Article Journal of Biomedical Nanotechnology
Copyright © 2013 American Scientific Publishers All rights reserved Printed in the United States of America
Vol. 9, 1254–1260, 2013 www.aspbs.com/jbn
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens Song Li1 ∗ , Hongna Liu2 , Yan Deng1 , Lin Lin1 , and Nongyue He1 2 1
Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology, Hunan University of Technology, Zhuzhou 412007, P. R. China 2 State Key Laboratory of Bioelectronics, Department of Biological Science and Medical Engineering, Southeast University, Nanjing, 210096, China
Foodborne diseases are a widespread and growing public health problem affecting both developed and developing countries, microbiologically contaminated food and water are the major causes of diarrhoeal diseases. Methods based on polymerase chain reaction (PCR) and microarrays are rapid and sensitive enough to detect very small quantities of microorganisms, however, the requirement for expensive equipments limits their application. In the present paper, we describe a method based on multiplex PCR and magnetic nanoparticles labelling for simultaneous detection of four major Delivered by Publishing Technology Rice University foodborne pathogens, including Escherichia coli O157:H7, Salmonellato: enterica, Vibrio cholera and Campylobacter jejuni. IP: 154.48.196.142 On: Wed, 04 Nov single 2015 strand 06:25:42 The process utilizes an oligonucleotide array onto which 5 biotinylated PCR products were hybridized and Copyright: American (SA-MNPs), Scientific Publishers visualized with streptavidin-coated magnetic nanoparticles the signal from which could be detected by the naked eye, microscope or CCD camera. By employing SA-MNPs as visible labels, the microarray unambiguously distinguished all 4 pathogens with detection sensitivity up to 316 CFU/mL. Due to its high sensitivity, specificity and simple detection procedure, the magnetic bead assay provides a powerful tool for the detection and identification of foodborne pathogens in a modestly equipped laboratory.
KEYWORDS: Magnetic Nanoparticles Labeling, Multiplex PCR, Foodborne Pathogen, Microarray, Visual Detection.
INTRODUCTION Food safety is a global health goal and the foodborne diseases pose a major crisis on health. Although the safety of food has dramatically improved overall, progress is uneven and foodborne outbreaks from microbial contamination, chemicals and toxins are common in many countries.1–4 Therefore, rapid and accurate detection of pathogenic bacteria is key to prevention and identification of problems related to health and safety. Conventional and standard bacterial detection methods such as culture and colony counting methods, immunology-based methods,5–7 may take up to several hours or even a few days to yield an answer. To make the real need for obtaining analytical results in the shortest time possible, the ∗
Author to whom correspondence should be addressed. Email: [email protected] Received: 1 October 2012 Accepted: 25 December 2012
1254
J. Biomed. Nanotechnol. 2013, Vol. 9, No. 7
conventional standard detection methods may insufficient and, therefore, new methods are needed. Over the recent years, many researchers have geared their efforts towards development of rapid detection methods. The advent of new technologies,8–12 based on biosensors, has brought in new and promising approaches for food pathogen detection. Microarrays are one of the main new breakthroughs in molecular analysis through miniaturization of assays and ability to enable monitoring of large number of genes simultaneously. Fluorescence detection has been a conventional method for DNA microarrays. Many researchers have used fluorescence for the detection and identification of intestinal pathogens in clinical specimens.13–20 Although fluorescent-based techniques are highly sensitive, the cost of detection equipment, including precise optics, laser diode, filters, and photo multiplier tube, makes them unattractive to most end users. To meet the requirements for less expensive equipment, some researches put 1550-7033/2013/9/1254/007
doi:10.1166/jbn.2013.1610
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
efforts on using nanomaterials as labels,21–33 which allows visual signal detection on microarray. In this study, we describe a DNA microarray assay using multiplex PCR and magnetic nanoparticles labeling for simultaneous detection of four clinically important foodborne pathogens, Escherichia coli O157:H7, Salmonella enterica, Vibrio cholera and Campylobacter jejuni. Multiplex asymmetric PCR system was established to simultaneously amplify the target genes of the four pathogens using two stages amplification. Subsequently, biotinylated single strand PCR products were hybridized on a detection microarray and streptavidin-coated magnetic nanoparticles were added to the slide surface for visualizing the hybridization results.
