Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

Contents lists available at ScienceDirect

Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid

Development of a new PCR-based assay to detect Anaplasmataceae and the first report of Anaplasma phagocytophilum and Anaplasma platys in cattle from Algeria Mustapha Dahmani a , Bernard Davoust a , Mohamed Seghir Benterki b , Florence Fenollar a,c , Didier Raoult a,c , Oleg Mediannikov a,c,∗ a Research Unit of Emerging Infectious and Tropical Diseases (URMITE), UMR CNRS 7278 IRD 198 INSERM 1095, Aix-Marseille Université, Faculté de Médecine, 27 Bd Jean Moulin, 13385 Marseille Cedex 05, France b Clinique vétérinaire Le Refuge, Batna, Algeria c Research Unit of Emerging Infectious and Tropical Diseases (URMITE), UMR CNRS 7278 IRD 198 INSERM 1095, Institut de Recherche pour le Développement, Centre IRD Hann, BP 1386, Dakar, Senegal

a r t i c l e

i n f o

Article history: Received 11 December 2014 Received in revised form 6 February 2015 Accepted 16 February 2015 Keywords: Anaplasma phagocytophilum Anaplasma platys Anaplasmataceae PCR assay 23S rRNA gene Cattle Algeria

a b s t r a c t Bovine anaplasmosis is a hemoparasitic disease considered as a major constraint to cattle production in many countries. This pathology is at least partially caused by Anaplasma phagocytophilum, Anaplasma marginale, Anaplasma centrale, and Anaplasma bovis. The global threat and emergence of these species in animals require the reliable identification of these bacteria in animal samples. In this study, we developed a new qPCR tool targeting the 23S rRNA gene for the detection of Anaplasmataceae bacteria. The primers and probe for the qPCR reaction had 100% specificity and could identify at least A. phagocytophilum, A. marginale, A. centrale, Anaplasma ovis, Anaplasma platys, Ehrlichia canis, Ehrlichia ruminantium, Neorickettisa sennetsu, and Neorickettsia risticii. We used this tool to test samples of bovines from Batna (Algeria), an area from which bovine anaplasmosis have never been reported. We identified three genetic variants of A. phagocytophilum, A. platys and Anaplasma sp. “variant 4”. This finding should attract the attention of public authorities to assess the involvement of these pathogens in human and animal health. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Bovine anaplasmosis (ehrlichiosis) is a hemoparasitic disease considered a major constraint to cattle production in many countries [1]. This infection can be caused by Anaplasma phagocytophilum, Anaplasma marginale,

∗ Corresponding author at: Research Unit of Emerging Infectious and Tropical Diseases (URMITE), UMR CNRS 7278 IRD 198 INSERM 1095, Institut de Recherche pour le Développement, Centre IRD Hann, BP 1386 Dakar, Senegal. Tel.: +221 338493580. E-mail address: [email protected] (O. Mediannikov). http://dx.doi.org/10.1016/j.cimid.2015.02.002 0147-9571/© 2015 Elsevier Ltd. All rights reserved.

Anaplasma centrale, or Anaplasma bovis [2]. A. phagocytophilum is the agent of human granulocytic ehrlichiosis [3]. This infection is reported worldwide and is considered the most widespread tick borne infection in animals in Europe [4], essentially in ruminants [5]. A. marginale is distributed worldwide and causes considerable economic loss in the dairy industry [6]. A. centrale is occasionally associated with clinical diseases and is used as a live vaccine in Israel, Australia, Africa, and South America [7]. These two bacteria infect erythrocytes and cluster together and apart from the granulocytic A. phagocytophilum, supporting the interpretation that they are within distinct genera [3]. Information about A. bovis is still limited compared

