N A end P2
sac~ 100 ~CGAGCCAGC°GGCCGGCGCCAGCGCCCAGCA°CC°CCTGGGG~CGCAGGAAG~ACcCCG~GGAGCGGCGGCGGCGT°T°C~T~TG°cCCG°°TGCGG~CGGCGGCGCGGGAGCA~C°CA
$maI M
Fig.
2.
Nucleotide sequence of the
5'
D
E
K
L
F
T
K
E
L
D
Q
W
I
E
Q
region of the rat PP-2A. gene. Nucleotides marked with stare represent the major transcriptmnal initiation
sites determined by primer e~ension. The 5' most proximal major cap site is denoted as nucleotide + 1. The locat~ns of the opposite strands of oligonucleotide PI and P2 used as probes for No.hem blot analysis are underlined. Three sets of direct repeam are shown by arrows. Two sets of dire~ repeats at the Sacll sites are shown by double arrows. The ten base pair pafindrom~ sequence is shown by a pair of arrows (head to head). The potential Spl binding site is shown by an open bo¢ The coding region is indMated by the sin@e Mt~m of amino acids.
342 B.
A.
A.
X I
S '
Sa Sa I I
S II '-. . . . . . . . =- mRNA
-I~
pS12.5 pS12-1 pS31
F
P1
pS33 pS12AXSa
P2
pS311Sa
B.
i
\i
~
~'
i
e
•
O
O
e
0
0
•
7
2.0 Kb
,
P2
Fig. 3. Determination of the transcriptional initiation sites by primer extension experiments (A) and Northern blot analysis (B). (A) Primer extension was performed with a 30mer oligonucleotide P2. The primer-extended DNA products were separated on a sequence gel alongside a didcoxy sequencing ladder (G, A, T, C) priming from the same primer. Samples of 6 /.tg of poly(A)+ RNA from a rat liver (lane I) and 10/~g of yeast tRNA (lane 2) were used as templates. Primer alone was also applied to the gel (lane 3). The sequence around the position of the three major cap sites which are marked with stars, is shown. (B) A sample of 5/tg of poly(A)+ RNA from rat liver was blotted and hybridized with oligonucleotides PI and P2. The position corresponding to the region PI is al~ indicated beside the sequencing ladder in A.
3B). Neither transcript of PP-2Aa was d e t e c t e d (Fig. 3B), with the P1 3 4 m e t probe corresponding to the region from - 7 2 to - 1 0 5 (Fig. 2). A 1.0 kb EcoRISmaI fragment of pE8 also detected n o transcript (data not shown). T h e s e results suggested that the length difference between the two kinds of transcripts of the PP-Z4a ( ~ 0.7 kb) is not due to the different initiation site but by o t h e r mechanisms such as poly(A) addition or alternative splicing. Usually the p r o m o t e r is localized within 110 base pairs u p s t r e a m from the transcriptional initiation site [13]. T h e putative p r o m o t e r region of the rat PP-2Aa gene has no ' T A T A box' o r ' C A A T box'. This region has a high G - C c o n t e n t (80% in t h e + 1 to - 1 0 0 region a n d 74% in the + 1 to - 2 0 0 region) a n d a unique potential binding site, G G G C G G , for the cellular transcription factor S p l [14] at position - 1 0 . A 10-base palindrome, 5 ' - G T G A C G T C A C - 3 ' , which is
e
e
e
e
e--:.
0
Fig. 4. Structures of promoter-CAT plasmids and their CAT activity. (A) The map of the genomic fragment in pE8 is shown at the top. Vectors for CAT assay were constructed on pSV00CAT as described in Materials and Methods. The orientations and lengths of fragments ligated to the cat gene are shown by arrows. Restriction sites: H, Hindlll: Sa. Sacll; S, Sinai: X, Xbal. B, Samples of 10 #g of plasmid DNAs were transfected into NIH3T3 cells (0.5- l06 cells/10 cm Petri dish) and their lysates were assayed for CAT activity. CM, chloramphenicol highly conserved in many o t h e r genes whose expressions are regulated by c A M P [15], is located at position - 26.