MATERIALS AND METHODS
reverse primer was labeled with biotin. The 5 -aminolabeled oligonucleotides with 10-nt poly T-linker were designed as target capture probes for array fabrication. All oligonucleotides used in this research were synthesized by Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd. (Shanghai, China). All sequences were selected from the conserved region and were crosscompared against each other to avoid cross-homology. Bacteria Culture and DNA Extraction A total of four reference strains of foodborne pathogens including Escherichia coli O157:H7 (rfbE), Salmonella enterica (invA), Vibrio cholera (OMPW) and Campylobacter jejuni (ceuE) were obtained from The American Type Culture Collection (ATCC, USA). All strains were colony purified before growing them in an appropriate liquid medium. After overnight incubation from fresh colonies, bacterial cells were collected by centrifugation and subjected to genomic DNA isolation. Genomic DNAs were extracted from 1 mL of bacterial culture liquids using Qiagen mini kit following the manufacture’s instructions. The concentrations of DNA samples were determined using NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, USA) and they ranged from 20 to 100 ng/L.
Reagents 3-mercaptopropyltriethoxysilane (MPTS) and 11-mercaptoundecanoic acid (MUA) (HOOCC11 SH) were obtained from Aldrich-sigma. EDC (1-Ethyl-3-(3-dimethyllaminopropyl) carbodiimide hydrochloride), MES (2-N -morpholino ethanesulfonic acid) and streptavidin were obtained from Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd. (Shanghai, China). Mini DNA extraction kit and Hot StarTaq Master Mix Kit were obtained from Qiagen. Epoxide by Coated Slides Technology Delivered Publishing to: Rice University PCR Amplification IP:Hybridization 154.48.196.142 On: Wed, Nov four 2015reference 06:25:42strains of foodborne pathogens were purchased from Corning Inc. solution The04 above Copyright: American Scientific Publishers was obtained from Invitrogen Corporation. Hybridization were used to assess the specificity of multiplex PCR. The chamber was obtained from Thermo Fisher Scientific Inc. oligonucleotides used in PCR amplification are listed in Table I. Multiplex PCR was performed in a two stages Synthesis of Oligonucleotides PCR model. Stage I was for gene specific amplification, The sequences of all oligonucleotides including geneinvolving 30 L of reaction mixture composed of 15 L of Qiagen 2× Master Mix, 2 L of template DNA, 1 L specific PCR primers, communal PCR primers, geneof primer mixture containing all 4 primer sets. Each primer specific probes, quality control (QC) probes used for this had a 10 mol/L concentration per reaction. The cycling experiment are shown in Table I. The 5 end of communal Table I.