40

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

with other Anaplasmataceae with no type strain available. A. bovis was detected in Africa and Asia [8–10] causing bovine ehrlichiosis, and it is considered phylogenetically more closely related to A. phagocytophilum than to A. marginale or A. centrale. Morulae are found in the monocytes of infected cattle [2]. Anaplasma platys has been considered a pathogen that mostly infects dogs, but recently, a strain of Anaplasma sp. closely related to A. platys was detected in ruminants from Sicily; however, the author did not report any symptoms associated with this infection [11]. In Algeria, there is a lack of information about the Anaplasmataceae infection in ruminants. Furthermore, the species implicated in the pathology of bovine anaplasmosis in this country has not been reported. Consequently, in order to screen these bacteria we have developed new qPCR tool based on the 23S ribosomal RNA gene that have broad sensitivity (Anaplasmataceae family-specific) and can amplify bacteria belonging to the Anaplasma, Ehrlichia, Neorickettsia and Wolbachia genera. The following identification of the bacterial species was based on sequencing of the amplicons of a portion of 23S- and 16S rRNA genes. We have applied this new diagnostic tool to blood samples of bovines from Algeria that exhibited the characteristic symptoms of bovine anaplasmosis in order to identify and genetically characterize the Anaplasmataceae responsible for this infection. 2. Materials and methods 2.1. Design of the new system of diagnosis 2.1.1. Anaplasmataceae family-specific probe and primers design In order to develop a qPCR-based tool for the screening of the samples for the presence of already known and potentially unknown obligatory intracellular bacteria from the Anaplasmataceae family, several genes were primarily tested to develop the Anaplasmataceae family-specific set of primers. Among those tested, the rpoB and groEL genes were considered too diverse, with few common patterns within the different species of Anaplasmataceae (data not shown). 16S rRNA (rrs) was determined to be not sufficiently diverse for discriminating among closely related species, such as Anaplasma ovis, A. marginale, and A. centrale [12]. The gene encoding the 23S subunit of ribosomal RNA (rrl) was selected for its large size and the presence of, on the one hand, highly conserved regions that enabled developing the family-specific oligonucleotide and, on the other hand, sufficient discrimination between closely related species of Anaplasmataceae. The sequences of A. phagocytophilum (CP006616 and CP006618), A. centrale (CP001759), A. marginale (NR076579, CP000030 and CP006847), Ehrlichia chaffeensis (AF416765), Ehrlichia canis (NR076375), Ehrlichia ruminantium (NR077000), Ehrlichia muris (CP006917), and Ochrobactrum anthropi (NR076113) were aligned using the BioEdit softwar [13]. A conserved region specific for Anaplasmataceae bacteria was chosen to design a set of primers and probe for the real time PCR assay and three primers for the conventional PCR assay. Primers sequences for the qPCR assay were designed to generate a 169 bp

Table 1 Primers and probes used in this study. Primers and probe 23S rRNA gene TtAna-f TtAna-r TtAna-s Ana23S-212f Ana23S-908r Ana23S-753r 16S rRNA gene Ehr-16S-D Ehr-16S-R

Sequences 5 –3 TGACAGCGTACCTTTTGCAT TGGAGGACCGAACCTGTTAC FAM-GGATTAGACCCGAAACCAAG-TAMRA ATAAGCTGCGGGGAATTGTC GTAACAGGTTCGGTCCTCCA TGCAAAAGGTACGCTGTCAC GGTACCYACAGAAGAAGTCC TAGCACTCATCGTTTACAGC

fragment with the Taqman® probe. The primers of the two conventional PCR assays shared the same forward primers and generated a fragment of approximately 700 bp and 500 bp, respectively (Table 1). The overall objective was to design a tool capable to identify most bacteria belonging to the family of Anaplasmataceae and potentially, a new species. The approach was to use the 23S-based qPCR for the screening of the samples and to identify the species based on the separately amplified larger portions of 23S and 16S rRNA-coding genes.

