Biochemical Pharmacology 96 (2015) 337–348

Contents lists available at ScienceDirect

Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm

Effects of flavonoids on senescence-associated secretory phenotype formation from bleomycin-induced senescence in BJ fibroblasts Hyun Lim, Haeil Park, Hyun Pyo Kim * College of Pharmacy, Kangwon National University, Chuncheon 200-701, Republic of Korea

A R T I C L E I N F O

A B S T R A C T

Article history: Received 14 May 2015 Accepted 11 June 2015 Available online 18 June 2015

During senescence, cells express molecules called senescence-associated secretory phenotype (SASP), including growth factors, proinflammatory cytokines, chemokines, and proteases. The SASP induces a chronic low-grade inflammation adjacent to cells and tissues, leading to degenerative diseases. The antiinflammatory activity of flavonoids was investigated on SASP expression in senescent fibroblasts. Effects of flavonoids on SASP expression such as IL-1a, IL-1b, IL-6, IL-8, GM-CSF, CXCL1, MCP-2 and MMP-3 and signaling molecules were examined in bleomycin-induced senescent BJ cells. In vivo activity of apigenin on SASP suppression was identified in the kidney of aged rats. Among the five naturally-occurring flavonoids initially tested, apigenin and kaempferol strongly inhibited the expression of SASP. These flavonoids inhibited NF-kB p65 activity via the IRAK1/IkBa signaling pathway and expression of IkBz. Blocking IkBz expression especially reduced the expression of SASP. A structure-activity relationship study using some synthetic flavones demonstrated that hydroxyl substitutions at C-20 ,30 ,40 ,5 and 7 were important in inhibiting SASP production. Finally, these results were verified by results showing that the oral administration of apigenin significantly reduced elevated levels of SASP and IkBz mRNA in the kidneys of aged rats. This study is the first to show that certain flavonoids are inhibitors of SASP production, partially related to NF-kB p65 and IkBz signaling pathway, and may effectively protect or alleviate chronic low-grade inflammation in degenerative diseases such as cardiovascular diseases and late-stage cancer. ß 2015 Elsevier Inc. All rights reserved.

Keywords: Flavonoid Senescence SASP Chronic low-grade inflammation IkBz

1. Introduction As cells in the human body age, they lose their active proliferating potential, leading to cellular senescence [1]. If cells continue to proliferate, some signaling pathways may be damaged and DNA may be mutated, which can lead to carcinogenesis unless several defense mechanisms such as apoptosis and immune surveillance are functioning properly. Thus, cellular senescence is considered a normal process to prevent uncontrolled cell growth. When cells enter into a senescent stage, growth is arrested, cells are enlarged about 2 fold, and they express senescence markers such as senescence associated b-galactosidase (SA b-gal), p16INK4, and p21, resulting in the formation of DNA segments with chromatin alterations reinforcing senescence (DNA-SCARS) [2]. Recently, however, it has been shown that senescent cells express senescence-associated secretory phenotype (SASP), which is released into the surrounding environment. The SASP includes

* Corresponding author. Tel.: +82 33 250 6915; fax: +82 33 255 7865. E-mail address: [email protected] (H.P. Kim). http://dx.doi.org/10.1016/j.bcp.2015.06.013 0006-2952/ß 2015 Elsevier Inc. All rights reserved.

various growth factors, transcription factors, proinflammatory cytokines such as IL-1, IL-6, and IL-8, proteases, and matrix metalloproteinases [3]. Since many of these molecules are proinflammatory, SASP production could potentially provoke inflammation, in this case, sterile low-grade chronic inflammation [4,5]. The chronic low-grade inflammation is believed to play a role in various degenerative disorders such as metabolic diseases, including type II diabetes, rheumatoid arthritis, vascular diseases, and in age-related cancers [4,6,7]. Thus, it is reasonably to think that inhibitors and/or down-regulators of SASP production may be able to remove harmful aspects of cellular senescence. To date, few specific SASP inhibitors have been reported. In this regard, it is worth evaluating the effects on SASP production and to find inhibitors from various sources, including many plant constituents. SASP factors are controlled by complex signaling pathways. Until recently, it has been demonstrated that several signaling components such as DNA damage response (DDR), p38 mitogenactivated protein kinase (MAPK), NF-kB, CCAAT/enhancer-binding protein b (C/EBPb), and protein kinase D1 are involved in regulating SASP production by senescent cells [8–10]. p38 MAPK activity is required for SASP production, as is IL-6, IL-8 and

338

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

granulocyte macrophage-colony stimulating factor (GM-CSF) which is regulated through activation of NF-kB in senescent human fibroblasts [8]. NF-kB was revealed as the crucial transcription factor for SASP induction [9]. NF-kB p65 subunit was observed at much higher levels in the chromatin of H-rasV12induced senescent human IMR-90 fibroblasts than in young fibroblasts [11]. In bleomycin-induced senescence in HCA2 primary cells, the expression of IL-6 and IL-8 was shown to be mediated by IL-1a together with the activation of NF-kB and C/ EBPb [12]. Also, C/EBPb acts as a regulator for oncogene-induced senescence, but heterodimerizing with C/EBPg suppresses senescence and transcription of SASP genes, including IL-6, chemokine (C–X–C motif) ligand 1 (CXCL1), IL-1a, and IL-1b [13]. These previous studies have shown that NF-kB-dependent signaling contributes to SASP production in cooperation with other transcription factors and signaling molecules. Recently, one report demonstrated that expression of IkBz, encoded by the gene Nfkbiz, was critically connected with SASP genes such as IL-6 and IL-8 in DNA damage- and oncogene-induced senescence [14]. IkBz, designated as the inhibitor of NF-kBz, is localized exclusively in the nucleus after rapid induction by NF-kB, and is implicated in expression of NF-kB target genes [15]. IkBz is important for the induction of inflammatory genes, including chemokine (C–C motif) ligand 2 and IL-6 [16]. NF-kB and C/EBPs are required for IkBz-mediated gene induction, represented by IL-6 [17]. During senescence, IkBz is synthesized with primary response genes by NF-kB p50/p65, and SASP genes such as IL-6 and IL-8 are transcribed by interacting with IkBz and NF-kB as secondary response [14]. Therefore, the development of a new SASP inhibitor targeting IkBz may be helpful in alleviating lowgrade chronic inflammation and deleterious aspects of degenerative diseases related to senescence. Flavonoids are polyphenol compounds, largely distributed in the Plant Kingdom. It is well-known that certain flavonoids are natural anti-inflammatory agents [18]. Some flavonoids were also reported to exert inhibitory action on chronic low-grade inflammation [19,20]. The main cellular mechanism of action of antiinflammatory flavonoids is a down-regulation in the expression of proinflammatory molecules such as IL-6, TNF-a, etc. via blocking inflammatory signaling pathways [21]. In a recent report about effects of plant constituents on inflammatory molecules associated with aging, resveratrol, a well-known antioxidant, was found to significantly inhibit secretion of several inflammatory cytokines such as IL-6, IL-8, and IL-1b in aged vascular smooth muscle cells from the non-human primate Macaca mulatta [20]. Also, chronic treatment of resveratrol attenuated cytokine gene expression without affecting fibroblast replicative senescence in senescent human MRC5 fibroblasts [22]. Among flavonoid molecules, baicalin and kaempferol administration in 24-month-old rats were shown to reduce the expression of some cytokines and adhesion molecules through NF-kB activation in their kidneys [23,24]. Based on these previous findings, it is thought that some flavonoids may potentially inhibit SASP production. Therefore, in this study, the effects of flavonoids on damage-induced cellular senescence and SASP production were examined. And some flavonoids such as apigenin and several synthetic flavones were found, for the first time, to be SASP inhibitors, and their cellular mechanisms and in vivo activity were also investigated. 2. Materials and methods 2.1. Chemicals Bleomycin was purchased from Enzo Life Sciences (Farmingdale, NY, USA). Primers for RT-qPCR were synthesized from Bioneer (Daejeon, Korea) or bought from Qiagen (Hilden, Germany).

