Original Research Cardiology 2014;127:236–244 DOI: 10.1159/000356471
Received: June 27, 2013 Accepted after revision: October 9, 2013 Published online: January 24, 2014
Effect of Inhibiting Malonyl-CoA Decarboxylase on Cardiac Remodeling after Myocardial Infarction in Rats Hongquan Wu Que Zhu Min Cai Xin Tong Dichuan Liu Jing Huang Gang Yang Yonghong Jiang Department of Cardiology, Second Affiliated Hospital, Chongqing Medical University, Chongquing, PR China
Abstract Objectives: The objective of this study was to determine the effect of inhibiting malonyl-CoA decarboxylase (MCD) on cardiac remodeling following myocardial infarction (MI) in rats. We used an ultrasound (US)-mediated microbubble (MB) approach for targeted delivery of a microRNA (miRNA) interference plasmid to the myocardium to silence MCD expression. Methods: Five pairs of RNA interference sequences were screened and ranked according to their highest inhibition rates in HEK293 cells. The plasmid with the highest inhibition rate was transfected by US into the rat myocardium after mixing with lipid MB. Twelve and 16 weeks after MI, cardiac function was measured by echocardiography, and glucose transporter-4 (GLUT-4) and high-energy phosphate levels were monitored in the myocardium before and after transfection. Results: Ejection fraction (EF) decreased by 16% in the control MI group, while it decreased by 8% in the MCD inhibition group that utilized the US-mediated MB approach. Concomitant with the improved EF, high-energy
© 2014 S. Karger AG, Basel 0008–6312/14/1274–0236$39.50/0 E-Mail [email protected] www.karger.com/crd
phosphates were increased and lactic acid was decreased in the left ventricle (LV), with no changes in triglyceride or GLUT-4 levels. Conclusions: Inhibiting MCD by an US-mediated injection of miRNA into the rat myocardium increased energy reserves in the LV after MI, most likely by limiting lactic acidosis and improving cardiac function without increasing lipid toxicity. © 2014 S. Karger AG, Basel
Introduction
During heart failure (HF), myocardial metabolic remodeling often occurs, depleting energy reserves without replenishing adenosine triphosphate (ATP) levels [1, 2]. The mitochondrion is the key organelle regulating myocardial metabolism [3] and is also the main location where reactive oxygen species are generated. An overabundance of fatty acid oxidation creates a heavy burden on the mitochondria, and this overabundance can induce mitochondrial impairment and cardiomyocyte apoptosis. Limiting fatty acid metabolism in mitochondria, there-
H.W. and Q.Z. contributed equally to this study.
Deputy Prof. Dichuan Liu Department of Cardiology Second Affiliated Hospital, Chongqing Medical University Chongqing 400010 (PR China) E-Mail LDC670220 @ 163.com
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Key Words Cardiac function · Heart failure · Malonyl-CoA decarboxylase · Microbubbles · RNA interference · Ultrasound
Table 1. Prescreening and negative sequences of miRNA expression vectors of the MCD gene in rats
miRNA
Oligonucleotide sequence 5′ to 3′
1-F 1-R 2-F 2-R 3-F 3-R 4-F 4-R Neg-F Neg-R
TGCTGAGTAGAAGACAGCAGCAGCGAGTTTTGGCCACTGACTGACTCGCTGCTTGTCTTCTACT CCTGAGTAGAAGACAAGCAGCGAGTCAGTCAGTGGCCAAAACTCGCTGCTGCTGTCTTCTACTC TGCTGTTCTGAAGCACCTCACAGGGCGTTTTGGCCACTGACTGACGCCCTGTGGTGCTTCAGAA CCTGTTCTGAAGCACCACAGGGCGTCAGTCAGTGGCCAAAACGCCCTGTGAGGTGCTTCAGAAC TGCTGAGACTTCGCCCACTCACCACTGTTTTGGCCACTGACTGACAGTGGTGAGGGCGAAGTCT CCTGAGACTTCGCCCTCACCACTGTCAGTCAGTGGCCAAAACAGTGGTGAGTGGGCGAAGTCTC TGCTGTTGACCATGAGGCCGCACGAGGTTTTGGCCACTGACTGACCTCGTGCGCTCATGGTCAA CCTGTTGACCATGAGCGCACGAGGTCAGTCAGTGGCCAAAACCTCGTGCGGCCTCATGGTCAAC tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc
Materials and Methods
sized as a positive control, and an MCD-miRNA-negative control plasmid was also constructed (table 1). The plasmids were confirmed by sequencing. Cell Culture and Plasmid Transfection HEK293 (human embryonic kidney 293) cells were grown to confluence in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS) in an incubator with 5% CO2 at 37 ° C. For the positive control group, cells were transfected with the pIRES2-DsRed-MCD construct. Green fluorescence was used to represent the MCD-miRNA interference plasmid [9]. For the negative control group, cells were co-transfected with the pIRES2DsRed-MCD and MCD-miRNA-negative control. For the interference groups, pIRES2-DsRed-MCD was co-transfected with the four MCD-miRNAs in separate experiments. The control group did not have a plasmid transfected into the cells. For each well, plasmid was mixed with PolyjetTM at a ratio of 1.0–3 μg, while 0.5 μg of MCD-miRNA and 0.5 μg of MCD expression plasmid were co-transfected into HEK293 cells. After 48 h of incubation, transfection efficiency was estimated by the amount of green and red fluorescence present by visualization under an inverted microscope. Each experiment was repeated 3 times.
MCD-mRNA Levels by RT-PCR In vivo Experiments After 48 h in culture, cells were incubated with 1 ml TRIpure (RP1002; Bioteke, Beijing, China). Total RNA was isolated and purified using a commercial kit (RP2402; Bioteke) according to manufacturer’s instructions. The purity of the RNA extracted was assessed by ultraviolet absorption. The ratio of absorption values at 260–280 nm (A260/A280) was calculated, and ratios ranging from 1.8 to 2.1 were identified as qualified. Using mRNA as a template, the total RNA was retrotranscribed to complementary DNA utilizing oligo-dT (37 ° C, 15 min), and transcriptase activity was stopped by heating the samples at 85 ° C for 5 s. A quantitative RNA reagent kit (Takara, Dalian, China) was used to measure mRNA levels. For MCD, the upstream primer was 5′-tacttcttctcccactgctccac-3′ and the downstream primer was 5′-ctcgttcctcccatactcctttc-3′. For GAPDH, the upstream primer was 5′-gaaggtgaaggtcggagtc-3′ and the downstream primer was 5′-gaagatggtgatgggatttc-3′. Levels were quantified by the 2–△△CT method with GAPDH as the housekeeping gene.
Plasmid Construction Four miRNA interference plasmids were constructed by Invitrogen along with one negative plasmid. The plasmid constructs were based on MCD sequences tested by BLAST to exclude nonspecific homogenic sequences in GenBank. The plasmids were named MCD-miRNA-1, MCD-miRNA-2, MCD-miRNA-3 and MCD-miRNA-4. A pIRES2-DsRed-MCD construct was synthe-
Effect of MCD Inhibition after MI
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
237
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
fore, could be an important therapy for HF. Previous research has demonstrated the benefit of increasing glucose metabolism or inhibiting fatty acid metabolism in ischemic myocardium [4, 5]. Malonyl-CoA (MCA) is a strong endogenous inhibitor of fatty acid metabolism in mitochondria, and MCA decarboxylase (MCD) inhibits the rate-limiting enzyme carnitine palmitoyltransferase-1 (CPT-1) during mitochondrial fatty acid uptake. MCD breaks down MCA in vitro and in vivo [6]. Inhibition of MCD in myocardial ischemia and reperfusion significantly downregulates fatty acid oxidation, promotes aerobic glycolysis, reduces acidosis and improves cardiac function [7]. Although inhibition of MCD has been shown to protect ischemic myocardium, effects on HF have not been examined. We hypothesized that myocardial systolic function in HF could be improved by preventing fatty acid influx into mitochondria by inhibiting MCD action. In this study, we used a post-myocardial infarction (MI) HF model and ultrasound (US)-mediated lipid microbubble (MB) delivery to target interference microRNA (miRNA) plasmid against MCD [8]. The aim of the current study was to explore the effect of targeted inhibition of MCD on cardiac function in post-MI myocardium.