2.1.2. Specificity and reproducibility of the new tools of diagnosis The specificity of the Taqman® assay and the conventional PCR assay was tested using DNA extracted from the following organisms: A. phagocytophilum, A. marginale, A. centrale, A. ovis [12], A. platys (kindly supplied by Pr. L. Chabanne (VetAgro Sup Lyon, France) obtained from the blood of a dog from the Gard department, France), E. canis, E. ruminantium, Neorickettsia sennetsu, Neorickettsia risticii, Rickettsia conorii, Rickettsia felis, Rickettsia typhi, Rickettsia massiliae, Rickettsia raoultii, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Enterococcus faecalis, Enterococcus faecium, Enterobacter cloacae, Enterobacter aerogenes, Streptococcus agalactiae, Streptococcus oralis, Citrobacter koseri, Haemophilus influenza, Serratia marcescens, Klebsiella oxytoca, Gardnerella vaginalis, Stenotrophomonas maltophilia and human DNA. A serial dilution was prepared for each sample of DNA for testing the sensibility of the Taqman® assay. At the first stage, all samples were tested by the 23S-based qPCR tool. Then those that were found positive (Anaplasma spp., Ehrlichia spp. and Neorickettsia spp.) were subjected to the two conventional PCRs. All amplified samples were sequenced to ensure there was no non-specific amplification and contamination. In all experiments, distilled water was included as negative control, and processed as described below. The purpose of this approach was to assess that 23S-based qPCR and conventional PCRs were able to amplify all available species of Anaplasmataceae family and not other bacteria. The sequences of the 23S rRNA gene of A. ovis and A. platys were not available in the GenBank database. Subsequently, the sequences obtained from the positive controls were deposited in GenBank (GenBank access numbers for 23S rRNA genes: A. ovis: KM021411, A. platys: KM021412).

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

2.2. Sample collection In early 2013, a veterinarian practicing in the province of Batna (latitude: 35◦ 33.3582 North; longitude: 6◦ 10.4484 East; altitude: 1035 m), situated at 350 km southeast of Alger, the capital of Algeria, reported several breeds of dairy bovines exhibiting hyperthermia, decreased milk production, cough, and (in some animals) distal edema. A blood smear was prepared from the infected bovines and displayed intraleukocyte morulae under a light microscope (not shown). Convicted that this symptomatology signified bovine anaplasmosis, he collected 36 EDTA blood samples from bovine breeding. These samples were used for molecular investigation. 2.3. DNA extraction and molecular investigation DNA was extracted from 200 ␮L of blood or culture, performed on the BIOROBOT EZ1 (Qiagen, Courtaboeuf, France) using a commercial DNA extraction kit (QIAamp DNA Mini Kit® ) according to the manufacturer’s instructions. The real-time PCR reaction was performed using Quantitec DNA polymerase (Qiagen, Courtaboeuf, France), and the conventional PCR reaction was performed using hot star DNA polymerase (Qiagen, Courtaboeuf, France). 2.3.1. Strategy for PCR amplification and sequencing To investigate the presence of Anaplasmataceae in the blood sample from Batna bovines, the DNA was initially tested with the real time assay. Next, the positive samples were amplified by the conventional PCR primers Ana23S-212f-Ana23S-908r that amplify a 649-bp fragment of the 23S rRNA. All samples were re-tested by two primers, EHR16SR and EHR16D (as described previously [14]), which amplify a 345-bp fragment of the 16S rRNA gene (Table 1), in order to confirm the data obtained by the newly developed 23S-based PCR. The real-time PCR assay was performed with the CFX96 Touch detection system (Bio-Rad, Marnes-laCoquette, France) under cycling conditions including an initial activation of the Taq DNA polymerase at 95 ◦ C for 15 min, followed by 40 cycles of a 10 second (s) denaturation at 95 ◦ C, followed by a one-minute (min) annealing–extension step at 60 ◦ C. The conventional PCR assay amplification reactions were performed with a DNA thermal cycler under the following conditions: an initial denaturation step at 95 ◦ C for 15 min, followed by 40 cycles consisting of 1 min denaturation at 94 ◦ C, 1 min annealing at 60 ◦ C, and a 1 min extension at 72 ◦ C. A final extension cycle at 72 ◦ C for 5 min was performed, and the reactions were cooled at 15 ◦ C. For primers targeting the 16S rRNA gene, the amplification conditions were as described above, except that the hybridization step was performed at 54 ◦ C for 30 s. Distilled water was used as the negative control, and a positive control that consisted of DNA of A. phagocytophilum provided by our laboratory was included in each reaction. An aliquot of each amplified product was resolved on a 1.5% agarose gel stained with ethidium bromide at 130 V for 25 min. The bands were visualized using the