Primary antibodies against p-p38 MAPK, p38 MAPK, p-STAT3, STAT3, pRb, p21, IRAK1, p-IkBa, IkBa, and IkBz were purchased from Cell Signaling Technology (Danvers, MA, USA) and anti-rabbit secondary antibody was bought form Enzo Life Sciences. Lamin B1 antibody was purchased from Bioworld Technology (Minneapolis, MN, USA). b-Actin antibody was bought from Bethyl Laboratories (Montgomery, TX, USA). Bromo-20 -deoxy-uridine labeling and detection kit III was bought from Roche (Mannheim, Germany). Cellular senescence assay kit for SA b-gal was bought from Chemicon (Darmstadt, Germany). ELISA for IL-6 and IL-8 was purchased from eBioscience (San Diego, CA, USA). BD cytometric bead array (CBA) human inflammatory cytokine kit was purchased from BD Biosciences (San Diego, CA, USA). TransAM NF-kB p65 transcription factor assay kit was bought from Active Motif (Carlsbad, CA, USA). All Reagents for RT-qPCR were bought from Toyobo (Osaka, Japan). siRNA against IkBz and non-targeting siRNA were purchased from Thermo Scientific (Lafayette, CO, USA). All reagents for cell culture were bought from Hyclone Laboratories (South Logan, Utah, USA). Phenylmethanesulfonyl fluoride (PMSF), sodium orthovanadate, sodium fluoride, and carboxymethylcellulose (CMC) were purchased from Sigma–Aldrich (St. Louis, MO, USA). 2.2. Flavonoids Flavonoids, including apigenin (97%), quercetin (98%), kaempferol (97%), and naringenin (95%) (Fig. 1) were purchased from Sigma–Aldrich (St. Louis, MO, USA). Wogonin (95%) was isolated according to the previously published methods [25]. Synthetic flavones (compounds 1–16), C721 (5,7-dihydroxy-8-(pyridine-4yl)flavones) and TMF (20 ,40 ,7-trimethoxyflavone) were prepared on the previous described synthetic procedures [26,27]. All flavonoids gave one spot on TLC analysis. The purity of synthetic flavones was 95% based on HPLC analysis. 2.3. Animals Male Sprague Dawley (SD) rats were purchased from Samtako (Osan, Korea). Young (5-month-old) and aged (21-month-old) rats were used in this experiment. Animals were fed with standard laboratory chow and water ad libitum. The animals were maintained in the animal facility at 20–22 8C under 40–60% relative humidity and a 12 h light/dark cycle for at least 7 days prior to the experiment. The experimental design using the animals was approved by the local committee for animal experimentation, KNU (KW-140929-1). In addition, the ethical guidelines described in the Korean Food and Drug Administration guide for the care and use of laboratory animals was followed throughout the experiments. 2.4. Cellular senescence BJ cells (human foreskin fibroblast) were obtained from ATCC (Manassas, VA, USA). Cells were maintained in Dulbecco’s modified eagle medium with 10% fetal bovine serum, glutamine, and penicillin/streptomycin. For damage-induced senescence, early passage BJ cells were treated with bleomycin (50 mg/mL) for 24 h. After the cells were washed, they were incubated for another 6 days. On the 6th day, the induction of cellular senescence was identified by BrdU uptake assay and SA b-gal staining assay. For BrdU uptake assay, cells were seeded in a 96-well plate at 4  104 cells per well and the assay was performed using BrdU labeling and detection kit III as described in the manufacturer’s protocol. When the percentage of BrdU positive cells is less than 10%, the cells have reached the senescent stage [28]. For SA b-gal staining assay, cells were seeded at 6  105 cells per well in a 6-well plate

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

3' 2' 8

HO 7

6

A

O 2

C

B

OH

OH

4' 5'

HO

OH HO

O

O

6' 3

OH

5 OH

339

OH

O

OH

O

Apigenin (flavone)

Naringenin (flavanone)

O

Kaempferol (flavonol) OH OH

OCH3 HO

O

HO

O OH

OH

O

OH

O

Quercetin (flavonol)

Wogonin (flavone)

Fig. 1. The chemical structures of the naturally-occurring flavonoids used in this study.

and activation of SA b-gal in cells, which was observed as a blue color, was examined using a cellular senescence assay kit. 2.5. SASP production Test compounds were simultaneously treated in the progress of senescence induction or treated for last 24 h after completion of senescence, which was induced by bleomycin in BJ cells. Cells and the media were collected on the 6th day. IL-6, IL-8, and IL-1b concentrations in the media were measured using ELISA or CBA human inflammatory kit according to manufacturer’s protocol. RT-qPCR analysis was carried out to measure the level of SASP mRNA. Total RNA was extracted using NucleoSpin RNA (MACHEREY-NAGEL GmbH & Co. KG, Du¨ren, Germany) and cDNA was synthesized with ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Quantitative PCR was carried out with THUNDERBIRD SYBR qPCR mix (Toyobo, Osaka, Japan) using C1000 Touch Thermal Cycler (Biorad Laboratories, Hercules, CA, USA). The levels of SASP mRNAs were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers for IL-1a, IL-1b, IL-6, IL-8, GM-CSF, CXCL1, MCP-2, and MMP-3 are shown in Table 1. Primers for human GAPDH were purchased from Qiagen (Hilden, Germany).

2.7. siRNA transfection against IkBz siRNA (25 nM) against IkBz and non-targeting siRNA were transfected to the cells with bleomycin for 24 h. After washing out bleomycin, cells were incubated for another 24 h and 48 h. The levels of IkBz, p21, and SASP mRNA were detected by RT-qPCR as described above. Primers for human IkBz and p21 are shown in Table 1. 2.8. SASP expression in aged rats In vivo activity of apigenin was examined using young (5-month-old) and aged (21-month-old) SD rats. Each group Table 1 Primer sequences for quantitative real-time PCR.