Color version available online
cardiac function from a rat with HF 12 weeks after MI showing an apparent decrease in LVEF and LVFS, an increase in LVIDd and a decrease in LV dimension. d HE staining of rat myocardium with HF 12 weeks after MI demonstrating apparent swollen cardiomyocytes, fracture of cardiac fibers and interstitial hyperplasia in the remote noninfarcted region.
a
b
c
d
Rat HF Model The experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health, and the protocol was approved by the Ethics Committee of the Second Affiliated Hospital of the Chongqing Medical University. We used male Wistar rats weighing 200–250 g that were obtained from the Experimental Animal Center of the Chongqing Medical University. The rats were housed in a controlled environment (22 ± 1 ° C, 12-hour light-12-hour dark cycle) and allowed unrestricted access to standard diet (10% fat, 20% proteins and 70% carbohydrates) and water. HF was induced by ligation of the left anterior descending (LAD) coronary artery under chloral hydrate anesthesia (10% of a 300 mg/kg concentration) as described previously [10, 11]. MI was confirmed by ST segment elevation on an electrocardiogram. The sham surgery group underwent the same procedure, including anesthesia and open-chest surgery, but the LAD was not ligated. Twelve weeks after MI, all rats underwent echocardiography to determine cardiac function. A total of 35 rats survived the LAD ligation. Of the rats that died, 9 died perioperatively and 5 died postoperatively. In the sham surgery group, 13 rats survived, 2 died perioperatively and none died in the postoperative period. Of the survivors, 7 of the 13 rats were randomly chosen for further evaluation (fig. 1).
Animal Groups The 35 survivors were assigned to one of five groups (7 in each group). In the HF + NS group, the animals were injected with 1.5 ml saline without plasmid-MB mixture or US radiation (n = 7). In the HF + plasmid group, micro-MCD plasmids were injected without MB and US radiation (n = 7). In the HF + US + plasmid group, micro-MCD plasmids were injected under US radiation without MB (n = 7). In the HF + US + MB + plasmid group, a
238
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
1.5 ml mixture of micro-MCD plasmid and MB was injected under US radiation (n = 7). In the HF + US + MB + N-plasmid group, a 1.5 ml mixture of micro-MCD-negative control plasmid and MB were injected under US radiation (n = 7). Meanwhile, 7 Wistar rats in the sham surgery group were injected with 1.5 ml saline only. US-Targeted MB-Assisted Myocardial Infusion Twelve weeks after ligation, the rats were anesthetized intraperitoneally with 10% chloral hydrate (300 mg/kg), and 1.3 ml MB solution were injected according to the method described in two legal patents of China on the production method of US-MB (Nos. ZL 200910260916X and ZL 200410021905.3). In total, 2 mg of plasmid were slowly injected through the jugular vein at a speed of 3 ml/h over 20 min. During the process, 2D contrast echocardiography was used to monitor the myocardium at a radiation frequency of 1.6 MHz and receiving frequency of 3.2 MHz, a mechanic index of 1.3, and triggering once every 4–8 cardiac cycles until the contrast MB disappeared. The rats were retransfected every 4 days up to a total of six additional injections. At termination, expression of miRNA-MCD was estimated by realtime fluorescence quantitative polymerase chain reaction (RFQPCR). Echocardiography Echocardiography was used to measure the size and function of the left ventricle (LV) 12 and 16 weeks after MI (4 weeks after intervention). Briefly, the mice were anesthetized with 10% chloral hydrate and kept in a supine position on a warm blanket. Long-axis views of the LV were acquired at the chordae tendinae level. M-mode images were evaluated for LV end-diastolic internal diameter (LVIDd), LV posterior wall diameter (LVPWd), LV ejection fraction (LVEF; %) and LV fractional shortening (LVFS; %).
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Fig. 1. Animal model of HF following MI. a Echocardiogram from a healthy Wistar rat. b HE staining for normal myocardium from a healthy Wistar rat. c Deteriorated
Expression of mRNA-MCD in Myocardium with Real-Time PCR Total RNA was isolated from 200 mg myocardial tissue with an RNA extraction kit (RP1002; Bioteke); MCD expression was measured as described above. MCA Assay The MCA assay was performed as described before [12]. The noninfarcted myocardial tissue was snap frozen in liquid helium after being precooled in sulfosalicylic solution and 50 M 1,4-dithioerythritol (D8255, 1:9 w/v; Sigma, St. Louis, Mo., USA). The LV was homogenized in 5% sulfosalicylic acid and 50 M dithioerythritol buffer, assayed by high performance liquid chromatography (HPLC) and then compared to an MCA standard (M4263; Sigma). An LV sample was precooled in perchloric acid (1:9 w/v) to assay ceramides. The LV was homogenized and assayed by HPLC according to the manufacturer’s instructions and compared with an MCA standard (M4263) supplemented with 10% FBS. Triglyceride concentrations in serum and tissue were analyzed by ELISA (F001-2; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Blood was sampled from the caudal vein, and uncoagulated blood was centrifuged at 3,000 rpm for 15 min at 4 ° C to collect serum. Myocardial tissue (200 mg) was placed in 1.8 ml PBS (1:9 w/v; mg/μl). An aliquot (200 mg) was centrifuged at 3,000 rpm for 15 min at 4 ° C, and then the supernatant was assayed. Lactic acid was assessed at 530 nm using a lactic acid assay kit (Jiancheng, Nanjing, China).
High-Energy Phosphates in the Myocardium Adenosine monophosphate (AMP), adenosine diphosphate (ADP) and ATP levels were measured in the noninfarcted myocardium. A total of 200 mg myocardial tissue was treated with ceramide and added in phase to 220 mmol/l KH2PO4/K2HPO4 buffering solution (pH 7.0) and 5% methanol at a rate of 0.9 ml/min. For the detection phase, the waveforms of ATP, ADP and AMP were measured at 254 nm and phosphocreatine at 210 nm. The sample volume was 20 μl ATP (A1852; Sigma) and ADP (A2754; Sigma) standards were purchased. Statistics All data are expressed as means ± SEM. Data were analyzed using SPSS (version 17.0; SPSS, San Rafael, Calif., USA). A value of p < 0.05 was considered significant. Differences between mean values were tested using one-way analysis of variance, and the least significant difference post hoc test was used for statistical differences.
Results
Plasmid Screening The most efficient MCD-miRNA interference sequence in the HEK293 cells was as follows: forward, Effect of MCD Inhibition after MI
5′-TGCTGAGTAGAAGACAGCAGCAGC GAGTTTTGGCCACTGACTGACTCGCTGCTT GTCTTCTACT-3′ and reverse, 5′-CCTGAGTAGAAGA CAAGCAGCGAGTCAGTCAGTGGCCAAAACTC GCTGCTGCTGTCTTCTACTC-3′. The interference rate of miRNA-MCD was observed by RFQ-PCR under an inverted fluorescence microscope. At 48 h after transfection, eukaryotic expression of MCD and the interference rate were observed with an inverted fluorescence microscope. The interference rate of recombinant plasmid in HEK293 cells was approximately 80%. In addition, the expression of MCD-mRNA in the four interference groups was lower than in the negative control group (p < 0.05 for all), and the interference rate in group one was lower than that in the negative control group (p < 0.05). The expression of miRNA was lower than in the other interference groups (p < 0.05). There was no statistical difference between the negative and positive control groups, and there was no MCDmiRNA detected in the nonplasmid controls (fig. 2). Expression of MCD-mRNA and Gene Transfer in Rat Myocardium The US-mediated MB-targeted interference plasmid was successfully transfected in rats with HF to significantly decrease the expression of MCD-mRNA. The decrease in MCD increased the concentration of MCA in the myocardium. Compared to the sham plasmid group, the interference rate in the HF + US + MB + plasmid group reached 56% (p < 0.05). The concentration of MCA in the HF + US + MB + plasmid group (16 ± 3 nmol/g) was higher than that in the HF group (9 ± 2 nmol/g; p < 0.05) and sham group (13 ± 2 nmol/g; p < 0.05; fig. 3). Cardiac Function Post-MI rats demonstrated deteriorated cardiac function at 12 weeks, with LV enlargement, decreased LVEF and LVFS, and increased LVIDd compared to sham rats according to echocardiography. Twelve weeks after MI (before intervention), the groups did not differ. Four weeks after treatment, LVEF and LVFS were increased in the HF + US + MB + plasmid group compared with the HF group (p < 0.05) but decreased compared with the sham group (p < 0.05). The LVIDd in the HF + US + MB + plasmid group was lower than that in the HF group (p < 0.05) and higher than in sham group (p < 0.05). LVPWd in the HF + US + MB + plasmid group was not statistically different from the other interference groups (table 2). Cardiology 2014;127:236–244 DOI: 10.1159/000356471
239
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Histological Evaluation Paraffin-embedded sections were stained with hematoxylin and eosin for routine histological evaluation. Immunohistochemistry was performed to measure glucose transporter (GLUT)-4 levels using a primary antibody (sc-1608; Santa Cruz, Santa Cruz, Calif., USA) at a 1:100 dilution.
a
Fig. 2. Screening for MCD-miRNA interference plasmids. a Red fluorescent protein was used as a tracer to detect eukaryotic expression of the MCD gene for plasmid transfection in HEK293 cells under a fluorescent microscope (×200). b Green fluorescence protein as a tracing signal for detecting MCD-miRNA interference plasmid transfection in HEK293 cells under a fluorescent microscope (×200). c Interference rate of MCD-miRNA, a = Positive
a
40
*
20 0
HF + plasmid HF + US + plasmid
a
b
c
d
e
f
g
HF + US + MB + plasmid HF + US + MB + N-plasmid
100
*
20
80 60
MCA (nmol/g)
MCD-mRNA in myocardium (%)
concentration of MCA was 76% higher in the HF + US + MB + plasmid group than that in HF + plasmid group (p < 0.05), and 22% higher than that in the sham group 12 weeks after MI (* p < 0.05 vs. all other groups).
