journal of dentistry 43 (2015) 110–116
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.intl.elsevierhealth.com/journals/jden
Effect of autogenous and fresh-frozen bone grafts on osteoblast differentiation E.P. Ferraz, S.P. Xavier, F.G. Azevedo, F.S. de Oliveira, M.M. Beloti, A.L. Rosa * Cell Culture Laboratory, School of Dentistry of Ribeira˜o Preto, University of Sa˜o Paulo, Av. do Cafe´ s/n, 14040-904 Ribeira˜o Preto, Sa˜o Paulo, Brazil
article info
abstract
Article history:
Objective: Fresh-frozen bone allograft (FFBA) is an alternative to autogenous bone (AB) for
Received 9 July 2014
reconstructing maxillary bone. Despite the promising clinical results, cell responses to FFBA
Received in revised form
and AB were not evaluated. Thus, our aim was to compare cells harvested from maxillary
14 October 2014
reconstructed sites with either AB or FFBA in terms of osteoblast differentiation and to
Accepted 24 October 2014
evaluate the effect of culturing cells in contact with FFBA. Methods: Cells harvested from three patients submitted to bilateral maxillary reconstruction with AB and FFBA were cultured to evaluate: proliferation, alkaline phosphatase
Keywords:
activity, extracellular matrix mineralization and gene expression of osteoblastic markers.
Bone
The effect of FFBA on osteoblast differentiation was studied by culturing cells harvested
Cell culture
from AB in contact with FFBA and evaluating the same parameters. Data were compared
Differentiation
using either two-way ANOVA followed by Tukey-b test or Student’s t test ( p 0.05).
Graft
Results: Cell proliferation was higher in cultures from AB grafted sites and extracellular
Osteoblast
matrix mineralization was higher in cultures derived from FFBA grafted sites. The gene expression of alkaline phosphatase, RUNX2, bone sialoprotein and osteocalcin was higher in cells derived from FFBA compared with cells from AB grafted sites. However, the exposure of cells derived from AB to FFBA particles did not have any remarkable effect on osteoblast differentiation. Conclusions: These results indicate the higher osteogenic activity of cells derived from FFBA compared with AB reconstructed sites, offering an explanation at cellular level of why FFBA could be a suitable alternative to AB for reconstructing maxillary bone defects. # 2014 Elsevier Ltd. All rights reserved.
1.
Introduction
Oral rehabilitation using dental implants is a well-established therapy with a high long-term success rate, which relies on the quality and amount of bone tissue. Insufficient bone volume * Corresponding author. Tel.: +55 16 3315 4106; fax: +55 16 3315 4788. E-mail address: [email protected] (A.L. Rosa). http://dx.doi.org/10.1016/j.jdent.2014.10.010 0300-5712/# 2014 Elsevier Ltd. All rights reserved.
represents a challenging clinical situation in the implantology field in terms of functional and aesthetic parameters.1 The need of maxillary reconstructions to retrieve the bone volume prior to the implant placement can be achieved by several procedures including the use of grafts such as autogenous bone (AB), allogenous bone and alloplastic materials.2–5 The
journal of dentistry 43 (2015) 110–116
histocompatibility, osteoinductive and osteoconductive properties make AB the gold standard graft; however, the amount of bone, donor site morbidity and unpredictable graft resorption are limitations of using this bone source.6–9 Biomaterials such as the anorganic bovine bone, which exhibits very similar physicochemical properties of the human bone, induce a delay in bone formation and exert negative effects on osteoblast differentiation.10–12 In this context, different grafts have been tested and fresh frozen bone allograft (FFBA) may represent an alternative to reconstruct bone defects. The FFBA is aseptically harvested from different skeletal sites of live or cadaveric donors, immediately frozen and stored at 80 8C.13 The rigorous protocol for bone processing, which eliminates living cells and consequently the risk of transmission of diseases, and the reduced immunological reaction to the graft have increased the clinical and scientific interest in the FFBA.13–16 The FFBA acts as a scaffold allowing the ingrowth of cellular and vascular components, and ultimately promoting the bone tissue regeneration.17 Some studies have shown that the use of dental implants in maxillary defects reconstructed with FFBA is a reliable technique that may be safely used as an alternative to AB graft.18–20 Despite the promising clinical and histological findings, up to now, there are no studies investigating the FFBA behaviour at the cellular level. Thus, the aim of this paper was to compare cells harvested from maxillary reconstructed sites with either AB graft or FFBA in terms of osteoblast differentiation. Additionally, to eliminate the influence of in vivo micro-environment and to evaluate the effect of FFBA itself on cells, we cultured osteoblasts harvested from AB in direct contact with FFBA.
2.
111
expanded in a-minimum essential medium (Invitrogen), supplemented with 10% foetal bovine serum (Invitrogen), 50 mg/mL gentamicin (Invitrogen), 0.3 mg/mL fungizone (Invitrogen), 107 M dexamethasone (Sigma–Aldrich, St Louis, MO, USA), 5 mg/mL ascorbic acid (Invitrogen), and 7 mM bglycerophosphate (Sigma–Aldrich). First passage cells were cultured in 24-well culture plates (Falcon, Franklin Lakes, NJ, USA) at a cell density of 2 104 cells/well for periods of up to 21 days. The cultures were incubated at 37 8C in a humidified atmosphere of 5% CO2 and 95% air and the medium was changed every 3 days.
Materials and methods
2.1. Osteoblast differentiation of cells derived from maxillary reconstructed sites with either AB graft or FFBA 2.1.1.
Patient selection
The Committee of Ethics in Research of the School of Dentistry approved the procedures and all patients signed the informed consent. Three healthy female patients, totally edentulous, with an average age of 55.5-year-old (ranging from 52 to 62year-old), were selected as subjects for a clinical trial to compare AB graft with FFBA and submitted to bilateral maxillary verticosagittal reconstruction surgery. The left and right sides were randomly reconstructed with either AB graft derived from mandibular ramus or FFBA harvested from femoral heads (Musculoskeletal Tissue Bank of Marilia Hospital – Unioss, Marilia, SP, Brazil). After 6 months, punch biopsies were obtained from each reconstructed site immediately before the dental implant (Neodent, Sa˜o Paulo, SP, Brazil) placement. The bone fragments from the two reconstructed sites, AB and FFBA, of the three patients were processed as described below.
2.1.2.
Isolation and cell culture
The osteoblastic cells were isolated from bone fragments of the AB and FFBA reconstructed sites by enzymatic digestion using collagenase type II (Invitrogen, Carlsbad, CA, USA) and
Fig. 1 – Proliferation (A), alkaline phosphatase (ALP) activity (B), and extracellular matrix mineralization (C) of cells derived from autogenous bone (AB) graft and fresh-frozen bone allograft (FFBA) reconstructed sites. The cell proliferation was higher (p = 0.001) in cultures from AB compared with FFBA grafted sites at days 7 and 10. The ALP activity was statistically the same (p = 0.818) in cultures from AB and FFBA grafted sites at all evaluated time points. At day 21, the calcium content in extracellular mineralized matrix was higher (p = 0.001) in cultures derived from FFBA grafted sites compared with ABderived ones. Data are presented as mean W standard deviation (n = 5). Asterisks indicate statistically significant differences (p = 0.05).