Oligonucleotides used in this study. Oligo name
Sequence (5 –3 )
rfbE forward primer rfbE reverse primer rfbE detector invA forward primer invA reverse primer invA detector ceuE forward primer ceuE reverse primer ceuE detector OMPW forward primer OMPW reverse primer OMPW detector Communal forward primer Communal reverse primer QC probe QC detector Array marker
caggccacgttttgtcatgcAGGATTAGCTGTACATAGGC ttctttgcgttatgtctctg TGTTCTAACTGGGCTAATCC NH2 -(T)10 -TTATAGGATGACAAATATCTGCGCTGCTATA caggccacgttttgtcatgcCTGGTACTAATGGTGATGATC ttctttgcgttatgtctctg TGT AGA ACG ACC CCA TAA AC NH2 -(T)10 -ATTGGTTCGTCATTCCATTACCTACCTTGA caggccacgttttgtcatgcAAC AAA CCT AGT GTA GGT GG ttctttgcgttatgtctctg ACCATAAAGTTTTGCAACGC NH2 -(T)10 -TAGCTCCAACTTTATTTGTAGGTCTTGATA caggccacgttttgtcatgcTCAATATTACTTATAGGGATGGCTA ttctttgcgttatgtctctg TGGATCTTCAGA ACCACTTC NH2 -ATGGCTATCAGTAATGTTTCGAAAGGGCA caggccacgttttgtcatgc Biotin-ttctttgcgttatgtctctg Biotin-CACATTTGTCACTGCATCTCCGTGGTATAC NH2 -(T)10 -GTATACCACGGAGATGCAGTGACAAATGTG NH2 -TTTTTTTTTT-Cy3
Microorganism Escherichia coli O157:H7
Salmonella enterica
Campylobacter jejuni
Vibrio cholera
Positive control
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1255
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
conditions of stage I were as follows: 95 C for 15 min for initial activation of Taq DNA polymerase; 15 cycles of denaturing at 94 C for 30 s, annealing at 55 C for 30 s, and extension at 72 C for 30 s. Stage II PCR was for single strand target amplification using communal primers, involving 30 L reaction mixture composed of 15 L of Qiagen 2× Master Mix, 3 L of PCR products from stage I as template, 1.5 L of forward communal primer (2.5 mol/L) and 1.5 L of biotinylated reverse communal primer (10 mol/L), then H2 O was added to total 30 L. The cycling profile consisted of an initial melting step of 15 min at 95 C, followed by 45 cycles of 30 s at 94 C, 30 s at 55 C, and 30 s at 72 C.
Li et al.
2000; Robbins Scientific Corp., Sunnyvale, CA) at 52 C for 15 min with gentle shaking. The SA-MNPs were gathered onto the array spots by streptavidin-biotin binding reaction. After the binding of SA-MNPs to the biotinylated PCR products on the array, the slides were gently washed at room temperature with 0.1 M PBS buffer to remove non-bound material and hot dried. The final hybridization results were imaged by a CCD camera under microscope. Data Analysis The hybridization images obtained from CCD camera under microscope were analyzed using the software of Image J. For each image, the average intensity of positive control (PC), detected target and negative control (NC) was determined. When the average signal intensity of one spot was over 1000 and the ratio in comparison with that of the negative control was greater than 10, then the signal of this spot was considered to be positive.
Microarray Preparation and Hybridization The epoxide modified glass slides were selected as substrates for microarray. 40 M of DNA probes diluted in 200 mM phosphate buffer (PH 8.0) were printed onto slides following Corning manufacture instruction. For each target, the representing spots were printed in duplicate RESULTS AND DISCUSSION on each array to ensure data reliability and accuracy Development of the Method of pathogen detection. After spotting, slides were placed In this study, we describe a DNA microarray assay with into a wet-box for 12 h at 37 C to immobilize probes. the help of SA-MNPs-mediated signal detection for simulThe slides printed with DNA probes were blocked using taneous screening of four clinically important foodborne blocking solution (0.1% SDS, 100 mM Tris HCl, 0.5% pathogens. Four pathogens were amplified by multiplex Ethanol Amine, pH 9.0) at room temperature for 30 min. Delivered Publishing Technology to: Rice University PCR using gene-specific primers at the first stage, and one The blocking solution was then removedbyand slides were IP: sodium 154.48.196.142 On: Wed,pair 04 Nov 2015 06:25:42 of communal primers in which the reverse primers washed successively with 1 g/L dodecyl sulfate Copyright: American Scientific Publishers were labeled with biotin at the 5 end, were designed (SDS)-4 × SSC, 1 g/L SDS-0.1 × SSC and deionized water to perform asymmetric PCR amplificatiom at the secat room temperature, 5 min for each wash. After that, ond stage. The amplified single strand-DNA (ss-DNA) slides were dried with N2 gas and stored at room temperwas then hybridized with its capture probe on the array ature until used. directly. After hybridization and washing, the hybridized The prepared microarray was framed with a 65 L biotinylated PCR products were visualized by means of hybridization chamber and the hybridization mixture was the streptavidin-coated