60
control; b = negative control; c = interference group 1; d = interference group 2; e = interference group 3; f = interference group 4; g = naked control. Compared to the no-interference saline-treated group, the interference rate was 82% in interference group 1, which was higher than that in any other group. * p < 0.05 vs. all other groups.
Sham + NS HF + NS
Fig. 3. MCD-miRNA interference plasmid in murine myocardium. a Interference rate of MCD-miRNA in different groups. b The
80
c
b
Color version available online
MCD-mRNA in cells (%)
100
*
40 20 0
b
15 10 5 0
Table 2. Values of echocardiography of animal models with HF after MI (mean ± SEM) Sham + NS
HF + NS
HF + plasmid
HF + US + plasmid
HF + US + MB + plasmid
HF + US + MB + N-plasmid
88±3 51±4 0.74±0.05 0.21±0.01
45±2 20±1 1.02±0.11 0.12±0.01
46±3 21±1 1.02±0.14 0.11±0.02
44±3 20±2 1.06±0.09 0.11±0.02
46±3** 20±1** 1.02±0.13** 0.12±0.01**
45±3 21±1 1.04±0.12 0.12±0.01
16 weeks after MI (4 weeks after intervention) LVEF, % 86±2 38±2 LVFS, % 50±4 15±2 LVIDd, cm 0.76±0.04 1.18±0.06 LVPWd, cm 0.21±0.01 0.10±0.01
39±2 15±1 1.17±0.09 0.09±0.01
37±3 16±2 1.17±0.08 0.10±0.01
42±2*, ** 18±1*, ** 1.08±0.09*, ** 0.10±0.01**
38±3 15±1 1.18±0.05 0.10±0.01
12 weeks after MI LVEF, % LVFS, % LVIDd, cm LVPWd, cm
240
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
* p < 0.05 vs. HF + NS, HF + plasmid, HF + US + plasmid, HF + US + MB + N-plasmid; ** p < 0.05 vs. sham + NS.
HF + plasmid HF + US + plasmid
*
0.200 0.100 0
a
*
b
groups, 34% higher than that in the HF + plasmid group (p < 0.05) and 101% higher than that in the sham group 12 weeks after MI (p < 0.05). c The concentration of triglycerides in the HF + US + MB + plasmid group was higher than that in the sham group (p < 0.05) and not significantly different compared with that in the HF + plasmid group. * p < 0.05 vs. all other groups; ** p < 0.05 vs. sham + NS.
Sham + NS HF + NS
HF + plasmid HF + US + plasmid
HF + US + MB + plasmid HF + US + MB + N-plasmid
ATP (mmol/mg)
2.50 2.00 1.50 1.00 0.50
3.00
*
0
a
Metabolite Assay Inhibiting MCD levels decreased the concentration of lactic acid in the myocardium, indicating a decrease in anaerobic oxidation and an increase in fatty acid metabolism. Taken together, lactic acidosis was improved in the myocardium. The increased concentration of ceramides in the MCD-inhibited group showed no significant effect on triglyceride levels in the myocardium or serum, indicating no abnormal lipid retention via the prevention of fatty acid entry into mitochondria. The concentration of lactic acid in the myocardium of the HF + US + MB + plasmid group was 30% lower than that in the HF group (p < 0.05), but was increased (61%) compared with the sham group (p < 0.05). The ceramide concentration in the myocardium of the HF + US + MB + plasmid group was 34% higher than in the HF group and 101% higher than in the sham group. The conEffect of MCD Inhibition after MI
**
c
Fig. 4. Metabolite concentrations. a The concentration of lactic acid in the HF + US + MB + plasmid group was less than that in the other intervention groups, 30% lower than that in the HF + plasmid group (p < 0.05) and 61% higher than that in the sham group 12 weeks after MI (p < 0.05). b The concentration of ceramide in the HF + US + MB + plasmid group was higher than that in the other intervention
Fig. 5. Phosphate concentrations. a The concentration of ATP in the HF + US + MB + plasmid group was 8% less than that in the sham + NS group, 23% higher than that in HF + NS group and 61% higher than that in the sham group 12 weeks after MI. b The concentration of ATP in the HF + US + MB + plasmid group was 19% less than that in the HF + US + MB + plasmid group and 13% higher than that in the HF + NS group. * p < 0.05 vs. all other groups.
0.06 0.05 0.04 0.03 0.02 0.01 0
2.00
*
1.00 0
b
centration of triglycerides in the myocardium of the HF + US + MB + plasmid group was 100% higher than that in the sham + NS group (p < 0.05), but was not significantly different compared to the HF + NS group (p < 0.05; fig. 4). Phosphates in the Myocardium In the US-mediated MB-carrying MCD-miRNA interferenced plasmid group, ATP concentration increased, indicating a heightened energy reserve in the post-MI myocardium. The concentration of ATP in the HF + US + MB + plasmid group was less than that in the sham + NS group (p < 0.05), but was higher than that in the HF + NS group (p < 0.05). The ADP concentration in the HF + US + MB + plasmid group was less than that in the sham + NS group (p < 0.05), but higher than in the HF + NS group (p < 0.05; fig. 5). Cardiology 2014;127:236–244 DOI: 10.1159/000356471
241
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
0.300
60 50 40 30 20 10 0
ADP (mmol/mg)
0.400
Ceramide (mmol/gprot)
Lactic acid (mmol/gprot)
0.500
HF + US + MB + plasmid HF + US + MB + N-plasmid Myocardial triglycerides (mmol/gprot)
Sham + NS HF + NS
Color version available online
Sham + NS
HF + plasmid
HF + US + MB + plasmid
Histological Evaluation Following MI, the saline-treated group showed swollen cardiomyocytes, fractured cardiac fibers and interstitial fibrosis compared to the sham rats (fig. 5). In the sham + NS group, cardiomyocytes were normally arranged, while myocyte disarray and hypertrophy was evident in the MI groups. The expression of GLUT4 was not statistically different between the groups (fig. 6).
Discussion
It has previously been demonstrated that plasmids introduced by US-mediated MB injection show increased efficacy compared with plasmids injected directly into the myocardium without MB [13]. The goal of the current 242
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
HF + US + plasmid
HF + US + MB + N-plasmid
study was to determine whether MB injection could improve cardiac function in a rat HF model. Cardiac function was significantly deteriorated by 12 weeks after MI. Four weeks after treatment, the decrease in MCD increased MCA levels and improved cardiac function by preventing enlargement of the cardiac chambers. Our results suggest that inhibition of MCD could be a potential treatment for congestive HF. Traditional small interfering RNA (siRNA) might influence cellular metabolism, especially if it interacts with endogenous miRNAs. Further, siRNA at very high levels could induce cell damage [14]. The exogenous administration of miRNA, a second-generation siRNA interference technique, shows similar production levels as endogenous miRNA and may avoid dosage issues seen with siRNA [15]. In addition, targeting a gene with miRNA is a more accurate approach [16]. Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Fig. 6. Cardiac fiber arrangements. In the sham + NS group, cardiomyocytes were arranged in sequence as normal. In contrast, there was cardiac fiber fracture or hypertrophy in the other intervention groups. There was no statistically significant difference in GLUT-4 expression among the groups.