41

BenchTop pGEM® DNA Marker (Promega, Madison, Wisconsin, USA) under ultraviolet illumination. 2.3.2. Sequencing analyses and phylogenetic analyses Sequencing analyses were performed on the Biosystems 3130xl Genetic Analyzer (Qiagen) using different sets of oligonucleotides and the DNA sequencing BigDye Terminator kit (Perkin-Elmer) as described by the manufacturer. The obtained sequences were assembled on ChromasPro 1.7 (Technelysium Pty Ltd., Tewantin, Australia). The gene sequences of the bacteria identified in this study and other reference strains available in GenBank were aligned using CLUSTAL W. Phylogenetic and molecular evolutionary analyses were conducted using MEGA 5 [15]. The genetic tree was constructed using maximum likelihood methods, with the complete deletion option, based on the Kimura 2-parameter model for nucleotide sequences. Statistical support for internal branches of the trees was evaluated by bootstrapping with 1000 iterations. 3. Results 3.1. Specificity and reproducibility of the new system of diagnosis The qPCR assay amplified A. phagocytophilum, A. marginale, A. centrale, A. ovis, A. platys, E. canis. E. ruminantium, N. sennetsu, and N. risticii. DNA from other bacteria tested (see above) was not amplified by this qPCR. Supplementary Fig. S1 shows the sensitivity of the real-time PCR assay tested on 6-fold serial dilutions of A. phagocytophilum DNA. The same results were obtained when two conventional PCR assays were used. All amplified bands were sequenced, and the results revealed specific amplification for each species. In each manipulation, negative controls were always negative. The results of both 23Sbased qPCR and conventional PCR were consistent. The phylogenetic tree based on the 23S rRNA gene sequences of the Anaplasmataceae strains tested here is presented in Fig. S2. The sequence similarity between A. phagocytophilum and the strains of A. platys, A. ovis, A. centrale, A. marginale, E. canis, E. ruminantium, N. sennetsu, and N. risticii was 94, 93, 93, 90, 86, 87, 83 and 83%, respectively. The lower sequence similarity score were 99%, and observed between A. marginale, A. centrale and A. ovis. The amplicon of this bacteria amplified by primers designed in this study was able to discriminate between this species on GenBank (Fig. S2). 3.2. Results of sample testing and phylogenetic analyses conducted on blood samples of bovines from Algeria Twenty-one of 36 tested cattle were found to be positive by the 23S-based qPCR. All 21 samples tested also positive by conventional 23S-based PCR. A BLAST search of obtained sequences showed that 15/21 sequences of 23S rRNA gene were identical or almost identical to A. phagocytophilum, 5/20 were positive for a new species of Anaplasma sp. closely related to A. phagocytophilum and 1/21 cattle were positive for A. platys. After

42

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

Table 2 The 5 sequence types amplified by 23S rRNA and 16S rRNA in this study. Sequence type A. phagocytophilum Variant 1 Variant 2 Variant 3 Anaplasma sp A. platys A. phagocytophilum Variant 1

Gene

BLAST analyses

Accession number

23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA

100% A. phagocytophilum 99% A. phagocytophilum 99% A. phagocytophilum 95% A. phagocytophilum 100% A. platys dog French

KM021415 KM021416 KM021417 KM021418 KM021419

16S rRNA

100% A. phagocytophilum (worldwide) 99% A. phagocytophilum (worldwide) 99% A. phagocytophilum (worldwide) 99% Anaplasma sp (China) 99% uncultured Anaplasma (China) 100% A. platys (worldwide)