For BJ cells

IL-6 IL-8 IL-1a IL-1b GM-CSF CXCL1

2.6. Cellular mechanism related to SASP expression Cell lysates were prepared from BJ cells simultaneously treated with bleomycin and test compounds. On the 6th day, total cellular proteins were extracted with Pro-Prep solution (iNtRON Biotechnology, Korea) containing 1 mM PMSF, 1 mM sodium orthovanadate, and 1 mM sodium fluoride. Protein samples were separated in SDS-PAGE and blotted on to a PVDF membrane (Immobilon-P, Millipore Corp, Billerica, MA, USA). The blots were reacted with anti-human pRb, p21, p-STAT3, STAT3, p-p38 MAPK, p38 MAPK, IRAK1, IkBa, p-IkBa, or b-actin antibodies. Protein concentration in cell lysates was calculated by the Bradford assay (Biorad Laboratories, Hercules, CA, USA). To examine the activation of NF-kB p65 and IkBz protein expression, nuclear extracts were prepared as in the previous report [29] and the concentration of the nuclear protein was measured using BCA assay (Thermo Scientific, Lafayette, CO, USA). NF-kB p65 binding activity was determined using the TransAM NF-kB p65 kit.

50 –30 primer sequence

Genes

MCP-2 MMP-3 IkBz p21

For rats

IL-6 IL-1a IL-1b CXCL1 MMP-3

b-Actin

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

AATTCGGTACATCCTCGACGG GGTTGTTTTCTGCCAGTGCC AACTTCTCCACAACCCTCTG TTGGCAGCCTTCCTGATTTC GGTTGAGTTTAAGCCAATCCA TGCTGACCTAGGCTTGATGA ACAGATGAAGTGCTCCTTCCA GTCGGAGATTCGTAGCTGGAT CTTCCTGTGCAACCCAGATT CAGCAGTCAAAGGGGATGAC GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC TCACCTGCTGCTTTAACGTG CACAGCTTCCTTGGGACATT CAAAACATATTTCTTTGTAGAGGACAA TTCAGCTATTTGCTTGGGAAA CCTTTCAAGGTGTTCGGGTA GCAGGTCCATCAGACAA GGCAGACCAGCATGACAGATTTC CGGATTAGGGCTTCCTCTTGG

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC ACATCCGTGGAGCTCTCTTTACA TTAAATGAACGAAGTGAACAGTACAGATT CACACTAGCAGGTCGTCATCATC ATGAGAGCATCCAGCTTCAAATC GGAGACCATTAGGTGTCAACCA CCTAACACAAAACACGATCCCA GCCAGATTTGGTTCTTCCAA AGTAGGCATAGCCCTCAGCA TTTGAGGGTGCAGCGAACTT ACAGCAACAGGGTGGTGGAC

340

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

consisted of five rats. Apigenin was dissolved in 0.3% CMC and orally administered at a dose of 2 and 4 mg/kg once a day for 10 days. In the control group, the same volume of 0.3% CMC was administered to 5- and 21-month-old rats for 10 days. Then, the rats were anaesthetized under CO2, decapitated and the organs, including kidney, lung, brain and liver, were excised. To examine SASP mRNA levels in the kidney, 50 mg tissue from each kidney (n = 10) were homogenized in 1 mL of Trizol (Favorgen Biotech Corp., Taiwan) using a polytron homogenizer (KINEMATICA AG, Switzerland), and total RNA was extracted with chloroform. Total RNA was purified with Nucleospin RNA clean-up kit (MACHEREYNAGEL GmbH & Co. KG, Du¨ren, Germany). cDNA synthesis and qPCR were carried out as mentioned in the methods above. SASP Primers for rat IL-1a, IL-1b, IL-6, CXCL1, MMP-3 and b-actin are shown in Table 1. Primers for rat GM-CSF and IkBz were purchased from Qiagen (Hilden, Germany). 2.9. Statistics Experimental values are represented as arithmetic mean  SD. Student’s t-test was performed for two-group data. One way analysis of variance (ANOVA) followed by Dunnett’s post hoc test was used to determine the statistical significance of multiple comparisons (IBM SPSS Statistics, version 21). P < 0.05 was considered significant for the in vitro experiments. For in vivo experiment, P < 0.1 was considered significant. 3. Results 3.1. Effects of flavonoids on cellular senescence and SASP production Cells were treated with 50 mg/mL of bleomycin for 24 h and then incubated for 6 days further. The results of BrdU uptake and SA b-gal assays demonstrated that BJ cells have reached senescent stage and levels of IL-6 protein in the media, a representative SASP marker, significantly increased for 24 h on the 6th day after bleomycin treatment (data not shown). All these results clearly indicated that damage-induced cellular senescence induced with bleomycin was well established and SASP was produced under these experimental conditions. The effects of flavonoids on senescent cells were examined under the same experimental conditions as described above. As representative flavonoids (Fig. 1), naringenin (flavanone-type), apigenin, wogonin (flavone-type), kaempferol, and quercetin (flavonol-type) were incubated with BJ cells for last 24 h after completion of senescence by bleomycin treatment at pharmacologically relevant concentrations (10–20 mM). ELISA was used to measure IL-6 concentration in the media as a SASP marker. Fig. 2A demonstrated that 20 mM of quercetin, apigenin, wogonin, and kaempferol inhibited IL-6 production by 14.3%, 39.6%, 36.8% and 49.3%, respectively, while naringenin did not. These results were also confirmed by real time-quantitative PCR (RT-qPCR) analysis of several SASPs including IL-1a, IL-1b, IL-6, IL-8, GM-CSF, CXCL1, monocyte chemoattractant protein-2 (MCP-2), and MMP-3 in cells (Fig. 2B). Apigenin (20 mM) showed the potent inhibitory activity against of IL-6, IL-1a, IL-1b and GM-CSF mRNA expression levels, and wogonin (20 mM) was found to significantly inhibit the expression levels of IL-6, IL-1a, and IL-1b mRNA among several SASP molecules. Kaempferol (20 mM) also inhibited IL-6 mRNA level by 51.7%. To identify the effect of flavonoids on the SASP during induction of senescence by bleomycin, flavonoids (10–20 mM) were treated simultaneously with bleomycin. All flavonoids except naringenin showed more significant inhibition on the secretion of IL-6, IL-8, and IL-1b in culture supernatant (Fig. 3A). Inhibitory activity of apigenin on IL-6, IL-8, and IL-1b was the most potent among the