HF + NS
We found that MCD gene expression could be significantly inhibited by miRNA interference with US-mediated MB injection into the target region, and this approach increased the MCD concentration significantly. Four weeks after treatment, however, both LVEF and LVFS were further decreased compared to the pretreatment MI levels, indicating that acute MCD inhibition had no effect on ventricular remodeling. In contrast, inhibition of MCD reduced lactic acid concentrations in the myocardium 28 days after MI. This may be due to increased aerobic oxidation of glucose and reduced glycolysis by preventing long-chain MCA into mitochondria and reducing oxidation of fatty acids to remove the inhibition of pyruvate dehydrogenase. The buildup of lactic acid in the cell can cause toxicity. The decrease in pH can alter the binding of Ca2+ to stimulate systolic dysfunction. Furthermore, the decrease in pH can stimulate Na+/H+ exchange to induce extracellular Ca2+ overload and cell death. Improvement of acidosis by lactic acid reduction could be one of the mechanisms improving systolic function [17]. Another possible mechanism is increased glucose oxidation due to decreased fatty acid oxidation from glucose and fat metabolism. Ischemia and anoxia are common in the failing myocardium. Although the oxidation of fatty acids produces more oxygen than that of glucose, apparent increases in ATP may reduce oxygen consumption and increase mitochondrial efficiency. Thus, energy derived from fatty acids is more beneficial than energy from glucose, even regarding potentially increased side effects. The presence of ceramide in the myocardium is subject to controversy due to its potential lipotoxicity [18, 19]. Although ceramide has been detected in post-MI myocardium, its effect on cardiac systolic function and ventricular remodeling remains to be elucidated [20, 21]. Ceramide levels increase with HF deterioration; however, controversy exists regarding in vitro and in vivo results [22]. Ceramides have not been shown to directly cause cardiac dysfunction in previous research [11, 23, 24]. In this study, cardiac dysfunction was not present at the 8-week post-MI time point. Ceramide levels, however, continually increased up to 12 weeks after MI, indicating that ceramides may play an indirect role in the development of HF. Previous studies have revealed that an elevated ceramide level can inhibit the insulin signal channel, which results in decreased insulin sensitivity [25, 26]. Therefore, the elevated ceramide level may be secondary to obstructed glucose uptake by cardiomyocytes, which would lead
to a deterioration in cardiac function. However, there was no significant change in GLUT-4 staining, even after MCD inhibition and ceramide level decreases. This result suggests that the improvement in cardiac function may not depend on the increase in insulin-independent GLUT-4 after MCD inhibition. A goal in treating HF is to increase the efficiency of myocardial metabolism to adapt to the demands for energy on exertion. Inhibition of CPT-1 directly improved cardiac function in previous animal experiments and clinical trials [27], but also demonstrated toxic effects on the liver [28]. MCA, an endogenous inhibitor of CPT-1, can inhibit CPT-1 derived from the myocardium more effectively than CPT-1 derived from the liver [29]. Thus, this strategy will likely limit the potential for liver toxicity.
Effect of MCD Inhibition after MI
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
Conclusion
The current study demonstrated that MCD inhibition may provide a promising novel treatment strategy for HF. The mechanism of action of MCD inhibition is to increase MCA levels, thereby indirectly inhibiting CPT-1 and increasing energy phosphate levels.
Acknowledgments The study was support by the National Natural Science Foundation of China (grant No. 30670870) and the Chongqing Municipal Science and Technology Commission of the Natural Science Foundation of China (cstc2012jjA10085).
Conflicts of Interest The authors declare there are no conflicts of interest.
1 Ashrafian H, Frenneaux MP, Opie LH: Metabolic mechanisms in heart failure. Circulation 2007;116:434–448. 2 Ingwall JS: Energy metabolism in heart failure and remodelling. Cardiovasc Res 2009; 81: 412–419. 3 Palaniyandi SS, Qi X, Yogalingam G, Ferreira JC, Mochly-Rosen D: Regulation of mitochondrial processes: a target for heart failure. Drug Discov Today Dis Mech 2010; 7:e95– e102. 4 Kuzmicic J, Del Campo A, Lopez-Crisosto C, et al: Mitochondrial dynamics: a potential new therapeutic target for heart failure. Rev Esp Cardiol 2011;64:916–923.
243
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
References
244
15 Chang K, Elledge SJ, Hannon GJ: Lessons from Nature: microRNA-based shRNA libraries. Nat Methods 2006;3:707–714. 16 Ely A, Naidoo T, Mufamadi S, Crowther C, Arbuthnot P: Expressed anti-HBV primary microRNA shuttles inhibit viral replication efficiently in vitro and in vivo. Mol Ther 2008; 16:1105–1112. 17 Liu Q, Docherty JC, Rendell JC, Clanachan AS, Lopaschuk GD: High levels of fatty acids delay the recovery of intracellular pH and cardiac efficiency in post-ischemic hearts by inhibiting glucose oxidation. J Am Coll Cardiol 2002;39:718–725. 18 Park TS, Yamashita H, Blaner WS, Goldberg IJ: Lipids in the heart: a source of fuel and a source of toxins. Curr Opin Lipidol 2007; 18: 277–282. 19 Stanley WC, Recchia FA: Lipotoxicity and the development of heart failure: moving from mouse to man. Cell Metab 2010;12:555. 20 Wende AR, Abel ED: Lipotoxicity in the heart. Biochim Biophys Acta 2010;1801:311– 319. 21 Morgan EE, Rennison JH, Young ME, et al: Effects of chronic activation of peroxisome proliferator-activated receptor-alpha or highfat feeding in a rat infarct model of heart failure. Am J Physiol Heart Circ Physiol 2006; 290:H1899–H1904. 22 Sharma S, Adrogue JV, Golfman L, et al: Intramyocardial lipid accumulation in the failing human heart resembles the lipotoxic rat heart. FASEB J 2004;18:1692–1700.
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
23 Rennison JH, McElfresh TA, Okere IC, et al: High-fat diet postinfarction enhances mitochondrial function and does not exacerbate left ventricular dysfunction. Am J Physiol Heart Circ Physiol 2007;292:H1498–H1506. 24 Morgan EE, Rennison JH, Young ME, et al: Effects of chronic activation of peroxisome proliferator-activated receptor-alpha or highfat feeding in a rat infarct model of heart failure. Am J Physiol Heart Circ Physiol 2006; 290:H1899–H1904. 25 Chess DJ, Stanley WC: Role of diet and fuel overabundance in the development and progression of heart failure. Cardiovasc Res 2008; 79:269–278. 26 Zhang L, Ussher JR, Oka T, Cadete VJ, Wagg C, Lopaschuk GD: Cardiac diacylglycerol accumulation in high fat-fed mice is associated with impaired insulin-stimulated glucose oxidation. Cardiovasc Res 2011;89:148–156. 27 Lionetti V, Linke A, Chandler MP, et al: Carnitine palmitoyl transferase-I inhibition prevents ventricular remodeling and delays decompensation in pacing-induced heart failure. Cardiovasc Res 2005;66:454–461. 28 Holubarsch CJ, Rohrbach M, Karrasch M, et al: A double-blind randomized multicentre clinical trial to evaluate the efficacy and safety of two doses of etomoxir in comparison with placebo in patients with moderate congestive heart failure: the ERGO (etomoxir for the recovery of glucose oxidation) study. Clin Sci (Lond) 2007;113:205–212. 29 Schreurs M, Kuipers F, van der Leij FR: Regulatory enzymes of mitochondrial beta-oxidation as targets for treatment of the metabolic syndrome. Obes Rev 2010;11:380–388.
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
5 van Bilsen M, van Nieuwenhoven FA, van der Vusse GJ: Metabolic remodelling of the failing heart: beneficial or detrimental. Cardiovasc Res 2009;81:420–428. 6 Folmes CD, Lopaschuk GD: Role of malonylCoA in heart disease and the hypothalamic control of obesity. Cardiovasc Res 2007; 73: 278–287. 7 Ussher JR, Lopaschuk GD: The malonyl CoA axis as a potential target for treating ischaemic heart disease. Cardiovasc Res 2008;79:259–268. 8 Hernot S, Klibanov AL: Microbubbles in ultrasound-triggered drug and gene delivery. Adv Drug Deliv Rev 2008;60:1153–1166. 9 Tsien RY: The green fluorescent protein. Annu Rev Biochem 1998;67:509–544. 10 Baily RG, Lehman JC, Gubin SS, Musch TI: Non-invasive assessment of ventricular damage in rats with myocardial infarction. Cardiovasc Res 1993;27:851–855. 11 Rennison JH, McElfresh TA, Okere IC, et al: Enhanced acyl-CoA dehydrogenase activity is associated with improved mitochondrial and contractile function in heart failure. Cardiovasc Res 2008;79:331–340. 12 Demoz A, Garras A, Asiedu DK, Netteland B, Berge RK: Rapid method for the separation and detection of tissue short-chain coenzyme A esters by reversed-phase high-performance liquid chromatography. J Chromatogr B Biomed Appl 1995;667:148–152. 13 Mayer CR, Bekeredjian R: Ultrasonic gene and drug delivery to the cardiovascular system. Adv Drug Deliv Rev 2008;60:1177–1192. 14 Boudreau RL, Martins I, Davidson BL: Artificial microRNAs as siRNA shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther 2009;17:169–175.