112
2.1.3.
journal of dentistry 43 (2015) 110–116
Cell proliferation
The culture growth was evaluated at days 3, 7 and 10 by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT, Sigma–Aldrich) assay. Cells were incubated with 100 mL of MTT (5 mg/mL) in PBS at 37 8C. After 4 h, 1 mL of acidified isopropanol (0.04 N HCl in isopropanol) was added to each well. The plates were then agitated for 5 min, and 150 mL of this solution was transferred to a 96-well format plates (Fisher Scientific, Pittsburgh, PA, USA). Wells without cells were assayed and used as baseline zero and the optical density was read at 570 nm on the plate reader (mQuant, Biotek, Winooski, VT, USA), and data were expressed as absorbance.
(Sigma–Aldrich), pH 4.2, for 10 min and the calcium content was detected using a colorimetric method.22 Briefly, 280 mL of 10% acetic acid were added to each well and the plate was incubated at room temperature for 30 min. This solution was heated to 85 8C for 10 min, and transferred to ice for 5 min. The slurry was centrifuged at 13,000 rpm for 15 min and 100 mL of the supernatant was mixed with 40 mL of 10% ammonium hydroxide. Wells without cells were assayed and used as baseline zero and the absorbance was measured at 405 nm in the plate reader mQuant (Biotek) and the data were expressed as absorbance.
2.1.6. 2.1.4.
Alkaline phosphatase (ALP) activity
At days 7, 10 and 14 the release of thymolphthalein from thymolphthalein monophosphate was determined to measure the ALP activity using a commercial kit (Labtest Diagnostica SA, Belo Horizonte, MG, Brazil). Cell lysates were obtained by incubating cultures with 0.1% sodium lauryl sulphate (Sigma) for 30 min. A solution of 50 mL of thymolphthalein monophosphate and 0.5 mL of 0.3 M diethanolamine buffer, pH 10.1, was kept for 2 min at 37 8C and 50 mL of the cell lysates from each well were added. After 10 min at 37 8C, 2 mL of a solution of Na2CO3 (0.09 mmol/mL) and NaOH (0.25 mmol/mL) were used to stop the reaction. Wells without cells were assayed and used as baseline zero and the absorbance was measured at 590 nm using the plate reader mQuant (Biotek) and ALP activity was expressed as mmol thymolphthalein normalized by the total protein content, determined by the Lowry method,21 at the respective timepoint.
2.1.5.
Extracellular matrix mineralization
At day 21, cells were fixed in 10% formalin for 2 h at room temperature, dehydrated and stained with 2% Alizarin Red S
Gene expression of key osteoblast markers
Quantitative real-time polymerase chain reaction (PCR) was carried out at 7 and 14 days to evaluate the gene expression of ALP, runt-related transcription factor 2 (RUNX2), bone sialoprotein (BSP) and osteocalcin (OC). The total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using 1 mg of the RNA through a reverse transcription reaction (M–MLV reverse transcriptase, Promega Corporation, Madison, WI, USA). Real-time PCR was carried out in a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories) using SybrGreen PCR Master-Mix (Applied Biosystems, Warrington, UK), 2.5 ng of cDNA and the following specific primers: ALP – 50 GGACATGCAGTACGAGCTGA30 30 GCAGTGAAGGGCTTCTTGTC50 ; RUNX2 – 50 CACAAACAACC ACAGAACCAC30 30 TTGCTGTCCTCCTGGAGAAA50 ; BSP – 50 AA TCTGTGCCACTCACTGCCTT30 30 CCTCTATTTTGACTCTTCGA TGCAA50 ; OC – 50 CAAAGGTGCAGCCTTTGTGTC30 30 TCACA GTCCGGATTGAGCTCA50 ; and b-actin – 50 ATGTTTGAGACC TTCAACA30 30 CACGTCAGACTTCATGATGG50 . The relative gene expression was normalized by b-actin and the real changes were relative to gene expression of cells derived from AB grafted sites at 7 days using the cycle threshold method.23
Fig. 2 – Gene expression of the osteoblast markers alkaline phosphatase (ALP, A), runt-related transcription factor 2 (RUNX2, B), bone sialoprotein (BSP, C) and osteocalcin (OC, D) of cells derived from autogenous bone (AB) graft and fresh-frozen bone allograft (FFBA) reconstructed sites. The expression of ALP, RUNX2, BSP and OC was higher (p = 0.001) in cells derived from FFBA compared with cells derived from AB grafted sites at both time points. Data are presented as mean W standard deviation (n = 4). Asterisks indicate statistically significant differences (p = 0.05).
journal of dentistry 43 (2015) 110–116
113
2.2. Effect of culturing cells harvested from AB in contact with FFBA particles on osteoblast differentiation
3.2. Effect of culturing cells harvested from AB in contact with FFBA particles on osteoblast differentiation
Fragments of maxillary AB discarded in orthognathic surgery from one 56-year-old male patient were mixed with the same volume of FFBA particles (AB + FFBA). These fragments were submitted to enzymatic digestion, the cells were expanded in presence of the residual bone particles until subconfluence. After that, bone particles were discarded and first passage cells were subcultured in 24-well culture plates for up to 21 days to evaluate the same parameters as described above. Non-mixed fragments of AB and FFBA were used as control groups.
As expected, fragments of FFBA alone did not generate cell cultures and were not considered for statistical analysis. Cells from AB and AB + FFBA exhibited the same pattern of growth with the number of cells increasing from day 3 to 10 (Fig. 3A). However, cell proliferation rate was higher (p = 0.001) in cultures from AB compared with AB + FFBA at all evaluated time points (Fig. 3A). The ALP activity was not different between cells from AB and AB + FFBA at all evaluated time points (p = 0.394). It was observed that ALP activity increased (p = 0.001) from day 7 to day 10 and decreased (p = 0.001) at day 14 in both cultures (Fig. 3B). The calcium content in the
2.3.
Statistical analysis
To avoid the influence of variability common to primary cultures, the comparisons between cells from FFBA and AB reconstructed sites were donor-matched. The results presented here are representative of the three sets of experiments conducted with cells from three different patients, excepting the experiments to evaluate the effect of culturing cells with FFBA on osteoblast differentiation, which was carried out with cells from one patient. Parameters evaluated in more than one time-point were compared using two-way ANOVA (group vs. time), followed by Tukey-b test, when appropriate while those evaluated in one timepoint were compared using Student’s t test. For all comparisons, differences at p 0.05 were considered statistically significant.
3.