five flavonoids that were tested (86.5%, 60.9%, and 94.9% at 10 mM, respectively). Kaempferol (10 mM) also significantly inhibited IL-6, IL-8, and IL-1b expression by 66.4%, 52.5% and 81.8%, respectively. RT-qPCR results showed that flavonoids inhibited the mRNA levels of several SASP, which are consistent with SASP expression data obtained by the CBA inflammatory kit above (Fig. 3B). Thus, these data demonstrated that flavonoids such as apigenin and kaempferol possess potent inhibitory activity on SASP expression whenever treated simultaneously with bleomycin or treated on the 6th day after bleomycin treatment. Simultaneous treatment of flavonoids with bleomycin in the induction period of senescence had a much higher inhibitory effect compared to the treatment of flavonoids on the 6th day after senescence induction by bleomycin. On the other hand, apigenin and kaempferol did not significantly affect senescence itself. Even when treated simultaneously with bleomycin, apigenin and kaempferol (10–20 mM) did not change the level of senescence markers, BrdU uptake and SA b-gal activity (data not shown). All these results indicate that apigenin and kaempferol inhibit SASP production without affecting cellular senescence. 3.2. Cellular mechanism study To investigate cellular signaling molecules related to SASP inhibition by flavonoids, several signaling proteins were examined in BJ cells treated with bleomycin as stated above. None of the five flavonoids at 10 mM influenced senescence markers such as degradation of pRb protein as expected (Fig. 4A). Only quercetin and naringenin slightly increased p21 protein expression. None of the flavonoids tested affected the phosphorylation of signal transducer and activator of transcription 3 (STAT3) and p38 MAPK, which have been reported to be related to SASP production [8,30]. As shown in Fig. 4B, apigenin and kaempferol, having strong inhibitory activity on SASP production, did not affect the level of pRb and p21 protein at 10–20 mM. These data indicate that apigenin and kaempferol do not directly inhibit senescence itself. However, apigenin and kaempferol at 20 mM were found to partially change the time-course of interleukin-1 receptorassociated kinase 1 (IRAK1), IkBa and p-IkBa expression as shown in Fig. 4C. Furthermore, apigenin and kaempferol reduced activation of NF-kB p65 (66.1% and 51.6% reduction at 20 mM, respectively) in a concentration-dependent manner (Fig. 4D). These findings suggest that SASP inhibition of apigenin and kaempferol in senescent BJ cells may be mediated, at least in part, by interfering with IRAK1/IkBa/NF-kB p65 signaling. 3.3. IkBz-related SASP production The effect of flavonoids on IkBz expression was examined according to previous report about role of IkBz in SASP induction [14]. Among the tested five flavonoids, apigenin and kaempferol significantly reduced IkBz mRNA levels at 10 mM, while they were only slightly reduced by quercetin and wogonin (Fig. 5A). Naringenin did not inhibit the expression of IkBz mRNA as expected. At 20 mM, apigenin and kaempferol strongly inhibiting SASP production, reduced the level of IkBz mRNA in bleomycininduced senescent BJ cells by 48.0% and 60.2%, respectively (Fig. 5A). Western blot data in Fig. 5B showed that apigenin and kaempferol also reduced expression of IkBz protein in nuclear fraction at 10–20 mM, which is consistent with the RT-qPCR results shown in Fig. 5A. To confirm an essential role of IkBz in SASP induction, siRNA transfection study against IkBz was carried out. When IkBztargeted siRNA was introduced into bleomycin-treated BJ cells, expression of IkBz mRNA was successfully blocked (Fig. 5C).

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

341

A 25

IL-6 (ng/mL)

20 *

*

* 15

**

** **

**

**

10 5 0

Bl - + + + + + + + + + + + (50 μg/mL) 20 10 20 10 20 10 20 10 20 10 (μM) Q

A

W

K

N

B IL-6

50

80

Fold change

40

**

20

** **

** **

0

20

GM-CSF

30

**

**

CXCL1

5

40

4

30

3

20

2

*

10

1

0

Bl

+

+ + + + + Q A W K N

10

400

MCP-2

-

+

+ + + + + Q A W K N

MMP-3

300

*

*

200

* 100

0

0

-

** ** ** **

20

0

20

10

** **

**

0

50

40 30

4 2

0

40

60

6

40

**

IL-1β

70

IL-1α

50

*

30

10 8

60

10

Fold change

IL-8

0

-

+

+ + + + + Q A W K N

-

+

+ + + + + (50 μg/mL) Q A W K N (20 μM)

Fig. 2. Effects of flavonoids on SASP expression after completion of cellular senescence by bleomycin treatment in BJ cells. Flavonoids were treated for last 24 h when cells were treated with bleomycin (50 mg/mL) for 24 h and incubated further 6 D. IL-6 protein secreted into the media and SASP mRNAs in cell lysates were measured by ELISA and RT-qPCR, respectively. (A) Inhibition of IL-6 expression by flavonoids (10–20 mM). (B) Inhibition of SASP mRNAs (IL-6, IL-8, IL-1a, IL-1b, GM-CSF, CXCL1, MCP-2, and MMP-3) by flavonoids (20 mM). Bl, Q, A, W, K and N are abbreviations for bleomycin, quercetin, apigenin, wogonin, kaempferol, and naringenin, respectively. *P < 0.05, **P < 0.01, significantly different from bleomycin-treated control group (n = 3).

Increased levels of most SASP mRNAs were significantly reduced by siRNA (25 nM) transfection against IkBz compared to those transfected with non-targeting siRNA (Fig. 5D). But transfection of siRNA against IkBz did not affect the level of p21 mRNA, a senescence marker (Fig. 5C). These results support the notion that expression of IkBz may contribute to SASP induction without affecting senescence, and flavonoids such as apigenin and kaempferol inhibit SASP expression by blocking IkBz expression in bleomycin-induced senescence in BJ cells. 3.4. Effects of synthetic flavonoids on SASP expression Apigenin (flavone-type) shows the most potent inhibitory activity against SASP expression. For finding the optimal chemical structures in the flavone family, the effects of synthetic flavones that have a diverse chemical structure on SASP production were

examined (Fig. 6A). All compounds were tested at 10 mM. Among synthetic flavones tested, compounds 8 (30 ,40 ,7-trihydroxyflavone) and 9 (20 ,30 ,5,7-tetrahydroxyflavone) showed the strongest inhibition against IL-6 (101.6% and 103.4% inhibition, respectively) and IL-8 production (87.9% and 90.3% inhibition, respectively) when simultaneously treated with bleomycin (Fig. 6B). C721 (5,7-dihydroxy-8-(pyridine-4yl)flavones) and TMF (20 ,40 ,7trimethoxyflavone) did not inhibit IL-6 and IL-8 production in bleomycin-treated senescent BJ cells. While compound 11 (30 ,40 ,5,7tetrahydroxyflavone; luteolin) was the most potent inhibitor of IL-6 and IL-8 production, this compound was significantly cytotoxic to BJ cells (8.0% reduction in MTT assay) and further decreased the BrdU uptake level (data not shown). Thus the following experiments were carried out with compounds 8 and 9. The inhibitory activity of compounds 8 and 9 on SASP production was confirmed by RT-qPCR analysis. Along with

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

342

A IL-6 IL-8 IL-1β

30

**

**

**

**

20

**

** **

*

10

0

-

+

** ** ** ** ** **

**

*

** ** **

**

**

Fold change

10

**

0

A

K

IL-8

3000

IL-6

W

**

N

IL-1α

20

*

80

IL-1β

200

15

150

10

100

2000

60 40

1000

**

0

0

250

GM-CSF

500

200

400

150

300

100 50

**

20

+

+ + + + + Q A W K N

MCP-2

*

100

+ + + + + + Q A W K N

**

200

150

10

100

*

MMP-3

* 50

0

0

-

50

15

5

0

-

*

0

*

**

0

Bl

CXCL1

200

**

*

5

**

0

*

*

20

Fold change

20

+ + + + + + + + + + (50 μg/mL) 20 10 20 10 20 10 20 10 20 10 (μM) Q

100

**

** **

Bl

B

**

* 30

40

IL-1β (pg/mL)