Received: June 27, 2013 Accepted after revision: October 9, 2013 Published online: January 24, 2014
Effect of Inhibiting Malonyl-CoA Decarboxylase on Cardiac Remodeling after Myocardial Infarction in Rats Hongquan Wu Que Zhu Min Cai Xin Tong Dichuan Liu Jing Huang Gang Yang Yonghong Jiang Department of Cardiology, Second Affiliated Hospital, Chongqing Medical University, Chongquing, PR China
Abstract Objectives: The objective of this study was to determine the effect of inhibiting malonyl-CoA decarboxylase (MCD) on cardiac remodeling following myocardial infarction (MI) in rats. We used an ultrasound (US)-mediated microbubble (MB) approach for targeted delivery of a microRNA (miRNA) interference plasmid to the myocardium to silence MCD expression. Methods: Five pairs of RNA interference sequences were screened and ranked according to their highest inhibition rates in HEK293 cells. The plasmid with the highest inhibition rate was transfected by US into the rat myocardium after mixing with lipid MB. Twelve and 16 weeks after MI, cardiac function was measured by echocardiography, and glucose transporter-4 (GLUT-4) and high-energy phosphate levels were monitored in the myocardium before and after transfection. Results: Ejection fraction (EF) decreased by 16% in the control MI group, while it decreased by 8% in the MCD inhibition group that utilized the US-mediated MB approach. Concomitant with the improved EF, high-energy
© 2014 S. Karger AG, Basel 0008–6312/14/1274–0236$39.50/0 E-Mail [email protected] www.karger.com/crd
phosphates were increased and lactic acid was decreased in the left ventricle (LV), with no changes in triglyceride or GLUT-4 levels. Conclusions: Inhibiting MCD by an US-mediated injection of miRNA into the rat myocardium increased energy reserves in the LV after MI, most likely by limiting lactic acidosis and improving cardiac function without increasing lipid toxicity. © 2014 S. Karger AG, Basel
Introduction
During heart failure (HF), myocardial metabolic remodeling often occurs, depleting energy reserves without replenishing adenosine triphosphate (ATP) levels [1, 2]. The mitochondrion is the key organelle regulating myocardial metabolism [3] and is also the main location where reactive oxygen species are generated. An overabundance of fatty acid oxidation creates a heavy burden on the mitochondria, and this overabundance can induce mitochondrial impairment and cardiomyocyte apoptosis. Limiting fatty acid metabolism in mitochondria, there-
H.W. and Q.Z. contributed equally to this study.
Deputy Prof. Dichuan Liu Department of Cardiology Second Affiliated Hospital, Chongqing Medical University Chongqing 400010 (PR China) E-Mail LDC670220 @ 163.com
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Key Words Cardiac function · Heart failure · Malonyl-CoA decarboxylase · Microbubbles · RNA interference · Ultrasound
Table 1. Prescreening and negative sequences of miRNA expression vectors of the MCD gene in rats
miRNA
Oligonucleotide sequence 5′ to 3′
1-F 1-R 2-F 2-R 3-F 3-R 4-F 4-R Neg-F Neg-R
TGCTGAGTAGAAGACAGCAGCAGCGAGTTTTGGCCACTGACTGACTCGCTGCTTGTCTTCTACT CCTGAGTAGAAGACAAGCAGCGAGTCAGTCAGTGGCCAAAACTCGCTGCTGCTGTCTTCTACTC TGCTGTTCTGAAGCACCTCACAGGGCGTTTTGGCCACTGACTGACGCCCTGTGGTGCTTCAGAA CCTGTTCTGAAGCACCACAGGGCGTCAGTCAGTGGCCAAAACGCCCTGTGAGGTGCTTCAGAAC TGCTGAGACTTCGCCCACTCACCACTGTTTTGGCCACTGACTGACAGTGGTGAGGGCGAAGTCT CCTGAGACTTCGCCCTCACCACTGTCAGTCAGTGGCCAAAACAGTGGTGAGTGGGCGAAGTCTC TGCTGTTGACCATGAGGCCGCACGAGGTTTTGGCCACTGACTGACCTCGTGCGCTCATGGTCAA CCTGTTGACCATGAGCGCACGAGGTCAGTCAGTGGCCAAAACCTCGTGCGGCCTCATGGTCAAC tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc
Materials and Methods
sized as a positive control, and an MCD-miRNA-negative control plasmid was also constructed (table 1). The plasmids were confirmed by sequencing. Cell Culture and Plasmid Transfection HEK293 (human embryonic kidney 293) cells were grown to confluence in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS) in an incubator with 5% CO2 at 37 ° C. For the positive control group, cells were transfected with the pIRES2-DsRed-MCD construct. Green fluorescence was used to represent the MCD-miRNA interference plasmid [9]. For the negative control group, cells were co-transfected with the pIRES2DsRed-MCD and MCD-miRNA-negative control. For the interference groups, pIRES2-DsRed-MCD was co-transfected with the four MCD-miRNAs in separate experiments. The control group did not have a plasmid transfected into the cells. For each well, plasmid was mixed with PolyjetTM at a ratio of 1.0–3 μg, while 0.5 μg of MCD-miRNA and 0.5 μg of MCD expression plasmid were co-transfected into HEK293 cells. After 48 h of incubation, transfection efficiency was estimated by the amount of green and red fluorescence present by visualization under an inverted microscope. Each experiment was repeated 3 times.
MCD-mRNA Levels by RT-PCR In vivo Experiments After 48 h in culture, cells were incubated with 1 ml TRIpure (RP1002; Bioteke, Beijing, China). Total RNA was isolated and purified using a commercial kit (RP2402; Bioteke) according to manufacturer’s instructions. The purity of the RNA extracted was assessed by ultraviolet absorption. The ratio of absorption values at 260–280 nm (A260/A280) was calculated, and ratios ranging from 1.8 to 2.1 were identified as qualified. Using mRNA as a template, the total RNA was retrotranscribed to complementary DNA utilizing oligo-dT (37 ° C, 15 min), and transcriptase activity was stopped by heating the samples at 85 ° C for 5 s. A quantitative RNA reagent kit (Takara, Dalian, China) was used to measure mRNA levels. For MCD, the upstream primer was 5′-tacttcttctcccactgctccac-3′ and the downstream primer was 5′-ctcgttcctcccatactcctttc-3′. For GAPDH, the upstream primer was 5′-gaaggtgaaggtcggagtc-3′ and the downstream primer was 5′-gaagatggtgatgggatttc-3′. Levels were quantified by the 2–△△CT method with GAPDH as the housekeeping gene.
Plasmid Construction Four miRNA interference plasmids were constructed by Invitrogen along with one negative plasmid. The plasmid constructs were based on MCD sequences tested by BLAST to exclude nonspecific homogenic sequences in GenBank. The plasmids were named MCD-miRNA-1, MCD-miRNA-2, MCD-miRNA-3 and MCD-miRNA-4. A pIRES2-DsRed-MCD construct was synthe-
Effect of MCD Inhibition after MI
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
237
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
fore, could be an important therapy for HF. Previous research has demonstrated the benefit of increasing glucose metabolism or inhibiting fatty acid metabolism in ischemic myocardium [4, 5]. Malonyl-CoA (MCA) is a strong endogenous inhibitor of fatty acid metabolism in mitochondria, and MCA decarboxylase (MCD) inhibits the rate-limiting enzyme carnitine palmitoyltransferase-1 (CPT-1) during mitochondrial fatty acid uptake. MCD breaks down MCA in vitro and in vivo [6]. Inhibition of MCD in myocardial ischemia and reperfusion significantly downregulates fatty acid oxidation, promotes aerobic glycolysis, reduces acidosis and improves cardiac function [7]. Although inhibition of MCD has been shown to protect ischemic myocardium, effects on HF have not been examined. We hypothesized that myocardial systolic function in HF could be improved by preventing fatty acid influx into mitochondria by inhibiting MCD action. In this study, we used a post-myocardial infarction (MI) HF model and ultrasound (US)-mediated lipid microbubble (MB) delivery to target interference microRNA (miRNA) plasmid against MCD [8]. The aim of the current study was to explore the effect of targeted inhibition of MCD on cardiac function in post-MI myocardium.