Identification of the promoter region by CAT a,;say T o define the p r o m o t e r region of the cloned fragment, we p r e p a r e d several constructs with D N A fragm e n t s of pE8 into the Hindlll site of pSV00CAT, as shown in Fig, 4A. pS12-5, containing a 1.3 kb HindIIlSma I f r a g m e n t of p E 8 (from nucleotide position - 1211 to + 134) showed significant C A T activity in N I H 3 T 3 cells (3-times that of pSV2CAT), pS12-1, containing the u p s t r e a m 0.8 kb region of this f r a g m e n t (position - 1 2 1 1 to - 3 7 0 ) , showed n o C A T activity, but pS31, pS12.5 I
pS31 II
I
ooeooe-c. f0rsk0lin 0 10 100 0 I0 100 ttH Fig. 5. Effect of forskolin on CAT activity of pS12-5 and pS31 in N1H3T3 cells. Plates containing 0.5-10' cells were transfected with l0/tg of pS12-5 and pS31. Transfected cells were treated with 10 or 100/zM forskolin or ethanol vehicle as a control for 43 h.
343 containing the downstream 0.5 ":b region (position - 3 6 9 to + 134), conferred more than half as much CAT activity as pS12-5. To define the essential region for promoter activity, we prepared deletion derivatives of pS12-5 and pS31. Deletion of the 0.7 kb Xbal-SacII fragment from pS12-5 (pS12AXSa)decreased the CAT activity significantly. The same degree of decrease in CAT activity was also observed on deletion of the 119 bp Sacll fragment from pS31 (pS31ASa). These results were confirmed by three independent experiments using two sets of different preparation of plasmids and suggest that the essential region for promoter activity of the PP-2Aa gene is in the 119 bp Sacll fragment (from position - 162 to - 44). pS12AXSa and pS31ASa still retained weak promoter activity, which contained a putative GC-box immediately upstream of the transcriptional initiation sites, pS33 contains the 0.53 kb Sinai fragment in the opposite orientation to the cat gene and showed a weak promoter activity, as in the case of pSI2AXSa and pS31ASa.
Regulation of transcription of the PPo2,4a gene by cAMP Since we found a 10-base palindrome, 5'-GTGACGTCAC-3', we examined whether the expression of the PP-2Aa gene is regulated by cAMP. NIH3T3 cells transfected with pS12-5 and pS31 were treated with forskolin, a direct activator of adenylate cyclase, for 43 h and then harvested. The CAT activities derived from pS12-5 and pS31 were induced 2.5- and 1.7-fold, respectively, by treatment with 10 ~tM/orskolin (Fig. 5). Discussion
in this study we isolated the 5' region of the rat PP-2Aa gene and identified the promoter regi~rl of this gene. The promoter region has no ' T A T A bo~" or ' C A A T box' and has an extremely high G-C cont.ent, suggesting that this promoter can be classified as that of a 'house keeping' gene. Since this promoter has no ' T A T A box', initiation of transcription occurred at several sites about 220 base pairs upstream of the translational initiation site, as observed with many 'house-keeping' genes. There is a GC-box (GGGCGG), possible Spl binding site, immediately preceding the transcriptional initiation site ( - 1 0 ) and the fragment containing this sequence was found to have promoter activity even when ligated in the opposite orientation to the cat gene (pS33 in Fig. 4), suggesting that this GC-box is functional and provides a basal transcription level. Deletion of the 119 bp SaclI fragment ( - 1 6 2 to - 4 4 ) from 0.5 kb Smal fragment decreased its promoter activity, more than 90%. Possibly the GC rich region(s) in the Sacll fragment is regulated by ETF, which binds to GC-box as well as GC-rich sequences