IL-6 or IL-8 (ng/mL)

40

-

+

+ + + + + Q A W K N

-

+

+ + + + + (50 μg/mL) Q A W K N (10 μM)

Fig. 3. Effects of the simultaneous treatment of flavonoids on SASP expression during induction of cellular senescence by bleomycin treatment in BJ cells. Flavonoids were simultaneously treated with bleomycin (50 mg/mL) for 24 h and incubated further for 6 D. IL-6, IL-8 and IL-1b protein in the media and SASP mRNAs in cell lysates were examined using CBA human inflammatory kit and RT-qPCR, respectively. (A) Inhibition of the expression of IL-6, IL-8, and IL-1b by flavonoids (10–20 mM). (B) Inhibition of SASP mRNAs (IL-6, IL-8, IL-1a, IL-1b, GM-CSF, CXCL1, MCP-2 and MMP-3) by flavonoids (10 mM). Bl, Q, A, W, K and N are abbreviations for bleomycin, quercetin, apigenin, wogonin, kaempferol, and naringenin, respectively. *P < 0.05, **P < 0.01, significantly different from bleomycin-treated control group (n = 3).

apigenin, these compounds potently decreased the levels of most SASP mRNA (Fig. 7A). And as expected, compounds 8 and 9 did not change the level of BrdU incorporated into cells (data not shown). The mechanism study demonstrated that compounds 8 and 9 did not change the level of pRb degradation and p21 expression, which are both senescence markers. In contrast, these compounds significantly inhibited the expression of IkBz protein (Fig. 7B) as well as mRNA (Fig. 7C) at 10–20 mM. Also, these compounds were found to show inhibition of the activation of NF-kB in the nuclear fraction (Fig. 7D). These cellular mechanisms are same as those of apigenin. From the results, it is revealed that the optimum chemical structural requirements in the flavonoid backbone are C2,3 double bond, C-5,7-hydroxyl groups in A-ring, and single or double substitution(s) at C-20 ,30 ,40 positions in the B-ring. All these findings demonstrate that both the expression of IkBz and

activation of NF-kB may be critical in SASP expression, and flavonoids act by interfering with these signaling pathways, strongly inhibiting SASP production during bleomycin-induced senescence in BJ cells. 3.5. Effects of apigenin on SASP production in aged rats To prove the effects of flavonoids in an animal model, in vivo activity of apigenin on SASP production was examined in aged rats. Apigenin was administered orally to 21-month-old rats at 2 and 4 mg/kg once a day for 10 days. Five month-old rats were used as young rat controls, and apigenin was administered at 4 mg/kg once a day for 10 days. After 10 days, the left and right kidneys were excised from each rat. Total RNA was extracted and SASP production in the kidneys were measured using RT-qPCR

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

343

Fig. 4. Inhibitory mechanism of SASP production by flavonoids in bleomycin-treated BJ cells. Flavonoids were simultaneously treated with bleomycin (50 mg/mL) for 24 h and incubated further for 6 D. Expression of cell signaling proteins in cell lysates was identified by Western blotting. Activation of NF-kB p65 in nuclear fraction was examined using the TransAM kit. (A) Effects of flavonoids on pRb, p21, p-STAT3, STAT3, p-p38 MAPK, and p38 MAPK. (B) Effects of apigenin and kaempferol on pRb and p21 expression at 10–20 mM. (C) Effects of apigenin and kaempferol on time-course expression of IRAK1, IkBa, and p-IkBa at 20 mM. (D) Inhibition of activation of NF-kB p65 by apigenin and kaempferol at 10–20 mM. C is for excess addition (20 pmol) of wild-type consensus oligonucleotide as a competitor for NF-kB binding. Bl, Q, A, W, K, and N are abbreviations for bleomycin, quercetin, apigenin, wogonin, kaempferol, and naringenin, respectively. *P < 0.05, **P < 0.01, significantly different from bleomycin-treated control group (n = 3). Each blot is a representative of three separate experiments.

(n = 10). The mRNA expression levels of IL-6, CXCL1, IL-1a, IL-1b, and GM-CSF were significantly increased by 33.0, 13.6, 15.6, 5.0 and 7.0 fold, respectively, in 21-month-old rats compared to those of 5-month-old rats. Increased levels of SASP mRNAs in aged rats were considerably reduced by oral administration of apigenin at 2 and 4 mg/kg/day (Fig. 8A). Administration of 2 and 4 mg/kg/day of apigenin significantly inhibited IL-6 production by 45.7% and 41.0% (P < 0.1), respectively. CXCL1 (69.3% inhibition) and GM-CSF (39.7% inhibition) production were inhibited after treatment with 4 mg/kg/day of apigenin (P < 0.05). As shown in Fig. 8B, the level of IkBz mRNA in aged rat was much higher (8.1 folds increase) than in young rats, in which apigenin

administration at 2 mg/kg significantly reduced IkBz expression by 46.4% (P < 0.1). These results demonstrate that flavonoid treatment is effective in suppressing SASP production in aged rats, and the in vivo animal model supports the hypothesis that the suppression of IkBz expression by flavonoids is cellular mechanism of action. 4. Discussion This study has, for the first time, shown that certain flavonoids are SASP inhibitors. However, they generally do not alter the progress of cellular senescence induced by bleomycin treatment.

344

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

Fig. 5. Suppression of flavonoids on IkBz mRNA expression and the implication of IkBz with SASP production in bleomycin-treated BJ cells. Flavonoids were simultaneously treated with bleomycin (50 mg/mL) for 24 h and incubated further for 6 D. IkBz protein in nuclear fraction and mRNA were examined by Western blotting and RT-qPCR, respectively. For IkBz blocking, cells were transfected with siRNA (25 nM) against IkBz and non-targeting siRNA with bleomycin for 24 h and incubated further for 24–48 h. The levels of target mRNA were identified by RT-qPCR. (A) Effects of flavonoids on level of IkBz mRNA at 10–20 mM. *P < 0.05, **P < 0.01, significantly different from bleomycintreated control group (n = 3). (B) Inhibition of IkBz protein expression by apigenin and kaempferol. (C) Effects of siRNA transfection against IkBz on the level of IkBz and p21 mRNA. C is an abbreviation for non-targeting siRNA transfection. **P < 0.01, significantly different from transfected with non-targeting siRNA control in bleomycin-treated group for 24 and 48 h, respectively (n = 3). (D) Inhibition of SASP mRNA by siRNA transfection against IkBz. Bl, Q, A, W, K, and N are abbreviations for bleomycin, quercetin, apigenin, wogonin, kaempferol, and naringenin, respectively. *P < 0.05, **P < 0.01, significantly different from transfected with non-targeting siRNA control in bleomycin-treated group for 48 h (n = 3).