Color version available online
cardiac function from a rat with HF 12 weeks after MI showing an apparent decrease in LVEF and LVFS, an increase in LVIDd and a decrease in LV dimension. d HE staining of rat myocardium with HF 12 weeks after MI demonstrating apparent swollen cardiomyocytes, fracture of cardiac fibers and interstitial hyperplasia in the remote noninfarcted region.
a
b
c
d
Rat HF Model The experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health, and the protocol was approved by the Ethics Committee of the Second Affiliated Hospital of the Chongqing Medical University. We used male Wistar rats weighing 200–250 g that were obtained from the Experimental Animal Center of the Chongqing Medical University. The rats were housed in a controlled environment (22 ± 1 ° C, 12-hour light-12-hour dark cycle) and allowed unrestricted access to standard diet (10% fat, 20% proteins and 70% carbohydrates) and water. HF was induced by ligation of the left anterior descending (LAD) coronary artery under chloral hydrate anesthesia (10% of a 300 mg/kg concentration) as described previously [10, 11]. MI was confirmed by ST segment elevation on an electrocardiogram. The sham surgery group underwent the same procedure, including anesthesia and open-chest surgery, but the LAD was not ligated. Twelve weeks after MI, all rats underwent echocardiography to determine cardiac function. A total of 35 rats survived the LAD ligation. Of the rats that died, 9 died perioperatively and 5 died postoperatively. In the sham surgery group, 13 rats survived, 2 died perioperatively and none died in the postoperative period. Of the survivors, 7 of the 13 rats were randomly chosen for further evaluation (fig. 1).
Animal Groups The 35 survivors were assigned to one of five groups (7 in each group). In the HF + NS group, the animals were injected with 1.5 ml saline without plasmid-MB mixture or US radiation (n = 7). In the HF + plasmid group, micro-MCD plasmids were injected without MB and US radiation (n = 7). In the HF + US + plasmid group, micro-MCD plasmids were injected under US radiation without MB (n = 7). In the HF + US + MB + plasmid group, a
238
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
1.5 ml mixture of micro-MCD plasmid and MB was injected under US radiation (n = 7). In the HF + US + MB + N-plasmid group, a 1.5 ml mixture of micro-MCD-negative control plasmid and MB were injected under US radiation (n = 7). Meanwhile, 7 Wistar rats in the sham surgery group were injected with 1.5 ml saline only. US-Targeted MB-Assisted Myocardial Infusion Twelve weeks after ligation, the rats were anesthetized intraperitoneally with 10% chloral hydrate (300 mg/kg), and 1.3 ml MB solution were injected according to the method described in two legal patents of China on the production method of US-MB (Nos. ZL 200910260916X and ZL 200410021905.3). In total, 2 mg of plasmid were slowly injected through the jugular vein at a speed of 3 ml/h over 20 min. During the process, 2D contrast echocardiography was used to monitor the myocardium at a radiation frequency of 1.6 MHz and receiving frequency of 3.2 MHz, a mechanic index of 1.3, and triggering once every 4–8 cardiac cycles until the contrast MB disappeared. The rats were retransfected every 4 days up to a total of six additional injections. At termination, expression of miRNA-MCD was estimated by realtime fluorescence quantitative polymerase chain reaction (RFQPCR). Echocardiography Echocardiography was used to measure the size and function of the left ventricle (LV) 12 and 16 weeks after MI (4 weeks after intervention). Briefly, the mice were anesthetized with 10% chloral hydrate and kept in a supine position on a warm blanket. Long-axis views of the LV were acquired at the chordae tendinae level. M-mode images were evaluated for LV end-diastolic internal diameter (LVIDd), LV posterior wall diameter (LVPWd), LV ejection fraction (LVEF; %) and LV fractional shortening (LVFS; %).
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Fig. 1. Animal model of HF following MI. a Echocardiogram from a healthy Wistar rat. b HE staining for normal myocardium from a healthy Wistar rat. c Deteriorated
Expression of mRNA-MCD in Myocardium with Real-Time PCR Total RNA was isolated from 200 mg myocardial tissue with an RNA extraction kit (RP1002; Bioteke); MCD expression was measured as described above. MCA Assay The MCA assay was performed as described before [12]. The noninfarcted myocardial tissue was snap frozen in liquid helium after being precooled in sulfosalicylic solution and 50 M 1,4-dithioerythritol (D8255, 1:9 w/v; Sigma, St. Louis, Mo., USA). The LV was homogenized in 5% sulfosalicylic acid and 50 M dithioerythritol buffer, assayed by high performance liquid chromatography (HPLC) and then compared to an MCA standard (M4263; Sigma). An LV sample was precooled in perchloric acid (1:9 w/v) to assay ceramides. The LV was homogenized and assayed by HPLC according to the manufacturer’s instructions and compared with an MCA standard (M4263) supplemented with 10% FBS. Triglyceride concentrations in serum and tissue were analyzed by ELISA (F001-2; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Blood was sampled from the caudal vein, and uncoagulated blood was centrifuged at 3,000 rpm for 15 min at 4 ° C to collect serum. Myocardial tissue (200 mg) was placed in 1.8 ml PBS (1:9 w/v; mg/μl). An aliquot (200 mg) was centrifuged at 3,000 rpm for 15 min at 4 ° C, and then the supernatant was assayed. Lactic acid was assessed at 530 nm using a lactic acid assay kit (Jiancheng, Nanjing, China).
High-Energy Phosphates in the Myocardium Adenosine monophosphate (AMP), adenosine diphosphate (ADP) and ATP levels were measured in the noninfarcted myocardium. A total of 200 mg myocardial tissue was treated with ceramide and added in phase to 220 mmol/l KH2PO4/K2HPO4 buffering solution (pH 7.0) and 5% methanol at a rate of 0.9 ml/min. For the detection phase, the waveforms of ATP, ADP and AMP were measured at 254 nm and phosphocreatine at 210 nm. The sample volume was 20 μl ATP (A1852; Sigma) and ADP (A2754; Sigma) standards were purchased. Statistics All data are expressed as means ± SEM. Data were analyzed using SPSS (version 17.0; SPSS, San Rafael, Calif., USA). A value of p < 0.05 was considered significant. Differences between mean values were tested using one-way analysis of variance, and the least significant difference post hoc test was used for statistical differences.
Results
Plasmid Screening The most efficient MCD-miRNA interference sequence in the HEK293 cells was as follows: forward, Effect of MCD Inhibition after MI
5′-TGCTGAGTAGAAGACAGCAGCAGC GAGTTTTGGCCACTGACTGACTCGCTGCTT GTCTTCTACT-3′ and reverse, 5′-CCTGAGTAGAAGA CAAGCAGCGAGTCAGTCAGTGGCCAAAACTC GCTGCTGCTGTCTTCTACTC-3′. The interference rate of miRNA-MCD was observed by RFQ-PCR under an inverted fluorescence microscope. At 48 h after transfection, eukaryotic expression of MCD and the interference rate were observed with an inverted fluorescence microscope. The interference rate of recombinant plasmid in HEK293 cells was approximately 80%. In addition, the expression of MCD-mRNA in the four interference groups was lower than in the negative control group (p < 0.05 for all), and the interference rate in group one was lower than that in the negative control group (p < 0.05). The expression of miRNA was lower than in the other interference groups (p < 0.05). There was no statistical difference between the negative and positive control groups, and there was no MCDmiRNA detected in the nonplasmid controls (fig. 2). Expression of MCD-mRNA and Gene Transfer in Rat Myocardium The US-mediated MB-targeted interference plasmid was successfully transfected in rats with HF to significantly decrease the expression of MCD-mRNA. The decrease in MCD increased the concentration of MCA in the myocardium. Compared to the sham plasmid group, the interference rate in the HF + US + MB + plasmid group reached 56% (p < 0.05). The concentration of MCA in the HF + US + MB + plasmid group (16 ± 3 nmol/g) was higher than that in the HF group (9 ± 2 nmol/g; p < 0.05) and sham group (13 ± 2 nmol/g; p < 0.05; fig. 3). Cardiac Function Post-MI rats demonstrated deteriorated cardiac function at 12 weeks, with LV enlargement, decreased LVEF and LVFS, and increased LVIDd compared to sham rats according to echocardiography. Twelve weeks after MI (before intervention), the groups did not differ. Four weeks after treatment, LVEF and LVFS were increased in the HF + US + MB + plasmid group compared with the HF group (p < 0.05) but decreased compared with the sham group (p < 0.05). The LVIDd in the HF + US + MB + plasmid group was lower than that in the HF group (p < 0.05) and higher than in sham group (p < 0.05). LVPWd in the HF + US + MB + plasmid group was not statistically different from the other interference groups (table 2). Cardiology 2014;127:236–244 DOI: 10.1159/000356471
239
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Histological Evaluation Paraffin-embedded sections were stained with hematoxylin and eosin for routine histological evaluation. Immunohistochemistry was performed to measure glucose transporter (GLUT)-4 levels using a primary antibody (sc-1608; Santa Cruz, Santa Cruz, Calif., USA) at a 1:100 dilution.
a
Fig. 2. Screening for MCD-miRNA interference plasmids. a Red fluorescent protein was used as a tracer to detect eukaryotic expression of the MCD gene for plasmid transfection in HEK293 cells under a fluorescent microscope (×200). b Green fluorescence protein as a tracing signal for detecting MCD-miRNA interference plasmid transfection in HEK293 cells under a fluorescent microscope (×200). c Interference rate of MCD-miRNA, a = Positive
a
40
*
20 0
HF + plasmid HF + US + plasmid
a
b
c
d
e
f
g
HF + US + MB + plasmid HF + US + MB + N-plasmid
100
*
20
80 60
MCA (nmol/g)
MCD-mRNA in myocardium (%)
concentration of MCA was 76% higher in the HF + US + MB + plasmid group than that in HF + plasmid group (p < 0.05), and 22% higher than that in the sham group 12 weeks after MI (* p < 0.05 vs. all other groups).