KM401444

Variant 2

16S rRNA

Variant 3

16S rRNA

Anaplasma sp

16S rRNA

A. platys

16S rRNA

alignment by CLUSTAL W, we identified five different types of sequences, three sequences belonged to A. phagocytophilum and, one sequence identified as new species, and one to A. platys (Table 2). The three variants of A. phagocytophilum sequences were closely related to one another, each difference in the base pairs was verified on the original chromatograms. A. phagocytophilum genetic variant 1 was identified in 13 bovines and shared 100% identity with the sequence of A. phagocytophilum strain Dog 2 (CP006618), strain Hz (CP000235) and strain JM (CP006617). Variants 2 and 3 were found each in one bovine and shared 99% of identity with the above mentioned sequences of A. phagocytophilum. The new species Anaplasma sp. “variant 4” was derived from five bovines and shared only 95% of identity with the 23S rRNA gene of A. phagocytophilum. The sequence of A. platys identified in one bovine had 100% identity with the A. platys sequence obtained from a dog in France (KM021412) that had been sequenced in this study as a positive control, and the sequences of A. platys identified on dog from Algeria [16], New Caledonia, and French Guiana (M. Dahmani, unpublished data). To be remarked, we have obtained the A. platys sequence from bovines before getting the positive control of A. platys from Pr. L. Chabanne. The GenBank database contains few 23S rRNA gene sequences of bacteria belonging to the family Anaplasmataceae compared with the 16S rRNA database. The phylogenetic tree presented in (Fig. 1) includes all the available genetic data from GenBank and the sequences obtained in this study. We confirmed our results by sequencing the portion of 16S rRNA-coding gene of all positive samples. Similarly to 23S, 21/36 of bovine were positive, the amplicons were sequenced and BLAST search produced similar results: 15/21 samples were positive for A. phagocytophilum, and showed 3 different genotypes. A. phagocytophilum variant 1 shared 100% identity with A. phagocytophilum isolated worldwide was found in 13/21 cattle. Variant 2 (1/21), and 3 (1/21), shared 99% identity with A. phagocytophilum isolated worldwide. 5/21 cattle were found to be infected by Anaplasma sp. “variant 4” closely related to A. phagocytophilum (99%). Finally, one sample was positive for A.

KM401445 KM401446 KM021420

KM401447

platys. The results of the sequencing analysis conducted targeting the 23S rRNA correspond to these obtained targeting the 16S rRNA. Anaplasma sp. “variant 4” identified in this study shared only 95% of identity by 23S rRNA gene, but 99% by 16S rRNA gene with the strain type of A. phagocytophilum (Fig. 2). 4. Discussion Anaplasmataceae bacteria are predominantly known as important agents of veterinary disease. However, several new Ehrlichia and Anaplasma species have been recently isolated and characterized from human patients, animals and ticks; [17–22]. These bacteria are known also as emerging tick-borne pathogens [23,24]. Fundamentally, the changes in the host–vector ecology are largely responsible for the emergence. Moreover, the development of new insights in the field of laboratory diagnosis contribute to detecting new species [25]. Indeed, the global threat of Anaplasmataceae suggests the need for a new tool capable of discriminating between all species and potentially able to identify a new species. Several systems in molecular biology were proposed for diagnosing the species belonging to the Anaplasmataceae family. Most of them are based on the major surface proteins (MSPs) [26], the heat shock gene groEL [27] and the 16S rRNA gene [14]. The World Organisation for Animal Health (OIE) reports that laboratories running the MSPs PCR Assay should recognize problems associated with the inability to discriminate between some Anaplasma spp. [28]. The phylogeny of the groEL gene provides good evolutionary relationships among members of the eubacterial lineage [29], but some of the proposed tools require the supplementary step of a nested PCR to differentiate between species, yielding the possibility of contamination. The 16S rRNA gene sequence analysis is a good tool but requires approximately 1400 bp for a higher level of divergence [27]. In this study, using the higher level of divergence of the 23S rRNA gene sequence, we successfully developed rapid differentiation methods involving speciesspecific PCR based on the 23S rRNA gene sequences. Using these tools, we successfully amplified and sequenced the

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

43

Fig. 1. 23S rRNA-based phylogenetic analyses of the strains identified in the present study.