The main cellular mechanisms of action to inhibit SASP production are the suppression of NF-kB activation and IkBz expression. Some structure-activity relationships of flavonoids on SASP inhibition could be drawn by the present investigation. A C-2,3 double bond in flavonoid backbone structure seems to be essential to exert SASP inhibition, since the flavonoids with a C-2,3 double

bond such as apigenin, kaempferol, compound 8 and 9 showed strong inhibitory action while naringenin, which is devoid of a C2,3-double bond, neither inhibited SASP production nor suppressed the activation of NF-kB p65 and IkBz expression. Also, our study showed that A-ring 5,7-dihydroxyl substitution in the flavone structure enhanced IL-6 and IL-8 suppression (compound 2

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

345

Fig. 6. The chemical structures of synthetic flavones and their effects on SASP expression in bleomycin-treated BJ cells. Synthetic flavones and apigenin (10 mM) were simultaneously treated with bleomycin (50 mg/mL) for 24 h and incubated further for 6 D. IL-6 and IL-8 protein in the media were examined by ELISA. (A) The chemical structures of synthetic flavones used in this study. (B) Inhibition of IL-6 and IL-8 protein expression by synthetic flavones. A, C, and T are abbreviations for apigenin, C721, and TMF, respectively. **P < 0.01, significantly different from bleomycin-treated control group (n = 3).

vs. apigenin, compound 3 vs. 9). Particularly, hydroxyl group substitution in the B-ring is also important. Hydroxyl substitution at C-40 is favorable as in apigenin and kaempferol. Vicinal hydroxyl substitutions at C-20 ,30 or C-30 ,40 increased inhibitory activity against IL-6 and IL-8 expression (compound 1 vs. 3, compound 7 vs. 8 and 9). But C721 (5,7-dihydroxy-8-(pyridine-4yl)flavones) and TMF (20 ,40 ,7-trimethoxyflavone), previously reported to possess strong anti-inflammatory activity [31,32], did not inhibit SASP production. Luteolin (compound 11, 5,7,30 ,40 -tetrahydroxyflavone) possesses the optimum chemical structure, but this compound displayed cytotoxicity and some senescence-enhancing activity on BJ cells. Thus, the flavonoids having optimum structures are suggested to be apigenin, kaempferol, and compounds 3, 8 and 9. Apigenin, kaempferol, and compounds 8 and 9 were shown to have the same cellular action mechanisms of SASP inhibition. As representative SASP markers, the expression of IL-6 and IL-8 is controlled by elements such as antaxia-telangiectasia mutated, nibrin and checkpoint kinase 2 in the DDR pathway and/or p38 MAPK signaling in senescent fibroblasts [33]. Also, transcription factors such as NF-kB and C/EBPb were shown to be major regulators of SASP induction [11,12]. The antidiabetic drug

metformin was found to inhibit SASP via the IkB kinase a/b/ IkBa/NF-kB signaling pathway in oncogene-induced senescence [34]. Recently, IkBz was found to be a key regulator of IL-6 and IL-8 expression in DNA damage- and oncogene-induced senescence [14]. IkBz is an important factor for the induction of inflammatory genes [16] and interacts with NF-kB, C/EBPb, and STAT3 [17,35]. Also, IRAK1 was found to play an essential role in the post-transcriptional activation of IkBz [36]. Thus, it is thought that the most prominent transcription factors involved in the regulation of SASP production are NF-kB and IkBz. In accordance with previous findings, the experimental results of the present study demonstrate that apigenin, kaempferol, and compounds 8 and 9, possess potent inhibitory activity against the induction of a subset of SASP mRNA, and inhibit activation of NF-kB p65 and IkBz expression in bleomycin-induced senescent BJ cells. Furthermore, SASP inhibitory action of flavonoids was also confirmed in vivo using aged rats. Administration of apigenin into aged rats for 10 days significantly reduced the concentrations of IL-6, CXCL1, and GM-CSF mRNA elevated in kidney tissue. It is worth mentioning that levels of IkBz mRNA in the kidneys of 21-month-old rats significantly increased as compared to those of

346

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

Fig. 7. Inhibitory mechanism of SASP expression by compounds 8 and 9 in bleomycin-treated BJ cells. The test compounds including compounds 8, 9 and apigenin (10–20 mM) were simultaneously treated with bleomycin (50 mg/mL) for 24 h and incubated further for 6 D. The expression levels of several SASP, IkBz and p21 mRNA were examined by RT-qPCR. Expressions of pRb, p21 and b-actin protein in cell lysates and nuclear IkBz and lamin B1 protein were examined by Western blotting. Activation of NF-kB p65 in nuclear fraction was identified by TransAM kit. (A) Inhibition of SASP mRNA by compounds 8, 9 and apigenin at 10 mM. (B) Effects of compounds 8, 9 and apigenin on expression of pRb, p21 and IkBz protein at 10–20 mM. (C) Effects of compounds 8, 9 and apigenin on IkBz and p21 mRNA at 10 mM. (D) Effect of compounds 8, 9, apigenin, and naringenin on activation of NF-kB p65 at 10 mM. C is for excess addition (20 pmol) of wild-type consensus oligonucleotide as a competitor for NF-kB binding. Bl, A and N are abbreviations for bleomycin, apigenin and naringenin, respectively. *P < 0.05, **P < 0.01, significantly different from bleomycin-treated control group (n = 3). Each blot is a representative of three separate experiments.

5-month-old rats. Administration of 2 mg/kg apigenin to aged rats significantly inhibited IkBz mRNA levels. To the best of our knowledge, this is the first report about the elevation of IkBz in an aged animal model and IkBz suppression by certain flavonoids. This new essential role of IkBz is expected to make it a target for new molecules designed to control SASP expression related to senescence in vivo. As a plant constituent, resveratrol was found to lengthen the lifespan of Caenorhabditis elegans and the fruit fly Drosophila

melanogaster, and increased the survival of mice on high-fat diet [37,38]. Recently, resveratrol from grapes was reported as SASP inhibitor [20]. Among flavonoid derivatives, baicalin was reported to inhibit NF-kB activation in the aged rat [24], suggesting that this flavonoid derivative possesses anti-aging properties. And kaempferol was shown to inhibit some inflammatory responses such as cyclooxygenase-2 expression in aged rats [39]. Although these two previous studies have described how flavonoids affect aged cells and animals, flavonoids as SASP

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

347

A IL-6

IL-1β

IL-1α

2.5

4.0

2.0

Fold change

3.5 2.0

3.0

1.5

2.5

1.5

2.0 1.0

1.0

1.5 1.0

0.5

0.5

0.5 0.0

0.0

CXCL1

GM-CSF

2.0

0.0

3.5

*

MMP-3

2.0

*

Fold change

3.0 1.5

1.5

2.5 2.0

1.0

1.0

1.5 1.0

0.5

0.5

0.5 0.0

0.0

0.0

Apigenin -

4

-

4

21 m

5m

B

2

-

4

5m

-

2 21 m

4

-

4

5m

-

2

4 (mg/kg)

21 m

IκBζ 3.0

Fold change

2.5 2.0 1.5 1.0 0.5 0.0

Apigenin -

4

5m

-

2

4 (mg/kg)