not recognized by SPI [16] or some other unknown transcriptional activator(s) that binds to specific GC rich sequences. At the two Sacll sites, there are two direct repeats of 12 nucleotides (CCCTCCCCGCGG), which can be a candidate for ETF binding sequence [16]. Within the Sacli fragment, a sequence of GGGCTCC, which exists as three direct repeats in the region of - 3 5 0 to - 5 0 , resides, although roles of this motif in promoter activity is not known. There is a 10 bp palindrome, 5'-GTGACGTCAC-3', 26 bp upstream of the transcriptional initiation site, which is highly conserved in many genes [15]. The heptanucleotide motif 5'-TGACGTCA-3' in this 10 bp palindrome has been proposed to be a consensus sequence for CREB, a cAMP response element binding protein [17] and ATF, a cellular transcription factor [18]. Promoters of a wide variety of genes such as those for somatostatin [15], proenkephalin [19], a-gonadotropin [20], fibronectin [21], c-los [22], adenovirus 5 E2-E4 [23-25], adenovirus 2 major late genes [26,27], HTLV-I LTR [23] and HTLV-I! LTR [22] contain a similar motif and are known to be regulated by cAMP. The activity of PP-1 can be inhibited by cAMP through the action of inhibitor-I which is activated by the cAMP-dependent protein kinase [28]. However, little is known about the regulation of PP-2A activity by cAMP. We found that the PP-2Aa promoter contained CRE and its activity was increased by forskolin. More experimental evidence is needed to establish the regulation; however, these findings suggest that cAMP regulates not only phosphorylation but also dephosphorylation mediated by both PP-I and PP-2A. We found previously that the treatment of raf and retll transformants with 10 nM okadaic acid, which is a potent inhibitor of PP-1 and PP-2A [29,30], resulted in reversion into flat morphology of these transformants [31]. The IC5o value of okadaic acid is 20 nM for the purified catalytic subunits of the PP-I and much less for PP-2A in vitro [30]. Thus, inhibition of some reaction(s) catalyzed by PP-2A may result in flat reversion of malignant cells. Recently, a 36 kDa cellular protein known to be associated with polyoma virus middle T and small t antigens was found to be identical to the catalytic subunit of PP-2A [32]. These findings suggest that PP-2A is involved in malignant transformation. We have reported that the PP-2Aa mRNA level is increased in rat liver tumors induced by IQ [4] and MelQx [6] and in regenerating liver (unpublished data). Therefore, it is important to determine the mechanism causing increase in the mRNA level of PP-2,4a. Possibly the specific GC rich sequences or CRE sequence found in the promoter region are involved in transcriptional activation in liver tumors and regenerating liver. Studies are also required on whether the increase of mRNA results in increase in the protein level, and the nature of the substrates in liver tumors.
344
Acknowledgments T h i s s t u d y w a s s u p p o r t e d by a G r a n t - i n - A i d f r o m the Ministry of Education, Science and Culture of Japan and a grant from the Ministry of Health and W e l f a r e for a C o m p r e h e n s i v e 1 0 - Y e a r S t r a t e g y o f C a n c e r C o n t r o l , J a p a n . K. Sasaki w a s t h e r e c i p i e n t o f a Research Resident Fellowship from the Foundation for P r o m o t i o n o f C a n c e r R e s e a r c h . W e also t h a n k D r s . H. Y o s h i z u m i a n d Y. S u w a o f t h e S u n t o r y R e s e a r c h C e n t e r for t h e s u p p o r t o f this study.