DNA of A. phagocytophilum, A. marginale, A. centrale, A. ovis, A. platys, E. canis, E. ruminantium, N. sennetsu, and N. risticii. Until now, this system was not tested on A. bovis DNAs, and the sequences of A. bovis based 23S RNA are not available in GenBank. At present, we cannot be clear on the ability of this system to amplify and discriminate A. bovis from other bacteria of Anaplasmataceae. In all experimentations, negative controls were always negative, the results of the

developed qPCR entirely corresponded to results obtained by the sequencing of the amplicons of the conventional PCR. None of these primer sets was able to amplify the DNA of other bacterial species including closely related Rickettsia. Moreover, we obtained the positive results by qPCR from the samples infected by potentially new species, Anaplasma sp. “variant 4” that confirm the proposed 23Sbased qPCR may not only identify the presence of already

Fig. 2. 16S rRNA-based phylogenetic analyses of the strains identified in the present study.

44

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45

known species (A. phagocytophilum, A. platys) but also rapidly identify potentially new species. The 23S rRNA gene provides better topological and statistical support and has several advantages compared with other gene analyses. First, this system provides realtime-PCR and conventional-PCR assays that can amplify all the bacteria used in this study. This system is now used routinely in our research and was tested on blood samples, ticks, and fleas, amplifying already known as well as potentially new Anaplasmataceae species (data not shown). Second, the phylogenetic tree based on the 23S rRNA sequences differentiates between the genera of Anaplasmataceae (Fig. 1, and Fig. S2). Third, the concept of this diagnostic method allows the association between speed and the ability to identify a large number of Anaplasmataceae, thereby providing a method that is cheaper and faster and does not require a reliable technique to discriminate between species. The bovine blood samples analyzed in this study allow us to report the first identification of A. phagocytophilum and A. platys from bovine in Algeria and confirm that bovines in Algeria can be carriers of Anaplasmataceae. Recently, study conducted on dog in Algeria confirmed infection of dogs by A. platys and E. canis by molecular tests [16,30]; A. phagocytophilum was also detected by serological testing [30]. In this study, analyses were conducted using the 23S rRNA and 16S rRNA genes. The results of the two systems are consistent and confirm that the method designed in this study provides a useful and powerful diagnostic tool. Ruminants are considered a competent reservoir of A. phagocytophilum [31], and carrier cows in advanced pregnancy and or lactation may relapse and develop signs of acute infection [32]. This characteristic essentially contributes to the persistence of infection and ensures its epidemiological cycle. Indeed, calving and milk sales yield the principal revenues for breeder. The intense conditions of livestock weaken the state of health of cattle; furthermore, the climate of northern Algeria is favorable to infestations by different species of ticks that are competent to transmit Anaplasmataceae [33]. All of these factors, combined with the absence of a system for monitoring infectious disease in animals, can lead to underestimating the extent of bovine anaplasmosis in Algeria. In the case of new species, other work were necessary to conclude on the pathogenicity of this species in Animals, and identify a potential vectors. One bovine was infected by A. platys: Ceci n’est pas 1 phrase. Using the 23S gene, the sequence showed 100% identity with the sequence of A. platys isolated from an infected dog. Zobba et al. reported this bacterium that infects ruminants as being A. platys-like [11]. Indeed, the infectivity of A. platys for ruminant, previously reported only as an agent of infectious cyclic thrombocytopenia in dogs, had already been documented in ovine from Senegal ([13] and personal data), and in human [34–36]. A. platys like A. bovis is not yet cultured species [37] and recently, analyses of 16S, groEL and gltA genes showed that A. bovis is closely related to A. phagocytophilum [38]. Indeed, the ability to detect these bacteria in blood smears greatly facilitates the diagnosis and implementation of