magnetic beads. Figure 1 shows the then added, with 10 L of biotinylated multiplex PCR schematic of magnetic beads labeling technique used in products, 32.5 L of hybridization buffer with 1 pmol of the detection of biotinylated targets on an oligonucleotide positive control probe (biotin labelled QC probe) which array. The final hybridization results are in visual foris complementary with QC detector on the array, and mat based on magnetic bead labeling technique, without 22.5 L of H2 O, all of these to a total volume of 65 L. need for expensive fluorescent probes and signal detection The frame was covered with a piece of plastic foil of the equipment. The approach described here offers an emergsame size. The microarray was incubated in a hybridizaing application for molecular diagnosis in food safety tion oven at 52 C for 50 min. After hybridization, the that is amenable for use in a modestly equipped laboratory. hybridization frame was peeled off over each array and the slides placed in the dish followed by twice washing with 2 × SSC solution, 0.1% SDS for 2 min, then twice with Foodborne Pathogen Detection 0.1 × SSC, 0.1% SDS for 2 min, and H2 O for 1 min. Multiplex PCR was evaluated using a mixture of genomic DNAs that were isolated individually from each culDetection with SA-Coated Magnetic Beads ture of bacteria. DNA mixture 1 contained an equal concentration of each genomic DNA from Escherichia Streptavidin coated magnetic nanoparticles were prepared coli O157:H7 and Vibrio cholera. DNA mixture 2 conaccording to the previously published paper,34 the SAtained an equal concentration of each genomic DNA from MNPs were dispersed in PBS buffer with the concentraSalmonella enterica, and Campylobacter jejuni. Followtion of 4 mg/mL. After hybridization, the microarray was ing two stages multiplex PCR, the DNAs amplified from reframed with another chamber and 65 L of 4 mg/mL DNA mixture 1 and mixture 2 were employed to evalustreptavidin coated magnetic beads were added in. The ate the performance of the microarray, respectively. For slides were incubated in a hybridization oven (Model 1256
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
Figure 1. Schematic of magnetic beads labelling techniques used in the detection of biotinylated target on oligonucleotide array. SA-coated magnetic beads discover biotinylated oligonucleotides hybridized with complementary oligonucleotides linked to microarrays.
each species, one capture probe representing the gene tarpositive signals on the array were unambiguous and could be distinguished from background by naked eyes. get was designed and printed in duplicate on each array for pathogen detection. Figure 2(A) shows the array layout for the four reference strains test. For detection of DNA mixSensitivity Comparison of SA-Magnetic Beads ture 1, the probes rfbE and OMPW which were designed with Dynal MyOne Streptavidin Beads for identification of Escherichia coli O157:H7 and VibApplication of Dynal MyOne streptavidin coated magnetic rio cholera showed unambiguously visible hybridization beads (Invitrogen Inc. Carlsbad, CA) as labels to be used results (Fig. 2(B)). After data analysis, the signal intensiin microarray detection has been reported.21 23 29 Howties of rfbE and OMPW were 8907 and 7865 (Fig. 2(D)) ever, the relatively lager size of MyOne beads (∼ 1 m) and the signal/noise ratio were 20.5 and 18.2, respectively. may affect the sensitivity of array detection. In this study, Similarly, both invA and ceuE also yielded viable sigwe compared the detection limit between our home-made Delivered by Publishing Rice University nal with intensities of 8645 and 6432 (Figs. 2(C), (E)), Technology SA-MNPsto:and Dynal MyOne beads. Various concentraIP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 and the signal/noise ratio were 15.6 andCopyright: 11.6, respectively. tions of biotinylated QC American Scientific Publishers probe (10 pmol/L, 1 pmol/L, 0.1 pmol/L, 0.01 pmol/L) instead of biotinylated asymAccording to the above criteria, they were all considered as metric PCR products being selected for hybridization positive. Furthermore, the microarray images that showed (A)
(B)
(D)
(C)
(E)
Figure 2. Multiple foodborne pathogens detection based on multiplex PCR and magnetic beads labelling technique. (A) The array layout for the four reference strains detection; (B) Escherichia coli O157:H7 (rfbE), and Vibrio cholera (OMPW); (C) Salmonella enterica (invA)and Campylobacter jejuni (ceuE); (D) The relative intensities of target rfbE and OMPW; (E) The relative intensities of target invA and ceuE. J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1257
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens (A)
(B)
Li et al.