Results
3.1. Osteoblast differentiation of cells derived from maxillary reconstructed sites with either AB graft or FFBA Cells derived from AB graft and FFBA reconstructed sites exhibited the same pattern of growth, which was determined by MTT assay at 3, 7 and 10 days (Fig. 1A). Irrespective of cell source, the number of cells increased (p = 0.001) from day 3 and peaked at day 7. Furthermore, cell proliferation rate was higher (p = 0.001) in cultures from AB compared with FFBA grafted sites at days 7 and 10 (Fig. 1A). The ALP activity increased (p = 0.001) from day 7 to day 14 in cells from FFBA grafted sites, while in cells from AB grafted sites ALP activity increased (p = 0.001) from day 7 to day 10 and reached the plateau from day 10 (Fig. 1B). In addition, it was not observed differences (p = 0.818) in terms of ALP activity between cells from AB and FFBA grafted sites at all evaluated time points (Fig. 1B). At day 21, the calcium content in the extracellular mineralized matrix was higher (p = 0.001) in cultures derived from FFBA grafted sites compared with AB-derived ones (Fig. 1C). The gene expression of ALP, RUNX2, BSP and OC was higher (p = 0.010 for all of them) at day 14 compared with day 7 (Fig. 2A–D). The expression of all these genes was higher (p = 0.001 for all of them) in cells derived from FFBA compared with cells derived from AB grafted sites at both time points (Fig. 2A–D).
Fig. 3 – Proliferation (A), alkaline phosphatase (ALP) activity (B), and extracellular matrix mineralization (C) of cells derived from autogenous bone cultured either in absence (AB) or in presence of fresh-frozen bone allograft particles (AB + FFBA). Cell proliferation was higher (p = 0.001) in AB compared with AB + FFBA cultures at all evaluated time points. The ALP activity presented the same pattern irrespective of FFBA exposure (p = 0.394) and it was higher at day 10 (p = 0.001). At day 17, the exposure to FFBA did not affect (p = 0.724) calcium content in the extracellular mineralized matrix. Data are presented as mean W standard deviation (n = 5). Asterisks indicate statistically significant differences (p = 0.05).
114
journal of dentistry 43 (2015) 110–116
extracellular mineralized matrix was not statistically different (p = 0.724) between AB and AB + FFBA cultures (Fig. 3C). Furthermore, the presence of FFBA did not affect the gene expression of RUNX2 (p = 0.878) and BSP ( p = 0.152), but reduced ALP (p = 0.009) and increased OC (p = 0.001) gene expression at 7 days (Fig. 4A–D).
4.
Discussion
The results of our study showed that cells derived from FFBA reconstructed sites exhibited a higher osteogenic potential than cells derived from AB reconstructed sites as evidenced by enhanced extracellular matrix mineralization and higher gene expression of key osteoblast markers. In addition, we noticed that the in vitro exposure of cells from AB to FFBA particles did not exert relevant effect on the osteoblast differentiation progression. To promote bone regeneration, grafts need to allow cell migration, adhesion and proliferation. Here, we observed less cells in cultures from FFBA compared with AB reconstructed sites during the proliferative and matrix maturation phases, despite both cultures displayed the same growth pattern. Agreeing with this, it has been shown the reduced proliferative activity of cells from sites grafted with anorganic bovine bone compared with cells from AB.11 Although ALP activity plays a key role in the mineralization process, the higher extracellular matrix mineralization observed in cultures from FFBA reconstructed sites could not be explained by higher ALP activity, since no differences in this enzyme activity were noticed between cultures from FFBA and AB grafted sites. This suggests that events other than ALP activity may be involved in the mineralization process.24 Corroborating the higher osteogenic potential of cells derived from FFBA reconstructed sites, gene expression of ALP, RUNX2, BSP and OC was upregulated in these cultures compared with cultures from AB reconstructed sites. Taken together, our results of cell growth and osteoblast differentiation are supported by the reciprocal
relationship between the decrease in cell proliferation and induction of differentiation.25,26 It has been reported a less pronounced osteogenic potential of cells derived from reconstructed sites with anorganic bovine bone compared with cells from non-grafted sites.11,12 Such apparently discrepant results may be related to differences in graft material, cell source and extracellular matrix characteristics. Indeed, it is known that the skeletal origin and/or anatomical site, features of the graft material and extracellular matrix composition have direct effects on osteoblast proliferation and differentiation.27–32 However, participation of each of these factors and the possible interactions among them to induce the distinct osteogenic potential of cells derived from FFBA compared with AB reconstructed sites observed here remain to be determined. Cells derived from AB grown in presence of FFBA particles in an in vitro controlled microenvironment did not exhibited remarkable distinct kinetics of differentiation compared with cells derived from AB, which were not exposed to FFBA. Despite the proliferation of cells in contact with FFBA particles was lower compared with AB-cells, the ALP activity of both cultures was similar. Furthermore, exposition to FFBA downregulated ALP, upregulated OC and did not affect RUNX2 and BSP gene expression. Together, our results pointed out the higher osteogenic activity of cells derived from FFBA compared with that ones derived from AB reconstructed sites and no significant effect of FFBA particles on in vitro osteoblast differentiation. Despite the higher osteogenic activity in FFBA reconstructed sites, no significant differences regarding osseointegration parameters between the implants placed at AB and FFBA grafted sites were noticed.33 In conclusion, we have shown the striking role of FFBA on osteogenic activity in reconstructed sites. To our knowledge, this is the first study presenting cellular aspects that may explain the in vivo differences between FFBA and AB grafted sites in terms of bone remodelling dynamics. Our findings support the use of FFBA as an alternative to AB for reconstructing maxillary bone defects prior to implant
Fig. 4 – Gene expression of the osteoblast markers alkaline phosphatase (ALP, A), runt-related transcription factor 2 (RUNX2, B), bone sialoprotein (BSP, C) and osteocalcin (OC, D) of cells derived from autogenous bone cultured either in absence (AB) or in presence of fresh-frozen bone allograft particles (AB + FFBA) at 7 days. The presence of FFBA reduced ALP (p = 0.009), increased OC (p = 0.001) and did not affect RUNX2 (p = 0.878), and BSP ( p = 0.152) gene expression. Data are presented as mean W standard deviation (n = 4). Asterisks indicate statistically significant differences (p = 0.05).
journal of dentistry 43 (2015) 110–116
placement; however, further long-term clinical trials should be considered to confirm the longevity of this therapy.
13.
Conflict of interest The authors declare that they have no conflict of interest. 14.
Acknowledgments This research was supported by grants from FAPESP and CNPq. We would like to thank Roger Fernandes and Milla Tavares for their assistance during the cell culture experiments.
15.