broad-spectrum treatment (also including babesiosis). The capacity of the treatment to yield excellent results makes this infection one of the neglected tick borne diseases in Algeria. The priority is to identify the Anaplasmataceae species that can infect ruminants in Algeria, followed by genotyping for identifying the genotype that circulates south of the Mediterranean. The province of Batna and other regions of Algeria are recognized as areas particularly affected by infectious diseases transmitted by ticks. Mokrani et al. reported the prospective study of all patients with fever and a skin rash admitted to the Infectious Diseases Units of Constantine and Batna Hospitals. From January 2000 to September 2006, 13% of the febrile exanthema cases among adults in the Batna area were attributed to tick-borne rickettsiosis [39]. For the 87% of the remaining fever cases, the author’s did not indicate any analysis conducted to identify Anaplasmataceae that may also play a role in the etiology of acute febrile diseases in humans. Indeed, in this study, we have confirmed that bovines in Algeria can be carriers of A. phagocytophilum. This bacterium is known as the agent of human granulocytic ehrlichiosis, and its involvement in cases of unexplained fever should be checked in Algerian patients. In addition, Anaplasmataceae are known to be responsible for the majority of infectious diseases transmitted by ticks in humans [37]. It is therefore necessary that the appropriate authorities in Algeria consider these new data for implementing programs that can evaluate Anaplasmataceae infections in human and animals. Acknowledgments This work was supported by the Fondation Méditerranée Infection (Marseille, France). We thank Muriel Vayssier, Hisashi Inokuma, Luc Chabanne, and Alpha Kabinet Keita for their assistance. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.cimid.2015.02.002. References [1] Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing SA. The natural history of Anaplasma marginale. Vet Parasitol 2010;167:95–107. [2] Inokuma H. Vectors and reservoir hosts of Anaplasmataceae. In: Raoult D, Parola P, editors. Rickettsial Disease. New York, NY: Taylor Grancis Group LLC; 2007. p. 199–212. [3] Brouqui P, Matsumoto K. Bacteriology and phylogeny of Anaplasmataceae. In: Raoult D, Parola P, editors. Rickettsial diseases. New York, NY: Taylor & Grancis Group LLC; 2007. p. 179–98. [4] Stuen S. Anaplasma phagocytophilum—the most widespread tick-borne infection in animals in Europe. Vet Res Commun 2007;31(S1):79–84. [5] Woldehiwet Z. Anaplasma phagocytophilum in ruminants in Europe. Ann NY Acad Sci 2006;1078:446–60. [6] Aubry P, Geale DW. A review of bovine anaplasmosis. Transboundary Emerg Dis 2011;58:1–30. [7] de la Fuente J, Torina A, Caracappa S, Tumino G, Furlá R, Almazán C, et al. Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily. Vet Parasitol 2005;133:357–62.

M. Dahmani et al. / Comparative Immunology, Microbiology and Infectious Diseases 39 (2015) 39–45 [8] Nair AS, Ravindran R, Lakshmanan B, Sreekumar C, Kumar SS, Raju R, et al. Bovine carriers of Anaplasma marginale and Anaplasma bovis in South India. Trop Biomed 2013;30:105–12. [9] Doan HTT, Noh JH, Choe SE, Yoo MS, Kim YH, Reddy KE, et al. Molecular detection and phylogenetic analysis of Anaplasma bovis from Haemaphysalis longicornis feeding on grazing cattle in Korea. Vet Parasitol 2013;196:478–81. [10] Kawahara M, Rikihisa Y, Lin Q, Tahara K, Itagaki A, Hiramitsu Y, et al. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis. Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl Environ Microbiol 2006;72:1102–9. [11] Zobba R, Anfossi AG, Pinna Parpaglia ML, Dore GM, Chessa B, Spezzigu A, et al. Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of neutrophiltropic strains closely related to A. platys. Appl Environ Microbiol 2014;80:271–80. [12] Djiba ML, Mediannikov O, Mbengue M, Thiongane Y, Molez J-F, Seck MT, et al. Survey of Anaplasmataceae bacteria in sheep from Senegal. Trop Anim Health Prod 2013;45:1557–61. [13] Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999;41:95–8. [14] Parola P, Cornet J, Ose Y, Miller RS, Thien HV, Gonzalez JP, et al. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol 2003;41:1600–8. [15] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731–9. [16] Dahmani M, Loudahi A, Mediannikov O, Fenollar F, Raoult D, Davoust B. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from Kabylie, Algeria. Ticks Tick Borne Dis 2015;6:198–203. [17] Dumler JS, Chen SM, Asanovich K, Trigiani E, Popov VL, Walker H. Isolation and characterization of a new strain of Ehrlichia chaffeensis from a patient with nearly fatal monocytic ehrlichiosis. J Clin Microbiol 1995;33(7):1704–11. [18] Dawson JE, Rikihisa Y, Ewing SA, Fishbein DB. Serologic diagnosis of human ehrlichiosis using two Ehrlichia canis isolates. J Infect Dis 1991;163(3):564–7. [19] Aguirre E, Sainz A, Dunner S, Amusatequi I, Lopez L, Rodrıguez-Franco F, et al. First isolation and molecular characterization of Ehrlichia canis in Spain. Vet Parasitol 2004;125:365–72. [20] Perez M, Rikihisa Y, Wen B. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J Clin Microbiol 1996;34:2133–9. [21] Bell-Sakyi L. Ehrlichia ruminantium grows in cell lines from four ixodid tick genera. J Comp Pathol 2004;130:285–93. [22] Zweygarth E, Shöl H, Lis K, Cruz AC, Thiel C, Silaghi C, et al. In vitro culture of a novel genotype of Ehrlichia sp. from Brazil. Transboundary Emerg Dis 2013;60:86–92. [23] Ismail N, Bloch KC, McBride JW. Human ehrlichiosis and anaplasmosis. Clin Lab Med 2010;30:261–92.