(C)
Figure 3. Sensitivity comparison of SA-magnetic beads with Dyna MyOne beads. (A) The image generated by using SA-MNPs; (B) The image generated by using Dyno MyOne beads. (C) The relative intensities of SA-MNPs and Dyno MyOne beads.
with the QC detector on array and then home-made SAthe detection method of using home-made SA-MNPs as MNPs and Dynal MyOne beads were added separately to labels showed higher sensitivity than the Dynal MyOne compare the sensitivity between them. Figures 3(A), (B) beads. show the hybridization results imaged by CCD camera, all giving visual results at the concentration of Limit of Detection (LOD) Test 10 pmol/L, 1 pmol/L, and 0.1 pmol/L. When the To determine the analytical sensitivity of this method, biotinylated oligonucleotide concentration was decreased Salmonella enterica was selected as the target in evaluation to 0.01 pmol/L, the image detected by Dynal MyOne of sensitivity. The bacterial solution of Salmonella enterica beads (Fig. 3(B)) looked not as bright as that from homewas serially diluted from 106 CFU/mL to 102 CFU/mL in made SA-MNPs (Fig. 3(A)). Figure 3(C) shows the relturn (ten-fold each time). Each concentration was tested ative intensities of the signal on the array, the signal in 10 to: replicates assays. DNA extracted from the serial Delivered by Publishing Technology Rice University intensity from 0.01 pmol/L IP: oligonuclotide detected 154.48.196.142 On:by Wed,dilutions 04 Nov 2015 06:25:42 was used as the template for multiplex PCR American Publishers Dynal MyOne beads was only 943,Copyright: which is lower than Scientific amplification. PCR products derived from the series of the 1000 and can be considered as negative. On the contemplates were mixed with hybridization buffer and incutrary, the signal intensity from 0.01 pmol/L detected by bated on separate slides in parallel with the hybridization. SA-MNPS was 2354.1, which was considered as positive. The images were obtained by CCD camera and the intenPrevious research showed that the home-made SA-MNPs sities were generated by Image J. The Limit of Detection have average diameter of 36 nm. Compared with Dynal (LOD) was defined as the level at which 95% of the samMyOne beads of 1.0 m in diameter, the home-made SAples yielded a positive result and the LOD results of this MNPs have smaller size and larger specific surface area, test are summarized in Table II. Only relevant dilutions which means more SA-MNPs can deposit on an unit area (above and below the 95% LOD) are indicated. After calthan the MyOne beads. Furthermore, we have evaluated culation, the result indicates that the LOD of this method the binding capacity of biotin labeled oligonucleotieds on was 316 CFU/mL. the two kinds of streptavidin coated magnetic beads. The results showed that the home-made SA-MNPs are capaCONCLUSION ble of binding 7-fold higher biotinylated oligonucleotides Though there are various foodborne pathogens that have than Dynal MyOne beads (Data not shown). Therefore, been identified for food borne illnesses, Escherichia coli biotinylated oligonucleotides on the array bonded with O157:H7, Salmonella enterica, Vibrio cholera and Campymore SA-MNPs and allowed the home-made SA-MNPs to lobacter jejuni have been generally found to be responenhance the assay sensitivity for visual detection. Overall, sible for majority of foodborne outbreaks.7 35 This study has reported a simple, rapid, sensitive and cheap microarTable II. Limit of detection (LOD) of this method. ray assay for the simultaneous detection of four clinically important foodborne pathogens in visualized format invA based on magnetic bead labelling technique and multiplex The concentration of sample (CFU/ml) % (+) (%) PCR. Combined with high efficient PCR amplification, an 1 × 105 100 appropriate sensitivity can be achieved for the multiplexed 100 1 × 104 microarray detection. While the naked eye readout allows 3 1 × 10 100 an instant interpretation of the multiplex results, recording 2 90 1 × 10 and transmission of the results can be facilitated by the 1258