16.
references 17. 1. Chiapasco M, Zaniboni M. Failures in jaw reconstructive surgery with autogenous onlay bone grafts for pre-implant purposes: incidence, prevention and management of complications. Oral and Maxillofacial Surgery Clinics of North America 2011;23:1–15. 2. Dahlin C, Johansson A. Iliac crest autogenous bone graft versus alloplastic graft and guided bone regeneration in the reconstruction of atrophic maxillae: a 5-year retrospective study on cost-effectiveness and clinical outcome. Clinical Implant Dentistry and Related Research 2011;13:305–10. 3. Miron RJ, Hedbom E, Saulacic N, Zhang Y, Sculean A, Bosshardt DD, et al. Osteogenic potential of autogenous bone grafts harvested with four different surgical techniques. Journal of Dental Research 2011;90:1428–33. 4. Misch CM. Maxillary autogenous bone grafting. Oral and Maxillofacial Surgery Clinics of North America 2011;23:229–38. 5. Miyamoto I, Yamashita Y, Yamamoto N, Nogami S, Yamauchi K, Yoshiga D, et al. Evaluation of mandibular reconstruction with particulate cancellous bone marrow and titanium mesh after mandibular resection due to tumor surgery. Implant Dentistry 2014;23:108–15. 6. Burchardt H. The biology of bone graft repair. Clinical Orthopaedics and Related Research 1983;174:28–42. 7. Johansson B, Grepe A, Wannfors K, Hirsch JM. A clinical study of changes in the volume of bone grafts in the atrophic maxilla. Dento-Maxillo-Facial Radiology 2001;30: 157–61. 8. Rogers GF, Greene AK. Autogenous bone graft: basic science and clinical implications. Journal of Craniofacial Surgery 2012;23:323–7. 9. Jensen T, Schou S, Stavropoulos A, Terheyden H, Holmstrup P. Maxillary sinus floor augmentation with Bio-Oss or BioOss mixed with autogenous bone as graft in animals: a systematic review. International Journal of Oral and Maxillofacial Surgery 2012;41:114–20. 10. Botticelli D, Berglundh T, Lindhe J. The influence of a biomaterial on the closure of a marginal hard tissue defect adjacent to implants. An experimental study in the dog. Clinical Oral Implants Research 2004;15:285–92. 11. Beloti MM, Martins Jr W, Xavier SP, Rosa AL. In vitro osteogenesis induced by cells derived from sites submitted to sinus grafting with anorganic bovine bone. Clinical Oral Implants Research 2008;19:48–54. 12. de Melo WM, de Oliveira FS, Marcantonio Jr E, Beloti MM, de Oliveira PT, Rosa AL. Autogenous bone combined with anorganic bovine bone for maxillary sinus augmentation: analysis of the osteogenic potential of cells derived from the
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
115
donor and the grafted sites. Clinical Oral Implants Research 2014;25:603–9. Buffoli B, Boninsegna R, Rezzani R, Poli PP, Santoro F, Rodella LF. Histomorphometrical evaluation of fresh frozen bone allografts for alveolar bone reconstruction: preliminary cases comparing femoral head with iliac crest grafts. Clinical Implant Dentistry and Related Research 2013;15:791–8. Marx RE, Carlson ER. Tissue banking safety: caveats and precautions for the oral and maxillofacial surgeon. Journal of Oral and Maxillofacial Surgery 1993;51:1372–9. Albert A, Leemruse T, Druez V, Delloye C, Cornu O. Are bone autografts still necessary in 2006? A three-year retrospective study of bone grafting. Acta Orthopaedica Belgica 2006;7: 724–40. Olender E, Uhrynowska-Tyszkiewicz I, Kaminski A. Revitalization of biostatic tissue allografts: new perspectives in tissue transplantology. Transplantation Proceedings 2011;43:3137–41. Roden RD. Principles of bone grafting. Oral and Maxillofacial Surgery Clinics of North America 2010;22:295–300. Contar CM, Sarot JR, Bordini Jr J, Galva˜o GH, Nicolau GV, Machado MA. Maxillary ridge augmentation with freshfrozen bone allografts. Journal of Oral and Maxillofacial Surgery 2009;67:1280–5. Novell J, Novell-Costa F, Ivorra C, Farin˜as O, Munilla A, Martinez C. Five-year results of implants inserted into freeze-dried block allografts. Implant Dentistry 2012;21: 129–35. Ferraz EP, Rosa AL, de Oliveira PT, Santos TS, Pontes CD, Reino DM, et al. Clinical, histological and cellular evaluation of vertico-lateral maxillary reconstruction associating alveolar osteogenic distraction and fresh frozen bone allograft. Journal of Oral Implantology 2013. http://dx.doi.org/ 10.1563/AAID-JOI-D-13-00102. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. Journal of Biological Chemistry 1951;193:265–75. Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Analytical Biochemistry 2004;329:77–84. Livak KL, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(t)) method. Methods 2001;25:402–8. de Oliva MA, Maximiano WM, de Castro LM, da Silva Jr PE, Fernandes RR, Ciancaglini P, et al. Treatment with a growth factor-protein mixture inhibits formation of mineralized nodules in osteogenic cell cultures grown on titanium. Journal of Histochemistry and Cytochemistry 2009;57:265–76. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, et al. Progressive development of the rat osteoblast phenotype in vitro: reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. Journal of Cellular Physiology 1990;143:357–70. Rosa AL, Crippa GE, de Oliveira PT, Taba Jr M, Lefebvre LP, Beloti MM. Human alveolar bone cell proliferation, expression of osteoblastic phenotype, and matrix mineralization on porous titanium produced by powder metallurgy. Clinical Oral Implants Research 2009;20:472–81. Kasperk C, Wergedal J, Strong D, Farley J, Wangerin K, Gropp H, et al. Human bone cell phenotypes differ depending on their skeletal site of origin. Journal of Clinical Endocrinology and Metabolism 1995;80:2511–7. Defino HL, da Silva Herrero CF, Crippa GE, Bellesini LS, Beloti MM, Rosa AL. In vitro proliferation and osteoblastic
116
journal of dentistry 43 (2015) 110–116
phenotype expression of cells derived from human vertebral lamina and iliac crest. Spine 2009;34:1549–53. 29. Coquelin L, Fialaire-Legendre A, Roux S, Poignard A, Bierling P, Hernigou P, et al. In vivo and in vitro comparison of three different allografts vitalized with human mesenchymal stromal cells. Tissue Engineering Part A 2012;18:1921–31. 30. Ferraz EP, Xavier SP, de Oliveira PT, Beloti MM, Rosa AL. Mandibular symphysis and ramus as sources of osteoblastic cells for bone tissue engineering. Oral Diseases 2014;20:e31–5. 31. Ayobian-Markazi N, Fourootan T, Kharazifar MJ. Comparison of cell viability and morphology of a human osteoblast-like cell line (SaOS-2) seeded on various bone
substitute materials: an in vitro study. Journal of Dental Research 2012;9:86–92. 32. Prasadam I, Farnaghi S, Feng JQ, Gu W, Perry S, Crawford R, et al. Impact of extracellular matrix derived from osteoarthritis subchondral bone osteoblasts on osteocytes: role of integrinb1 and focal adhesion kinase signaling cues. Arthritis Research and Therapy 2013;15:R150. 33. Spin-Neto R, Stavropoulos A, Coletti FL, Faeda RS, Pereira LA, Marcantonio J E. Graft incorporation and implant osseointegration following the use of autologous and freshfrozen allogeneic block bone grafts for lateral ridge augmentation. Clinical Oral Implants Research 2014;25:226–33.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.intl.elsevierhealth.com/journals/jden
Effect of autogenous and fresh-frozen bone grafts on osteoblast differentiation E.P. Ferraz, S.P. Xavier, F.G. Azevedo, F.S. de Oliveira, M.M. Beloti, A.L. Rosa * Cell Culture Laboratory, School of Dentistry of Ribeira˜o Preto, University of Sa˜o Paulo, Av. do Cafe´ s/n, 14040-904 Ribeira˜o Preto, Sa˜o Paulo, Brazil
article info
abstract
Article history:
Objective: Fresh-frozen bone allograft (FFBA) is an alternative to autogenous bone (AB) for
Received 9 July 2014
reconstructing maxillary bone. Despite the promising clinical results, cell responses to FFBA
Received in revised form
and AB were not evaluated. Thus, our aim was to compare cells harvested from maxillary
14 October 2014
reconstructed sites with either AB or FFBA in terms of osteoblast differentiation and to
Accepted 24 October 2014
evaluate the effect of culturing cells in contact with FFBA. Methods: Cells harvested from three patients submitted to bilateral maxillary reconstruction with AB and FFBA were cultured to evaluate: proliferation, alkaline phosphatase
Keywords:
activity, extracellular matrix mineralization and gene expression of osteoblastic markers.