45

[24] Rikihisa Y. New findings on members of the family Anaplasmataceae of veterinary importance. Ann NY Acad Sci 2006;1078:438–45. [25] Paddock CD, Childs JE. Ehrlichia chaffeensis: a prototypical emerging pathogen. Clin Microbiol Rev 2003;16:37–64. [26] de la Fuente J, Lew A, Lutz H, Meli ML, Hofmann-Lehmann R, Shkap V, et al. Genetic diversity of Anaplasma species major surface proteins and implications for anaplasmosis serodiagnosis and vaccine development. Anim Health Res Rev 2007;6:75–89. [27] Park HS, Lee JH, Jeong EJ, Park TK, Kim TY, Chae JS, et al. Differentiation of Anaplasmataceae through partial groEL gene analysis. Microbiol Immunol 2005;49:655–62. [28] Torina A, Agnone A, Blanda V, Alongi A, d’Agostino R, Caracappa S, et al. Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale. Ticks Tick Borne Dis 2012;3:283–7. [29] Viale AM, Arakaki AK, Soncini FC, Ferreyra RG. Evolutionary relationships among eubacterial groups as inferred from GroEL (chaperonin) sequence comparisons. Int J Syst Bacteriol 1994;44: 527–33. [30] Azzag N, Petit E, Gandoin C, Bouillin C, Ghalmi F, Haddad N, et al. Prevalence of select vector-borne pathogens in stray and clientowned dogs from Algiers. Comp Immunol Microbiol Infect Dis 2015, http://dx.doi.org/10.1016/j.cimid.2015.01.001. [31] Stuen S, Granquist EG, Silaghi C. Anaplasma phagocytophilum—a widespread multi-host pathogen with highly adaptive strategies. Front Cell Infect Microbiol 2015;3:31. [32] da Silva JB, da Fonseca AH. Risk factors for anaplasmosis in dairy cows during the peripartum. Trop Anim Health Prod 2014;46:461–5. [33] Kernif T, Socolovschi C, Bitam I, Raoult D, Parola P. Vector-borne rickettsioses in North Africa. Infect Dis Clin North Am 2012;26:455–78. [34] Maggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt EB. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasit Vectors 2013;6:103. [35] Breitschwerdt EB, Hegarty BC, Qurollo BA, Saito TB, Maggi RG, Blanton LS, et al. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit Vectors 2014;7:298. [36] Arraga-Alvarado CM, Qurollo BA, Parra OC, Berrueta MA, Hegarty BC, Breitschwerdt EB. Case report: molecular evidence of Anaplasma platys infection in two women from Venezuela. Am J Trop Med Hyg 2014;91:1161–5. ˜ [37] Ybanez AP, Sashika M, Inokuma H. The phylogenetic position of Anaplasma bovis and inferences on the phylogeny of the genus Anaplasma. J Vet Med Sci 2014;76(2):307–12. [38] Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combi. Int J Syst Evol Microbiol 2001;51:2145–65. [39] Mokrani K, Tebbal S, Raoult D, Fournier PE. Human rickettsioses in the Batna area, eastern Algeria. Ticks Tick Borne Dis 2012;3:364–6.