21 m

Fig. 8. In vivo inhibitory activity of apigenin on SASP and IkBz expression in aged rats. Apigenin dissolved in 0.3% CMC was orally administered into 5-month-old young (5 m) and 21-month-old (21 m) rats at 2–4 mg/kg daily for 10 days. After 10 days, both the left and right kidneys were excised. Total RNA was extracted from each kidney and SASP mRNA levels were detected by RT-qPCR. (A) Inhibition of expression of SASP mRNAs by apigenin in both the left and right kidney. (B) Inhibition of IkBz mRNA level by apigenin in both the left and right kidney. +P < 0.1, *P < 0.05, significantly different from 0.3% CMC-treated aged (21 m) control group (n = 10).

inhibitors in general are demonstrated, for the first time, in the present investigation. The chronic low-grade inflammation is the term used to describe the sterile inflammation by long-term intrinsic inflammatory stimulation, which is not induced by foreign microbes or viruses. This low-grade inflammation is known to eventually lead to the development of various diseases, including metabolic disorders. Despite the importance of low-grade inflammation, a few inhibitors have been developed. Here, we have shown that certain flavonoids are SASP inhibitors. It means that they can control low-grade chronic inflammation in humans. Thus, it is suggested that long-term oral administration of certain flavonoids or food products containing high amounts of flavonoids may have a favorable effect on human health. Indeed, some clinical studies have shown the inverse relationship of flavonoid ingestion and the incidence of cardiovascular diseases and cancers [40,41]. The incidence of cancer was inversely related to the flavonoid intake in a cohort study from 1967 to 1991 in Finland [42]. In one clinical study with a cohort group of elderly people, a high intake of flavonoid from vegetables and fruits in men aged 65–84 years was

inversely associated with some cancer risk [43]. The incidence of disease seems to be related to the type and amount of flavonoid consumed. Besides cancer, the incidence of type 2 diabetes was inversely related to the dietary intake of flavonol [44]. Therefore, in view of SASP suppression, a long-term clinical study is highly recommended to clearly prove the beneficial effects of flavonoids on SASP production in relation to the aging process and the incidence of degenerative diseases such as late-stage cancer. Plant flavonoids are well-known anti-inflammatory agents with less adverse effects. In addition to SASP inhibitory activity, they exert inhibitory action on acute and chronic animal models of inflammation, including animal models of lung inflammation, skin inflammation, and arthritis. Thus flavonoids have been shown to be safe and effective broad-spectrum anti-inflammatory agents from nature. In conclusion, our data indicate that certain flavonoids inhibit SASP production in damage-induced senescence by bleomycin in BJ fibroblasts. This suppression did not coincide with a change in senescence markers. SASP suppression by flavonoids may be mediated by interfering with signaling pathways associated with IRAK1/IkBa/NF-kB p65 and IkBz expression. The flavonoid

348

H. Lim et al. / Biochemical Pharmacology 96 (2015) 337–348

derivatives having optimum structures are apigenin, kaempferol, 20 ,30 -dihydroxyflavone, 30 ,40 ,7-trihydroxyflavone, and 20 ,30 ,5,7tetrahydroxyflavone. Apigenin was the most potent SASP inhibitor, displaying strong in vivo inhibitory activity against SASP production in aged rats. Therefore, it is suggested that certain flavonoids can inhibit SASP production caused by chronic low-grade inflammation and can be expected to alleviate the progress of degenerative diseases related to aging, leading to considerable improvement in human health. Conflict of interest There are no conflicts of interest. Acknowledgements This study is financially supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (NRF-2013R1A1A2005609) and BK21-plus from the Ministry of Education. The authors thank to Prof. Hae Young Chung (Pusan National University, Korea) for the helpful discussion. The bioassay facility of New Drug Development Institute (KNU) was used and greatly acknowledged. References [1] L. Hayflick, The limited in vitro lifetime of human diploid cell strains, Exp. Cell Res. 37 (1965) 614–636. [2] J. Campisi, Aging, cellular senescence, and cancer, Annu. Rev. Physiol. 75 (2013) 685–705. [3] F. Rodier, J. Campisi, Four faces of cellular senescence, J. Cell Biol. 192 (2011) 547–556. [4] M. Kumar, W. Seeger, R. Voswinckel, Senescence-associated secretory phenotype and its possible role in chronic obstructive pulmonary disease, Am. J. Respir. Cell Mol. Biol. 51 (2014) 323–333. [5] Y. Zhu, J.L. Armstrong, T. Tchkonia, J.L. Kirkland, Cellular senescence and the senescent secretory phenotype in age-related chronic diseases, Curr. Opin. Clin. Nutr. Metab. Care 17 (2014) 324–328. [6] J. Campisi, J.K. Andersen, P. Kapahi, S. Melov, Cellular senescence: a link between cancer and age-related degenerative disease? Semin. Cancer Biol. 21 (2011) 354–359. [7] A. Onat, G. Can, Enhanced proinflammatory state and autoimmune activation: a breakthrough to understanding chronic diseases, Curr. Pharm. Des. 20 (2014) 575–584. [8] A. Freund, C. Patil, K. Age, J. Campisi, p38MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype, EMBO J. 30 (2011) 1536–1548. [9] A. Salminen, A. Kauppinen, K. Kaarniranta, Emerging role of NF-kB signaling in the induction of senescence-associated secretory phenotype (SASP), Cell. Signal. 24 (2012) 835–845. [10] P. Wang, L. Han, H. Shen, P. Wang, C. Lv, G. Zhao, et al., Protein kinase D1 is essential for Ras-induced senescence and tumor suppression by regulating senescence-associated inflammation, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) 7683–7688. [11] Y. Chien, C. Scuoppo, X. Wang, X. Fang, B. Balgley, J.E. Bolden, et al., Control of the senescence-associated secretory phenotype by NF-kB promotes senescence and enhances chemosensitivity, Genes Dev. 25 (2011) 2125–2136. [12] A.V. Orjalo, D. Bhaumik, B.K. Gengler, G.K. Scott, J. Campisi, Cell surface-bound IL-1a is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 17031–17036. [13] C.J. Huggins, R. Malik, S. Lee, J. Salotti, S. Thomas, N. Martin, et al., C/EBPg suppresses senescence and inflammatory gene expression by heterodimerizing with C/EBPb, Mol. Cell. Biol. 33 (2013) 3242–3258. [14] E. Alexander, D.G. Hildebrand, A. Kriebs, K. Obermayer, M. Manz, O. Rothfuss, et al., IkBz is a regulator of the senescence-associated secretory phenotype in DNA damage- and oncogene-induced senescence, J. Cell Sci. 126 (2013) 3738–3745. [15] M. Motoyama, S. Yamazaki, A. Eto-Kimura, K. Takeshige, T. Muta, Positive and negative regulation of nuclear factor-kB-mediated transcription by IkB-z, an inducible nuclear protein, J. Biol. Chem. 280 (2005) 7444–7451. [16] D.G. Hildebrand, E. Alexander, S. Ho¨rber, S. Lehle, K. Obermayer, N.A. Mu¨nck, et al., IkBz is a transcriptional key regulator of CCL2/MCP-1, J. Immunol. 190 (2013) 4812–4820. [17] S. Matsuo, S. Yamazaki, K. Takeshige, T. Muta, Crucial roles of binding sites for NF-kB and C/EBPs in IkB-z-mediated transcriptional activation, Biochem. J. 405 (2007) 605–615.