Bone
The effect of FFBA on osteoblast differentiation was studied by culturing cells harvested
Cell culture
from AB in contact with FFBA and evaluating the same parameters. Data were compared
Differentiation
using either two-way ANOVA followed by Tukey-b test or Student’s t test ( p 0.05).
Graft
Results: Cell proliferation was higher in cultures from AB grafted sites and extracellular
Osteoblast
matrix mineralization was higher in cultures derived from FFBA grafted sites. The gene expression of alkaline phosphatase, RUNX2, bone sialoprotein and osteocalcin was higher in cells derived from FFBA compared with cells from AB grafted sites. However, the exposure of cells derived from AB to FFBA particles did not have any remarkable effect on osteoblast differentiation. Conclusions: These results indicate the higher osteogenic activity of cells derived from FFBA compared with AB reconstructed sites, offering an explanation at cellular level of why FFBA could be a suitable alternative to AB for reconstructing maxillary bone defects. # 2014 Elsevier Ltd. All rights reserved.
1.
Introduction
Oral rehabilitation using dental implants is a well-established therapy with a high long-term success rate, which relies on the quality and amount of bone tissue. Insufficient bone volume * Corresponding author. Tel.: +55 16 3315 4106; fax: +55 16 3315 4788. E-mail address: [email protected] (A.L. Rosa). http://dx.doi.org/10.1016/j.jdent.2014.10.010 0300-5712/# 2014 Elsevier Ltd. All rights reserved.
represents a challenging clinical situation in the implantology field in terms of functional and aesthetic parameters.1 The need of maxillary reconstructions to retrieve the bone volume prior to the implant placement can be achieved by several procedures including the use of grafts such as autogenous bone (AB), allogenous bone and alloplastic materials.2–5 The
journal of dentistry 43 (2015) 110–116
histocompatibility, osteoinductive and osteoconductive properties make AB the gold standard graft; however, the amount of bone, donor site morbidity and unpredictable graft resorption are limitations of using this bone source.6–9 Biomaterials such as the anorganic bovine bone, which exhibits very similar physicochemical properties of the human bone, induce a delay in bone formation and exert negative effects on osteoblast differentiation.10–12 In this context, different grafts have been tested and fresh frozen bone allograft (FFBA) may represent an alternative to reconstruct bone defects. The FFBA is aseptically harvested from different skeletal sites of live or cadaveric donors, immediately frozen and stored at 80 8C.13 The rigorous protocol for bone processing, which eliminates living cells and consequently the risk of transmission of diseases, and the reduced immunological reaction to the graft have increased the clinical and scientific interest in the FFBA.13–16 The FFBA acts as a scaffold allowing the ingrowth of cellular and vascular components, and ultimately promoting the bone tissue regeneration.17 Some studies have shown that the use of dental implants in maxillary defects reconstructed with FFBA is a reliable technique that may be safely used as an alternative to AB graft.18–20 Despite the promising clinical and histological findings, up to now, there are no studies investigating the FFBA behaviour at the cellular level. Thus, the aim of this paper was to compare cells harvested from maxillary reconstructed sites with either AB graft or FFBA in terms of osteoblast differentiation. Additionally, to eliminate the influence of in vivo micro-environment and to evaluate the effect of FFBA itself on cells, we cultured osteoblasts harvested from AB in direct contact with FFBA.
2.
111
expanded in a-minimum essential medium (Invitrogen), supplemented with 10% foetal bovine serum (Invitrogen), 50 mg/mL gentamicin (Invitrogen), 0.3 mg/mL fungizone (Invitrogen), 107 M dexamethasone (Sigma–Aldrich, St Louis, MO, USA), 5 mg/mL ascorbic acid (Invitrogen), and 7 mM bglycerophosphate (Sigma–Aldrich). First passage cells were cultured in 24-well culture plates (Falcon, Franklin Lakes, NJ, USA) at a cell density of 2 104 cells/well for periods of up to 21 days. The cultures were incubated at 37 8C in a humidified atmosphere of 5% CO2 and 95% air and the medium was changed every 3 days.
Materials and methods
2.1. Osteoblast differentiation of cells derived from maxillary reconstructed sites with either AB graft or FFBA 2.1.1.
Patient selection
The Committee of Ethics in Research of the School of Dentistry approved the procedures and all patients signed the informed consent. Three healthy female patients, totally edentulous, with an average age of 55.5-year-old (ranging from 52 to 62year-old), were selected as subjects for a clinical trial to compare AB graft with FFBA and submitted to bilateral maxillary verticosagittal reconstruction surgery. The left and right sides were randomly reconstructed with either AB graft derived from mandibular ramus or FFBA harvested from femoral heads (Musculoskeletal Tissue Bank of Marilia Hospital – Unioss, Marilia, SP, Brazil). After 6 months, punch biopsies were obtained from each reconstructed site immediately before the dental implant (Neodent, Sa˜o Paulo, SP, Brazil) placement. The bone fragments from the two reconstructed sites, AB and FFBA, of the three patients were processed as described below.
2.1.2.
Isolation and cell culture
The osteoblastic cells were isolated from bone fragments of the AB and FFBA reconstructed sites by enzymatic digestion using collagenase type II (Invitrogen, Carlsbad, CA, USA) and
Fig. 1 – Proliferation (A), alkaline phosphatase (ALP) activity (B), and extracellular matrix mineralization (C) of cells derived from autogenous bone (AB) graft and fresh-frozen bone allograft (FFBA) reconstructed sites. The cell proliferation was higher (p = 0.001) in cultures from AB compared with FFBA grafted sites at days 7 and 10. The ALP activity was statistically the same (p = 0.818) in cultures from AB and FFBA grafted sites at all evaluated time points. At day 21, the calcium content in extracellular mineralized matrix was higher (p = 0.001) in cultures derived from FFBA grafted sites compared with ABderived ones. Data are presented as mean W standard deviation (n = 5). Asterisks indicate statistically significant differences (p = 0.05).