60
control; b = negative control; c = interference group 1; d = interference group 2; e = interference group 3; f = interference group 4; g = naked control. Compared to the no-interference saline-treated group, the interference rate was 82% in interference group 1, which was higher than that in any other group. * p < 0.05 vs. all other groups.
Sham + NS HF + NS
Fig. 3. MCD-miRNA interference plasmid in murine myocardium. a Interference rate of MCD-miRNA in different groups. b The
80
c
b
Color version available online
MCD-mRNA in cells (%)
100
*
40 20 0
b
15 10 5 0
Table 2. Values of echocardiography of animal models with HF after MI (mean ± SEM) Sham + NS
HF + NS
HF + plasmid
HF + US + plasmid
HF + US + MB + plasmid
HF + US + MB + N-plasmid
88±3 51±4 0.74±0.05 0.21±0.01
45±2 20±1 1.02±0.11 0.12±0.01
46±3 21±1 1.02±0.14 0.11±0.02
44±3 20±2 1.06±0.09 0.11±0.02
46±3** 20±1** 1.02±0.13** 0.12±0.01**
45±3 21±1 1.04±0.12 0.12±0.01
16 weeks after MI (4 weeks after intervention) LVEF, % 86±2 38±2 LVFS, % 50±4 15±2 LVIDd, cm 0.76±0.04 1.18±0.06 LVPWd, cm 0.21±0.01 0.10±0.01
39±2 15±1 1.17±0.09 0.09±0.01
37±3 16±2 1.17±0.08 0.10±0.01
42±2*, ** 18±1*, ** 1.08±0.09*, ** 0.10±0.01**
38±3 15±1 1.18±0.05 0.10±0.01
12 weeks after MI LVEF, % LVFS, % LVIDd, cm LVPWd, cm
240
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
* p < 0.05 vs. HF + NS, HF + plasmid, HF + US + plasmid, HF + US + MB + N-plasmid; ** p < 0.05 vs. sham + NS.
HF + plasmid HF + US + plasmid
*
0.200 0.100 0
a
*
b
groups, 34% higher than that in the HF + plasmid group (p < 0.05) and 101% higher than that in the sham group 12 weeks after MI (p < 0.05). c The concentration of triglycerides in the HF + US + MB + plasmid group was higher than that in the sham group (p < 0.05) and not significantly different compared with that in the HF + plasmid group. * p < 0.05 vs. all other groups; ** p < 0.05 vs. sham + NS.
Sham + NS HF + NS
HF + plasmid HF + US + plasmid
HF + US + MB + plasmid HF + US + MB + N-plasmid
ATP (mmol/mg)
2.50 2.00 1.50 1.00 0.50
3.00
*
0
a
Metabolite Assay Inhibiting MCD levels decreased the concentration of lactic acid in the myocardium, indicating a decrease in anaerobic oxidation and an increase in fatty acid metabolism. Taken together, lactic acidosis was improved in the myocardium. The increased concentration of ceramides in the MCD-inhibited group showed no significant effect on triglyceride levels in the myocardium or serum, indicating no abnormal lipid retention via the prevention of fatty acid entry into mitochondria. The concentration of lactic acid in the myocardium of the HF + US + MB + plasmid group was 30% lower than that in the HF group (p < 0.05), but was increased (61%) compared with the sham group (p < 0.05). The ceramide concentration in the myocardium of the HF + US + MB + plasmid group was 34% higher than in the HF group and 101% higher than in the sham group. The conEffect of MCD Inhibition after MI
**
c
Fig. 4. Metabolite concentrations. a The concentration of lactic acid in the HF + US + MB + plasmid group was less than that in the other intervention groups, 30% lower than that in the HF + plasmid group (p < 0.05) and 61% higher than that in the sham group 12 weeks after MI (p < 0.05). b The concentration of ceramide in the HF + US + MB + plasmid group was higher than that in the other intervention
Fig. 5. Phosphate concentrations. a The concentration of ATP in the HF + US + MB + plasmid group was 8% less than that in the sham + NS group, 23% higher than that in HF + NS group and 61% higher than that in the sham group 12 weeks after MI. b The concentration of ATP in the HF + US + MB + plasmid group was 19% less than that in the HF + US + MB + plasmid group and 13% higher than that in the HF + NS group. * p < 0.05 vs. all other groups.
0.06 0.05 0.04 0.03 0.02 0.01 0
2.00
*
1.00 0
b
centration of triglycerides in the myocardium of the HF + US + MB + plasmid group was 100% higher than that in the sham + NS group (p < 0.05), but was not significantly different compared to the HF + NS group (p < 0.05; fig. 4). Phosphates in the Myocardium In the US-mediated MB-carrying MCD-miRNA interferenced plasmid group, ATP concentration increased, indicating a heightened energy reserve in the post-MI myocardium. The concentration of ATP in the HF + US + MB + plasmid group was less than that in the sham + NS group (p < 0.05), but was higher than that in the HF + NS group (p < 0.05). The ADP concentration in the HF + US + MB + plasmid group was less than that in the sham + NS group (p < 0.05), but higher than in the HF + NS group (p < 0.05; fig. 5). Cardiology 2014;127:236–244 DOI: 10.1159/000356471
241
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
0.300
60 50 40 30 20 10 0
ADP (mmol/mg)
0.400
Ceramide (mmol/gprot)
Lactic acid (mmol/gprot)
0.500
HF + US + MB + plasmid HF + US + MB + N-plasmid Myocardial triglycerides (mmol/gprot)
Sham + NS HF + NS
Color version available online
Sham + NS
HF + plasmid
HF + US + MB + plasmid
Histological Evaluation Following MI, the saline-treated group showed swollen cardiomyocytes, fractured cardiac fibers and interstitial fibrosis compared to the sham rats (fig. 5). In the sham + NS group, cardiomyocytes were normally arranged, while myocyte disarray and hypertrophy was evident in the MI groups. The expression of GLUT4 was not statistically different between the groups (fig. 6).
Discussion
It has previously been demonstrated that plasmids introduced by US-mediated MB injection show increased efficacy compared with plasmids injected directly into the myocardium without MB [13]. The goal of the current 242
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
HF + US + plasmid
HF + US + MB + N-plasmid
study was to determine whether MB injection could improve cardiac function in a rat HF model. Cardiac function was significantly deteriorated by 12 weeks after MI. Four weeks after treatment, the decrease in MCD increased MCA levels and improved cardiac function by preventing enlargement of the cardiac chambers. Our results suggest that inhibition of MCD could be a potential treatment for congestive HF. Traditional small interfering RNA (siRNA) might influence cellular metabolism, especially if it interacts with endogenous miRNAs. Further, siRNA at very high levels could induce cell damage [14]. The exogenous administration of miRNA, a second-generation siRNA interference technique, shows similar production levels as endogenous miRNA and may avoid dosage issues seen with siRNA [15]. In addition, targeting a gene with miRNA is a more accurate approach [16]. Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
Fig. 6. Cardiac fiber arrangements. In the sham + NS group, cardiomyocytes were arranged in sequence as normal. In contrast, there was cardiac fiber fracture or hypertrophy in the other intervention groups. There was no statistically significant difference in GLUT-4 expression among the groups.