References I lngebrit~n, T.S. and Cohen, P. (1983) Science 221,331-338. 2 Cohen, P. (1989) Annu. Rev. Biochem. 58, 453-508. 3 Kitagawa, Y., Tahira, T., lkeda, !., Kikuchi. K., Tsuiki, S., Sugimura, T. and Nagao, M. (1988) Biochim. Biophys. Acta 951, 123-129. 4 Kitagawa, Y., Sakai. R., Tahira, T., Tsuda, H., ito, N., Sugimura, T. and Nagao, M. (1988) Biochem. Biophys. Res. Comman. 157, 821-827. 5 Kitagawa. Y., Sasaki, K., Shima, H., Shibuya, M., Yanagida, M., Sugimura, T. and Nagao, M. (1990) Bioehem. Biophys. Res. Commun. 171,230-235. 6 Sasaki, K., Shima, H., Kitagawa, Y., lrino, S., Sugimura, T. and Nagao, M. (1990) Jpn. J. Cancer Res. 170. 169-175. 7 Pel!icer, A., Wigler, M., Axel. R. and Silverstein, S. (1978) Cell 14, 133-141. 8 Chert, E. J. and Seeburg, P. H. (1985) DNA 4, 165-170. 9 Sanger, F., Nicklen, S. and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74. 5463-5467. 10 Mizusawa, S., Nishimura, S. and Seela. F. (1986) Nucleic Acids Res. 14, 1319-1324. 11 Araki, E., Shimada, F., Shichiri, M., Mori, M. and Ebina, Y, (1988) Nucleic Acids Res. 16, 1627.
12 Graham, M. A. and Van der Eb, A. (1973) Virology 52, 456-45729. 13 Maniatis, T., Goodbourn, S. and Fischer, J.A. (1987) Science 236, 1238-1245. 14 Dynan, W.S. and Tjian. R. (1985) Nature 316, 774-778. 15 Montminy, M~R., Sevarino, K.A., Wagner, J,A., Mandel, G. and Goodman, R.H. (1986) Proc. Natl. Acad. Sci. USA 83, 6682-6686. 16 Kageyama, R., Merlino, G.T. and Pastan, !. (1989)J. Biol. Chert. 264, 15508-15514. 17 Montminy, M.R. and Bilezikjian, L.M. (1987) Nature 328, 175178. 18 Lee, K.A.W., Hal, T.Y., SivaRaman, L., Thimmappaya, B., Hurst, H.C., Jones, N.C. and Green, M. (1987) Proc. Natl. Acad. Sci. USA 84, 8355-8359. 19 Terao, M., Watanabe, Y., Mishina, M. and Numa, S. 0983) EMBO J. 2, 2223-2228. 20 Darnell, R.B. and Boime, 1. (1985) Mol. Cell. Biol. 5, 3157-3167. 21 Jones, N.C., Rigby. P.W.J. and Ziff, E.W. (1988) Genes Dev. 2. 267-281. 22 Van Beveren, C., Van Straaten, F., Curran, T., Muiller, R. and Verma, I.M. (1983) Cell 32, 1241-1255. 23 Berk, A.J. (1986) Annu. Rev. Genet. 20, 45-79. 24 Hurst, H.C. and Jones, N.C. (1987) Genes and Dev. 1, 1132-1145. 25 Hanaka, S., Nishigaki, T., Sharp, P.A. and Handa, H. (1987) Mol. Cell. Biol. 7, 2578-2587. 26 Sawagodo, M. and Roeder. R.G. (1985) Cell 43, 165-175. 27 Carthew, R.W.. Chodosh, L.A. and Sharp. P.A. (1985) Cell 43, 439-448. 28 Cohen, P. (1985) Eur. J. Biochen'. 151,439-448. 29 Bialojan, C. and Takai, A. (1988) Biochem. J. 256, 283-290. 30 Haystead, T.AJ., Sire, A.T.R., Carling, D., Honnor, R.C., Tsukitani, Y., Cohen, P. and Hardie, D.G. (1989) Nature 337, 78-81. 31 Sakai, R., lkeda, I., Kitani, H., Fujiki, H., Takaku, F., Rupp, U., Sugimura, T. and Nagao, M. (1989) Proc. Natl. Acad. Sci. USA 86, 9946-9950. 32 Pallas, D.C., Shahrik, L.K., Martin, B.L., Jaspers, S., Miller, T.B.. Brautigan, D.L. and Roberts, T.M. (1990) Cell, 60, 167-176.