112
2.1.3.
journal of dentistry 43 (2015) 110–116
Cell proliferation
The culture growth was evaluated at days 3, 7 and 10 by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT, Sigma–Aldrich) assay. Cells were incubated with 100 mL of MTT (5 mg/mL) in PBS at 37 8C. After 4 h, 1 mL of acidified isopropanol (0.04 N HCl in isopropanol) was added to each well. The plates were then agitated for 5 min, and 150 mL of this solution was transferred to a 96-well format plates (Fisher Scientific, Pittsburgh, PA, USA). Wells without cells were assayed and used as baseline zero and the optical density was read at 570 nm on the plate reader (mQuant, Biotek, Winooski, VT, USA), and data were expressed as absorbance.
(Sigma–Aldrich), pH 4.2, for 10 min and the calcium content was detected using a colorimetric method.22 Briefly, 280 mL of 10% acetic acid were added to each well and the plate was incubated at room temperature for 30 min. This solution was heated to 85 8C for 10 min, and transferred to ice for 5 min. The slurry was centrifuged at 13,000 rpm for 15 min and 100 mL of the supernatant was mixed with 40 mL of 10% ammonium hydroxide. Wells without cells were assayed and used as baseline zero and the absorbance was measured at 405 nm in the plate reader mQuant (Biotek) and the data were expressed as absorbance.
2.1.6. 2.1.4.
Alkaline phosphatase (ALP) activity
At days 7, 10 and 14 the release of thymolphthalein from thymolphthalein monophosphate was determined to measure the ALP activity using a commercial kit (Labtest Diagnostica SA, Belo Horizonte, MG, Brazil). Cell lysates were obtained by incubating cultures with 0.1% sodium lauryl sulphate (Sigma) for 30 min. A solution of 50 mL of thymolphthalein monophosphate and 0.5 mL of 0.3 M diethanolamine buffer, pH 10.1, was kept for 2 min at 37 8C and 50 mL of the cell lysates from each well were added. After 10 min at 37 8C, 2 mL of a solution of Na2CO3 (0.09 mmol/mL) and NaOH (0.25 mmol/mL) were used to stop the reaction. Wells without cells were assayed and used as baseline zero and the absorbance was measured at 590 nm using the plate reader mQuant (Biotek) and ALP activity was expressed as mmol thymolphthalein normalized by the total protein content, determined by the Lowry method,21 at the respective timepoint.
2.1.5.
Extracellular matrix mineralization
At day 21, cells were fixed in 10% formalin for 2 h at room temperature, dehydrated and stained with 2% Alizarin Red S
Gene expression of key osteoblast markers
Quantitative real-time polymerase chain reaction (PCR) was carried out at 7 and 14 days to evaluate the gene expression of ALP, runt-related transcription factor 2 (RUNX2), bone sialoprotein (BSP) and osteocalcin (OC). The total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using 1 mg of the RNA through a reverse transcription reaction (M–MLV reverse transcriptase, Promega Corporation, Madison, WI, USA). Real-time PCR was carried out in a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories) using SybrGreen PCR Master-Mix (Applied Biosystems, Warrington, UK), 2.5 ng of cDNA and the following specific primers: ALP – 50 GGACATGCAGTACGAGCTGA30 30 GCAGTGAAGGGCTTCTTGTC50 ; RUNX2 – 50 CACAAACAACC ACAGAACCAC30 30 TTGCTGTCCTCCTGGAGAAA50 ; BSP – 50 AA TCTGTGCCACTCACTGCCTT30 30 CCTCTATTTTGACTCTTCGA TGCAA50 ; OC – 50 CAAAGGTGCAGCCTTTGTGTC30 30 TCACA GTCCGGATTGAGCTCA50 ; and b-actin – 50 ATGTTTGAGACC TTCAACA30 30 CACGTCAGACTTCATGATGG50 . The relative gene expression was normalized by b-actin and the real changes were relative to gene expression of cells derived from AB grafted sites at 7 days using the cycle threshold method.23
Fig. 2 – Gene expression of the osteoblast markers alkaline phosphatase (ALP, A), runt-related transcription factor 2 (RUNX2, B), bone sialoprotein (BSP, C) and osteocalcin (OC, D) of cells derived from autogenous bone (AB) graft and fresh-frozen bone allograft (FFBA) reconstructed sites. The expression of ALP, RUNX2, BSP and OC was higher (p = 0.001) in cells derived from FFBA compared with cells derived from AB grafted sites at both time points. Data are presented as mean W standard deviation (n = 4). Asterisks indicate statistically significant differences (p = 0.05).
journal of dentistry 43 (2015) 110–116
113
2.2. Effect of culturing cells harvested from AB in contact with FFBA particles on osteoblast differentiation
3.2. Effect of culturing cells harvested from AB in contact with FFBA particles on osteoblast differentiation
Fragments of maxillary AB discarded in orthognathic surgery from one 56-year-old male patient were mixed with the same volume of FFBA particles (AB + FFBA). These fragments were submitted to enzymatic digestion, the cells were expanded in presence of the residual bone particles until subconfluence. After that, bone particles were discarded and first passage cells were subcultured in 24-well culture plates for up to 21 days to evaluate the same parameters as described above. Non-mixed fragments of AB and FFBA were used as control groups.
As expected, fragments of FFBA alone did not generate cell cultures and were not considered for statistical analysis. Cells from AB and AB + FFBA exhibited the same pattern of growth with the number of cells increasing from day 3 to 10 (Fig. 3A). However, cell proliferation rate was higher (p = 0.001) in cultures from AB compared with AB + FFBA at all evaluated time points (Fig. 3A). The ALP activity was not different between cells from AB and AB + FFBA at all evaluated time points (p = 0.394). It was observed that ALP activity increased (p = 0.001) from day 7 to day 10 and decreased (p = 0.001) at day 14 in both cultures (Fig. 3B). The calcium content in the
2.3.
Statistical analysis
To avoid the influence of variability common to primary cultures, the comparisons between cells from FFBA and AB reconstructed sites were donor-matched. The results presented here are representative of the three sets of experiments conducted with cells from three different patients, excepting the experiments to evaluate the effect of culturing cells with FFBA on osteoblast differentiation, which was carried out with cells from one patient. Parameters evaluated in more than one time-point were compared using two-way ANOVA (group vs. time), followed by Tukey-b test, when appropriate while those evaluated in one timepoint were compared using Student’s t test. For all comparisons, differences at p 0.05 were considered statistically significant.
3.