HF + NS
We found that MCD gene expression could be significantly inhibited by miRNA interference with US-mediated MB injection into the target region, and this approach increased the MCD concentration significantly. Four weeks after treatment, however, both LVEF and LVFS were further decreased compared to the pretreatment MI levels, indicating that acute MCD inhibition had no effect on ventricular remodeling. In contrast, inhibition of MCD reduced lactic acid concentrations in the myocardium 28 days after MI. This may be due to increased aerobic oxidation of glucose and reduced glycolysis by preventing long-chain MCA into mitochondria and reducing oxidation of fatty acids to remove the inhibition of pyruvate dehydrogenase. The buildup of lactic acid in the cell can cause toxicity. The decrease in pH can alter the binding of Ca2+ to stimulate systolic dysfunction. Furthermore, the decrease in pH can stimulate Na+/H+ exchange to induce extracellular Ca2+ overload and cell death. Improvement of acidosis by lactic acid reduction could be one of the mechanisms improving systolic function [17]. Another possible mechanism is increased glucose oxidation due to decreased fatty acid oxidation from glucose and fat metabolism. Ischemia and anoxia are common in the failing myocardium. Although the oxidation of fatty acids produces more oxygen than that of glucose, apparent increases in ATP may reduce oxygen consumption and increase mitochondrial efficiency. Thus, energy derived from fatty acids is more beneficial than energy from glucose, even regarding potentially increased side effects. The presence of ceramide in the myocardium is subject to controversy due to its potential lipotoxicity [18, 19]. Although ceramide has been detected in post-MI myocardium, its effect on cardiac systolic function and ventricular remodeling remains to be elucidated [20, 21]. Ceramide levels increase with HF deterioration; however, controversy exists regarding in vitro and in vivo results [22]. Ceramides have not been shown to directly cause cardiac dysfunction in previous research [11, 23, 24]. In this study, cardiac dysfunction was not present at the 8-week post-MI time point. Ceramide levels, however, continually increased up to 12 weeks after MI, indicating that ceramides may play an indirect role in the development of HF. Previous studies have revealed that an elevated ceramide level can inhibit the insulin signal channel, which results in decreased insulin sensitivity [25, 26]. Therefore, the elevated ceramide level may be secondary to obstructed glucose uptake by cardiomyocytes, which would lead
to a deterioration in cardiac function. However, there was no significant change in GLUT-4 staining, even after MCD inhibition and ceramide level decreases. This result suggests that the improvement in cardiac function may not depend on the increase in insulin-independent GLUT-4 after MCD inhibition. A goal in treating HF is to increase the efficiency of myocardial metabolism to adapt to the demands for energy on exertion. Inhibition of CPT-1 directly improved cardiac function in previous animal experiments and clinical trials [27], but also demonstrated toxic effects on the liver [28]. MCA, an endogenous inhibitor of CPT-1, can inhibit CPT-1 derived from the myocardium more effectively than CPT-1 derived from the liver [29]. Thus, this strategy will likely limit the potential for liver toxicity.
Effect of MCD Inhibition after MI
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
Conclusion
The current study demonstrated that MCD inhibition may provide a promising novel treatment strategy for HF. The mechanism of action of MCD inhibition is to increase MCA levels, thereby indirectly inhibiting CPT-1 and increasing energy phosphate levels.
Acknowledgments The study was support by the National Natural Science Foundation of China (grant No. 30670870) and the Chongqing Municipal Science and Technology Commission of the Natural Science Foundation of China (cstc2012jjA10085).
Conflicts of Interest The authors declare there are no conflicts of interest.
1 Ashrafian H, Frenneaux MP, Opie LH: Metabolic mechanisms in heart failure. Circulation 2007;116:434–448. 2 Ingwall JS: Energy metabolism in heart failure and remodelling. Cardiovasc Res 2009; 81: 412–419. 3 Palaniyandi SS, Qi X, Yogalingam G, Ferreira JC, Mochly-Rosen D: Regulation of mitochondrial processes: a target for heart failure. Drug Discov Today Dis Mech 2010; 7:e95– e102. 4 Kuzmicic J, Del Campo A, Lopez-Crisosto C, et al: Mitochondrial dynamics: a potential new therapeutic target for heart failure. Rev Esp Cardiol 2011;64:916–923.
243
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
References
244
15 Chang K, Elledge SJ, Hannon GJ: Lessons from Nature: microRNA-based shRNA libraries. Nat Methods 2006;3:707–714. 16 Ely A, Naidoo T, Mufamadi S, Crowther C, Arbuthnot P: Expressed anti-HBV primary microRNA shuttles inhibit viral replication efficiently in vitro and in vivo. Mol Ther 2008; 16:1105–1112. 17 Liu Q, Docherty JC, Rendell JC, Clanachan AS, Lopaschuk GD: High levels of fatty acids delay the recovery of intracellular pH and cardiac efficiency in post-ischemic hearts by inhibiting glucose oxidation. J Am Coll Cardiol 2002;39:718–725. 18 Park TS, Yamashita H, Blaner WS, Goldberg IJ: Lipids in the heart: a source of fuel and a source of toxins. Curr Opin Lipidol 2007; 18: 277–282. 19 Stanley WC, Recchia FA: Lipotoxicity and the development of heart failure: moving from mouse to man. Cell Metab 2010;12:555. 20 Wende AR, Abel ED: Lipotoxicity in the heart. Biochim Biophys Acta 2010;1801:311– 319. 21 Morgan EE, Rennison JH, Young ME, et al: Effects of chronic activation of peroxisome proliferator-activated receptor-alpha or highfat feeding in a rat infarct model of heart failure. Am J Physiol Heart Circ Physiol 2006; 290:H1899–H1904. 22 Sharma S, Adrogue JV, Golfman L, et al: Intramyocardial lipid accumulation in the failing human heart resembles the lipotoxic rat heart. FASEB J 2004;18:1692–1700.
Cardiology 2014;127:236–244 DOI: 10.1159/000356471
23 Rennison JH, McElfresh TA, Okere IC, et al: High-fat diet postinfarction enhances mitochondrial function and does not exacerbate left ventricular dysfunction. Am J Physiol Heart Circ Physiol 2007;292:H1498–H1506. 24 Morgan EE, Rennison JH, Young ME, et al: Effects of chronic activation of peroxisome proliferator-activated receptor-alpha or highfat feeding in a rat infarct model of heart failure. Am J Physiol Heart Circ Physiol 2006; 290:H1899–H1904. 25 Chess DJ, Stanley WC: Role of diet and fuel overabundance in the development and progression of heart failure. Cardiovasc Res 2008; 79:269–278. 26 Zhang L, Ussher JR, Oka T, Cadete VJ, Wagg C, Lopaschuk GD: Cardiac diacylglycerol accumulation in high fat-fed mice is associated with impaired insulin-stimulated glucose oxidation. Cardiovasc Res 2011;89:148–156. 27 Lionetti V, Linke A, Chandler MP, et al: Carnitine palmitoyl transferase-I inhibition prevents ventricular remodeling and delays decompensation in pacing-induced heart failure. Cardiovasc Res 2005;66:454–461. 28 Holubarsch CJ, Rohrbach M, Karrasch M, et al: A double-blind randomized multicentre clinical trial to evaluate the efficacy and safety of two doses of etomoxir in comparison with placebo in patients with moderate congestive heart failure: the ERGO (etomoxir for the recovery of glucose oxidation) study. Clin Sci (Lond) 2007;113:205–212. 29 Schreurs M, Kuipers F, van der Leij FR: Regulatory enzymes of mitochondrial beta-oxidation as targets for treatment of the metabolic syndrome. Obes Rev 2010;11:380–388.
Wu/Zhu/Cai/Tong/Liu/Huang/Yang/ Jiang
Downloaded by: Ondokuz Mayis Universitesi 193.140.28.22 - 4/27/2014 8:31:24 PM
5 van Bilsen M, van Nieuwenhoven FA, van der Vusse GJ: Metabolic remodelling of the failing heart: beneficial or detrimental. Cardiovasc Res 2009;81:420–428. 6 Folmes CD, Lopaschuk GD: Role of malonylCoA in heart disease and the hypothalamic control of obesity. Cardiovasc Res 2007; 73: 278–287. 7 Ussher JR, Lopaschuk GD: The malonyl CoA axis as a potential target for treating ischaemic heart disease. Cardiovasc Res 2008;79:259–268. 8 Hernot S, Klibanov AL: Microbubbles in ultrasound-triggered drug and gene delivery. Adv Drug Deliv Rev 2008;60:1153–1166. 9 Tsien RY: The green fluorescent protein. Annu Rev Biochem 1998;67:509–544. 10 Baily RG, Lehman JC, Gubin SS, Musch TI: Non-invasive assessment of ventricular damage in rats with myocardial infarction. Cardiovasc Res 1993;27:851–855. 11 Rennison JH, McElfresh TA, Okere IC, et al: Enhanced acyl-CoA dehydrogenase activity is associated with improved mitochondrial and contractile function in heart failure. Cardiovasc Res 2008;79:331–340. 12 Demoz A, Garras A, Asiedu DK, Netteland B, Berge RK: Rapid method for the separation and detection of tissue short-chain coenzyme A esters by reversed-phase high-performance liquid chromatography. J Chromatogr B Biomed Appl 1995;667:148–152. 13 Mayer CR, Bekeredjian R: Ultrasonic gene and drug delivery to the cardiovascular system. Adv Drug Deliv Rev 2008;60:1177–1192. 14 Boudreau RL, Martins I, Davidson BL: Artificial microRNAs as siRNA shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther 2009;17:169–175.