[18] E. Middleton Jr., C. Kandaswami, T.C. Theoharides, The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer, Pharmacol. Rev. 52 (2000) 673–751. [19] L. Ding, D. Jin, X. Chen, Luteolin enhances insulin sensitivity via activation of PPARg transcriptional activity in adipocytes, J. Nutr. Biochem. 21 (2010) 941–947. [20] A. Csiszar, D. Sosnowska, M. Wang, E.G. Lakatta, W.E. Sonntag, Z. Ungvari, Age-associated proinflammatory secretory phenotype in vascular smooth muscle cells from the non-human primate Macaca mulatta: reversal by resveratrol treatment, J. Gerontol. A: Biol. Sci. Med. Sci. 67 (2012) 811– 820. [21] H.P. Kim, K.H. Son, H.W. Chang, S.S. Kang, Anti-inflammatory plant flavonoids and cellular action mechanisms, J. Pharmacol. Sci. 96 (2004) 229–245. [22] V. Pitozzi, A. Mocali, A. Laurenzana, E. Giannoni, I. Cifola, C. Battaglia, et al., Chronic resveratrol treatment ameliorates cell adhesion and mitigates the inflammatory phenotype in senescent human fibroblasts, J. Gerontol. A: Biol. Sci. Med. Sci. 68 (2013) 371–381. [23] J.M. Kim, E.K. Lee, D.H. Kim, B.P. Yu, H.Y. Chung, Kaempferol modulates proinflammatory NF-kB activation by suppressing advanced glycation endproducts-induced NADPH oxidase, Age (Dordr.) 32 (2010) 197–208. [24] H.A. Lim, E.K. Lee, J.M. Kim, M.H. Park, D.H. Kim, Y.J. Choi, et al., PPARg activation by baicalin suppresses NF-kB-mediated inflammation in aged rat kidney, Biogerontology 13 (2012) 133–145. [25] K.M. You, H.G. Jong, H.P. Kim, Inhibition of cyclooxygenase/lipoxygenase from human platelets by polyhydroxylated/methoxylated flavonoids isolated from medicinal plants, Arch. Pharm. Res. 22 (1999) 18–24. [26] T.T. Dao, Y.S. Chi, J. Kim, H.P. Kim, S. Kim, H. Park, Synthesis and PGE2 inhibitory activity of 5,7-dihydroxyflavones and their O-methylated flavone analogs, Arch. Pharm. Res. 26 (2003) 345–350. [27] H. Che, H. Lim, H.P. Kim, H. Park, A chrysin analog exhibited strong inhibitory activities against both PGE2 and NO production, Eur. J. Med. Chem. 46 (2011) 4657–4660. [28] R.M. Laberge, L. Zhou, M.R. Sarantos, F. Rodier, A. Freund, P.L. de Keizer, et al., Glucocorticoids suppress selected components of the senescence-associated secretory phenotype, Aging Cell 11 (2012) 569–578. [29] J.H. Lee, H. Lim, O. Shehzad, Y.S. Kim, H.P. Kim, Ginsenosides from Korean red ginseng inhibit matrix metalloproteinase-13 expression in articular chondrocytes and prevent cartilage degradation, Eur. J. Pharmacol. 724 (2014) 145–151. [30] C. Canino, F. Mori, A. Cambria, A. Diamantini, S. Germoni, G. Alessandrini, et al., SASP mediates chemoresistance and tumor-initiating-activity of mesothelioma cells, Oncogene 31 (2012) 3148–3163. [31] C.K. Han, M.J. Son, H.W. Chang, Y.S. Chi, H. Park, H.P. Kim, Inhibition of prostaglandin production by a structurally-optimized flavonoid derivative, 20 ,40 ,7-trimethoxyflavone and cellular action mechanism, Biol. Pharm. Bull. 28 (2005) 1366–1370. [32] H. Lim, J.H. Jin, H. Park, H.P. Kim, New synthetic anti-inflammatory chrysin analog, 5,7-dihydroxy-8-(pyridine-4yl)flavone, Eur. J. Pharmacol. 670 (2011) 617–622. [33] F. Rodier, J.P. Coppe´, C.K. Patil, W.A. Hoeijmakers, D.P. Mun˜oz, S.R. Raza, et al., Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion, Nat. Cell Biol. 11 (2009) 973–979. [34] O. Moiseeva, X. Descheˆnes-Simard, E. St-Germain, S. Igelmann, G. Huot, A.E. Cadar, et al., Metformin inhibits the senescence-associated secretory phenotype by interfering with IKK/NF-kB activation, Aging Cell 12 (2013) 489–498. [35] Z. Wu, X. Zhang, J. Yang, G. Wu, Y. Zhang, Y. Yuan, et al., Nuclear protein IkB-z inhibits the activity of STAT3, Biochem. Biophys. Res. Commun. 387 (2009) 348–352. [36] T. Ohba, Y. Ariga, T. Maruyama, N.K. Truong, J. Inoue, T. Muta, Identification of interleukin-1 receptor-associated kinase 1 as a critical component that induces post-transcriptional activation of IkB-z, FEBS J. 279 (2012) 211–222. [37] J.A. Baur, K.J. Pearson, N.L. Price, H.A. Jamieson, C. Lerin, A. Kalra, et al., Resveratrol improves health and survival of mice on a high-calorie diet, Nature 444 (2006) 337–342. [38] J.G. Wood, B. Rogina, S. Lavu, K. Howitz, S.L. Helfand, M. Tatar, et al., Sirtuin activators mimic caloric restriction and delay ageing in metazoans, Nature 430 (2004) 686–689. [39] M.J. Park, E.K. Lee, H.S. Heo, M.S. Kim, B. Sung, M.K. Kim, et al., The antiinflammatory effect of kaempferol in aged kidney tissues: the involvement of nuclear factor-kB via nuclear factor-inducing kinase/IkB kinase and mitogenactivated protein kinase pathways, J. Med. Food 12 (2009) 351–358. [40] M.L. Neuhouser, Dietary flavonoids and cancer risk: evidence from human population studies, Nutr. Cancer 50 (2004) 1–7. [41] M.L. McCullough, J.J. Peterson, R. Patel, P.F. Jacques, R. Shah, J.T. Dwyer, Flavonoid intake and cardiovascular disease mortality in a prospective cohort of US adults, Am. J. Clin. Nutr. 95 (2012) 454–464. [42] P. Knekt, R. Ja¨rvinen, R. Seppa¨nen, M. Hello¨vaara, L. Teppo, E. Pukkala, et al., Dietary flavonoids and the risk of lung cancer and other malignant neoplasms, Am. J. Epidemiol. 146 (1997) 223–230. [43] M.G. Hertog, E.J. Feskens, P.C. Hollman, M.B. Katan, D. Kromhout, Dietary flavonoids and cancer risk in the Zutphen Elderly Study, Nutr. Cancer 22 (1994) 175–184. [44] P.F. Jacques, A. Cassidy, G. Rogers, J.J. Peterson, J.B. Meigs, J.T. Dwyer, Higher dietary flavonol intake is associated with lower incidence of type 2 diabetes, J. Nutr. 143 (2013) 1474–1480.