Results
3.1. Osteoblast differentiation of cells derived from maxillary reconstructed sites with either AB graft or FFBA Cells derived from AB graft and FFBA reconstructed sites exhibited the same pattern of growth, which was determined by MTT assay at 3, 7 and 10 days (Fig. 1A). Irrespective of cell source, the number of cells increased (p = 0.001) from day 3 and peaked at day 7. Furthermore, cell proliferation rate was higher (p = 0.001) in cultures from AB compared with FFBA grafted sites at days 7 and 10 (Fig. 1A). The ALP activity increased (p = 0.001) from day 7 to day 14 in cells from FFBA grafted sites, while in cells from AB grafted sites ALP activity increased (p = 0.001) from day 7 to day 10 and reached the plateau from day 10 (Fig. 1B). In addition, it was not observed differences (p = 0.818) in terms of ALP activity between cells from AB and FFBA grafted sites at all evaluated time points (Fig. 1B). At day 21, the calcium content in the extracellular mineralized matrix was higher (p = 0.001) in cultures derived from FFBA grafted sites compared with AB-derived ones (Fig. 1C). The gene expression of ALP, RUNX2, BSP and OC was higher (p = 0.010 for all of them) at day 14 compared with day 7 (Fig. 2A–D). The expression of all these genes was higher (p = 0.001 for all of them) in cells derived from FFBA compared with cells derived from AB grafted sites at both time points (Fig. 2A–D).
Fig. 3 – Proliferation (A), alkaline phosphatase (ALP) activity (B), and extracellular matrix mineralization (C) of cells derived from autogenous bone cultured either in absence (AB) or in presence of fresh-frozen bone allograft particles (AB + FFBA). Cell proliferation was higher (p = 0.001) in AB compared with AB + FFBA cultures at all evaluated time points. The ALP activity presented the same pattern irrespective of FFBA exposure (p = 0.394) and it was higher at day 10 (p = 0.001). At day 17, the exposure to FFBA did not affect (p = 0.724) calcium content in the extracellular mineralized matrix. Data are presented as mean W standard deviation (n = 5). Asterisks indicate statistically significant differences (p = 0.05).
114
journal of dentistry 43 (2015) 110–116
extracellular mineralized matrix was not statistically different (p = 0.724) between AB and AB + FFBA cultures (Fig. 3C). Furthermore, the presence of FFBA did not affect the gene expression of RUNX2 (p = 0.878) and BSP ( p = 0.152), but reduced ALP (p = 0.009) and increased OC (p = 0.001) gene expression at 7 days (Fig. 4A–D).
4.
Discussion
The results of our study showed that cells derived from FFBA reconstructed sites exhibited a higher osteogenic potential than cells derived from AB reconstructed sites as evidenced by enhanced extracellular matrix mineralization and higher gene expression of key osteoblast markers. In addition, we noticed that the in vitro exposure of cells from AB to FFBA particles did not exert relevant effect on the osteoblast differentiation progression. To promote bone regeneration, grafts need to allow cell migration, adhesion and proliferation. Here, we observed less cells in cultures from FFBA compared with AB reconstructed sites during the proliferative and matrix maturation phases, despite both cultures displayed the same growth pattern. Agreeing with this, it has been shown the reduced proliferative activity of cells from sites grafted with anorganic bovine bone compared with cells from AB.11 Although ALP activity plays a key role in the mineralization process, the higher extracellular matrix mineralization observed in cultures from FFBA reconstructed sites could not be explained by higher ALP activity, since no differences in this enzyme activity were noticed between cultures from FFBA and AB grafted sites. This suggests that events other than ALP activity may be involved in the mineralization process.24 Corroborating the higher osteogenic potential of cells derived from FFBA reconstructed sites, gene expression of ALP, RUNX2, BSP and OC was upregulated in these cultures compared with cultures from AB reconstructed sites. Taken together, our results of cell growth and osteoblast differentiation are supported by the reciprocal
relationship between the decrease in cell proliferation and induction of differentiation.25,26 It has been reported a less pronounced osteogenic potential of cells derived from reconstructed sites with anorganic bovine bone compared with cells from non-grafted sites.11,12 Such apparently discrepant results may be related to differences in graft material, cell source and extracellular matrix characteristics. Indeed, it is known that the skeletal origin and/or anatomical site, features of the graft material and extracellular matrix composition have direct effects on osteoblast proliferation and differentiation.27–32 However, participation of each of these factors and the possible interactions among them to induce the distinct osteogenic potential of cells derived from FFBA compared with AB reconstructed sites observed here remain to be determined. Cells derived from AB grown in presence of FFBA particles in an in vitro controlled microenvironment did not exhibited remarkable distinct kinetics of differentiation compared with cells derived from AB, which were not exposed to FFBA. Despite the proliferation of cells in contact with FFBA particles was lower compared with AB-cells, the ALP activity of both cultures was similar. Furthermore, exposition to FFBA downregulated ALP, upregulated OC and did not affect RUNX2 and BSP gene expression. Together, our results pointed out the higher osteogenic activity of cells derived from FFBA compared with that ones derived from AB reconstructed sites and no significant effect of FFBA particles on in vitro osteoblast differentiation. Despite the higher osteogenic activity in FFBA reconstructed sites, no significant differences regarding osseointegration parameters between the implants placed at AB and FFBA grafted sites were noticed.33 In conclusion, we have shown the striking role of FFBA on osteogenic activity in reconstructed sites. To our knowledge, this is the first study presenting cellular aspects that may explain the in vivo differences between FFBA and AB grafted sites in terms of bone remodelling dynamics. Our findings support the use of FFBA as an alternative to AB for reconstructing maxillary bone defects prior to implant
Fig. 4 – Gene expression of the osteoblast markers alkaline phosphatase (ALP, A), runt-related transcription factor 2 (RUNX2, B), bone sialoprotein (BSP, C) and osteocalcin (OC, D) of cells derived from autogenous bone cultured either in absence (AB) or in presence of fresh-frozen bone allograft particles (AB + FFBA) at 7 days. The presence of FFBA reduced ALP (p = 0.009), increased OC (p = 0.001) and did not affect RUNX2 (p = 0.878), and BSP ( p = 0.152) gene expression. Data are presented as mean W standard deviation (n = 4). Asterisks indicate statistically significant differences (p = 0.05).
journal of dentistry 43 (2015) 110–116
placement; however, further long-term clinical trials should be considered to confirm the longevity of this therapy.
13.
Conflict of interest The authors declare that they have no conflict of interest. 14.
Acknowledgments This research was supported by grants from FAPESP and CNPq. We would like to thank Roger Fernandes and Milla Tavares for their assistance during the cell culture experiments.
15.
16.
references 17. 1. Chiapasco M, Zaniboni M. Failures in jaw reconstructive surgery with autogenous onlay bone grafts for pre-implant purposes: incidence, prevention and management of complications. Oral and Maxillofacial Surgery Clinics of North America 2011;23:1–15. 2. Dahlin C, Johansson A. Iliac crest autogenous bone graft versus alloplastic graft and guided bone regeneration in the reconstruction of atrophic maxillae: a 5-year retrospective study on cost-effectiveness and clinical outcome. Clinical Implant Dentistry and Related Research 2011;13:305–10. 3. Miron RJ, Hedbom E, Saulacic N, Zhang Y, Sculean A, Bosshardt DD, et al. Osteogenic potential of autogenous bone grafts harvested with four different surgical techniques. Journal of Dental Research 2011;90:1428–33. 4. Misch CM. Maxillary autogenous bone grafting. Oral and Maxillofacial Surgery Clinics of North America 2011;23:229–38. 5. Miyamoto I, Yamashita Y, Yamamoto N, Nogami S, Yamauchi K, Yoshiga D, et al. Evaluation of mandibular reconstruction with particulate cancellous bone marrow and titanium mesh after mandibular resection due to tumor surgery. Implant Dentistry 2014;23:108–15. 6. Burchardt H. The biology of bone graft repair. Clinical Orthopaedics and Related Research 1983;174:28–42. 7. Johansson B, Grepe A, Wannfors K, Hirsch JM. A clinical study of changes in the volume of bone grafts in the atrophic maxilla. Dento-Maxillo-Facial Radiology 2001;30: 157–61. 8. Rogers GF, Greene AK. Autogenous bone graft: basic science and clinical implications. Journal of Craniofacial Surgery 2012;23:323–7. 9. Jensen T, Schou S, Stavropoulos A, Terheyden H, Holmstrup P. Maxillary sinus floor augmentation with Bio-Oss or BioOss mixed with autogenous bone as graft in animals: a systematic review. International Journal of Oral and Maxillofacial Surgery 2012;41:114–20. 10. Botticelli D, Berglundh T, Lindhe J. The influence of a biomaterial on the closure of a marginal hard tissue defect adjacent to implants. An experimental study in the dog. Clinical Oral Implants Research 2004;15:285–92. 11. Beloti MM, Martins Jr W, Xavier SP, Rosa AL. In vitro osteogenesis induced by cells derived from sites submitted to sinus grafting with anorganic bovine bone. Clinical Oral Implants Research 2008;19:48–54. 12. de Melo WM, de Oliveira FS, Marcantonio Jr E, Beloti MM, de Oliveira PT, Rosa AL. Autogenous bone combined with anorganic bovine bone for maxillary sinus augmentation: analysis of the osteogenic potential of cells derived from the
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
115
donor and the grafted sites. Clinical Oral Implants Research 2014;25:603–9. Buffoli B, Boninsegna R, Rezzani R, Poli PP, Santoro F, Rodella LF. Histomorphometrical evaluation of fresh frozen bone allografts for alveolar bone reconstruction: preliminary cases comparing femoral head with iliac crest grafts. Clinical Implant Dentistry and Related Research 2013;15:791–8. Marx RE, Carlson ER. Tissue banking safety: caveats and precautions for the oral and maxillofacial surgeon. Journal of Oral and Maxillofacial Surgery 1993;51:1372–9. Albert A, Leemruse T, Druez V, Delloye C, Cornu O. Are bone autografts still necessary in 2006? A three-year retrospective study of bone grafting. Acta Orthopaedica Belgica 2006;7: 724–40. Olender E, Uhrynowska-Tyszkiewicz I, Kaminski A. Revitalization of biostatic tissue allografts: new perspectives in tissue transplantology. Transplantation Proceedings 2011;43:3137–41. Roden RD. Principles of bone grafting. Oral and Maxillofacial Surgery Clinics of North America 2010;22:295–300. Contar CM, Sarot JR, Bordini Jr J, Galva˜o GH, Nicolau GV, Machado MA. Maxillary ridge augmentation with freshfrozen bone allografts. Journal of Oral and Maxillofacial Surgery 2009;67:1280–5. Novell J, Novell-Costa F, Ivorra C, Farin˜as O, Munilla A, Martinez C. Five-year results of implants inserted into freeze-dried block allografts. Implant Dentistry 2012;21: 129–35. Ferraz EP, Rosa AL, de Oliveira PT, Santos TS, Pontes CD, Reino DM, et al. Clinical, histological and cellular evaluation of vertico-lateral maxillary reconstruction associating alveolar osteogenic distraction and fresh frozen bone allograft. Journal of Oral Implantology 2013. http://dx.doi.org/ 10.1563/AAID-JOI-D-13-00102. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. Journal of Biological Chemistry 1951;193:265–75. Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Analytical Biochemistry 2004;329:77–84. Livak KL, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(t)) method. Methods 2001;25:402–8. de Oliva MA, Maximiano WM, de Castro LM, da Silva Jr PE, Fernandes RR, Ciancaglini P, et al. Treatment with a growth factor-protein mixture inhibits formation of mineralized nodules in osteogenic cell cultures grown on titanium. Journal of Histochemistry and Cytochemistry 2009;57:265–76. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, et al. Progressive development of the rat osteoblast phenotype in vitro: reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. Journal of Cellular Physiology 1990;143:357–70. Rosa AL, Crippa GE, de Oliveira PT, Taba Jr M, Lefebvre LP, Beloti MM. Human alveolar bone cell proliferation, expression of osteoblastic phenotype, and matrix mineralization on porous titanium produced by powder metallurgy. Clinical Oral Implants Research 2009;20:472–81. Kasperk C, Wergedal J, Strong D, Farley J, Wangerin K, Gropp H, et al. Human bone cell phenotypes differ depending on their skeletal site of origin. Journal of Clinical Endocrinology and Metabolism 1995;80:2511–7. Defino HL, da Silva Herrero CF, Crippa GE, Bellesini LS, Beloti MM, Rosa AL. In vitro proliferation and osteoblastic
116
journal of dentistry 43 (2015) 110–116
phenotype expression of cells derived from human vertebral lamina and iliac crest. Spine 2009;34:1549–53. 29. Coquelin L, Fialaire-Legendre A, Roux S, Poignard A, Bierling P, Hernigou P, et al. In vivo and in vitro comparison of three different allografts vitalized with human mesenchymal stromal cells. Tissue Engineering Part A 2012;18:1921–31. 30. Ferraz EP, Xavier SP, de Oliveira PT, Beloti MM, Rosa AL. Mandibular symphysis and ramus as sources of osteoblastic cells for bone tissue engineering. Oral Diseases 2014;20:e31–5. 31. Ayobian-Markazi N, Fourootan T, Kharazifar MJ. Comparison of cell viability and morphology of a human osteoblast-like cell line (SaOS-2) seeded on various bone
substitute materials: an in vitro study. Journal of Dental Research 2012;9:86–92. 32. Prasadam I, Farnaghi S, Feng JQ, Gu W, Perry S, Crawford R, et al. Impact of extracellular matrix derived from osteoarthritis subchondral bone osteoblasts on osteocytes: role of integrinb1 and focal adhesion kinase signaling cues. Arthritis Research and Therapy 2013;15:R150. 33. Spin-Neto R, Stavropoulos A, Coletti FL, Faeda RS, Pereira LA, Marcantonio J E. Graft incorporation and implant osseointegration following the use of autologous and freshfrozen allogeneic block bone grafts for lateral ridge augmentation. Clinical Oral Implants Research 2014;25:226–33.