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
12. B. Suo, Y. P. He, G. Paoli, A. Gehring, S. I. Tu, and X. M. Shi, Development of an oligonucleotide-based microarray to detect multiple foodborne pathogens. Mol. Cell. Probe. 24, 77 (2010). 13. D. Z. Jin, S. Y. Wen, S. H. Chen, F. Lin, and S. Q. Wang, Detection and identification of intestinal pathogens in clinical specimens using DNA microarrays. Mol. Cell. Probe. 20, 337 (2006). 14. S. C. De Keersmaecker, K. Marchal, T. L. Verhoeven, K. Engelen, J. Vanderleyden, and C. S. Detweiler, Microarray analysis and motif detection reveal new targets of the Salmonella enterica serovar Acknowledgment: This research was financially supTyphimurium HilA regulatory protein, including hilA itself. J. Bacported by the National Key Program for Developing teriol. 187, 4381 (2005). Basic Research of China (2010CB933903), the National 15. I. Abubakar, L. Irvine, C. F. Aldus, G. M. Wyatt, R. Fordham, S. Schelenz, L. Shepstone, A. Howe, M. Peck, and P. R. Hunter, Key Special Science Program (2013ZX10004103-002), A systematic review of the clinical, public health and costNSFC (60801007, 21205013, 61271056 and 60971045), effectiveness of rapid diagnostic tests for the detection and identifiHunan Science and Technology Projects (2012SK3105 cation of bacterial intestinal pathogens in faeces and food. Health. and 2010sk2003), Natural Science Foundation of Hunan Technol. Asses. 11, 36 (2007). Province (12JJ6060), Scientific Research Fund of Hunan 16. B. Liu, Y. Jia, M. Ma, Z. Li, H. Liu, S. Li, Y. Deng, L. Zhang, Z. Lu, W. Wang, and N. He, High throughput SNP detection system Provincial Education Department (11A030), China based on magnetic nanoparticles separation. J. Biomed. Nanotechnol. Postdoctoral Science Foundation (20100471362 and 9, 247 (2013). 2012M511660). 17. G. Xia, W. Gao, K. Ji, S. Liu, B. Wan, J. Luo, and Y. Bai, Single nucleotide polymorphisms analysis of noise-induced hearing loss using three-dimensional polyacrylamide gel-based microarray REFERENCES method. J. Biomed. Nanotechnol. 7, 807 (2011). 1. H. J. Kim, S. H. Park, T. H. Lee, B. H. Nahm, Y. R. Kim, and 18. S. Li, H. Liu, Y. Jia, Y. Deng, L. Zhang, Z. Lu, and N. He, A novel H. Y. Kim, Microarray detection of food-borne pathogens using speSNPs detection method based on gold magnetic nanoparticles array cific probes prepared by comparative genomics. Biosens. Bioelecand single base extension. Theranostics 2, 967 (2012). tron. 24, 238 (2008). 19. A. Bruchet, V. Dugas, I. Laszak, C. Mariet, F. Goutelard, and 2. V. Velusamy, K. Arshak, O. Korostynska, K. Oliwa, and C. Adley, J. Randon, Synthesis and characterization of ammonium functionalAn overview of foodborne pathogenDelivered detection: Inby the Publishing perspective of Technology ized porous poly(glycidyl methacrylate-co-ethylene dimethacrylate) to: Rice University biosensors. Biotechnol. Adv. 28, 232 (2010). monoliths for microscale analysis and its application to DNA purifiIP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 3. E. D. Boer and R. R. Beumer, MethodologyCopyright: for detection American and typcation. J.Publishers Biomed. Nanotechnol. 7, 415 (2011). Scientific ing of foodborne microorganisms. Int. J. Food. Microbiol. 50, 119 20. P. Prabhu and V. Patravale, The upcoming field of theranos(1999). tic nanomedicine: An overview. J. Biomed. Nanotechnol. 8, 859 4. E. C. Alocilja and S. M. Radke, Market analysis of biosensors for (2012). food safety. Biosens. Bioelectron. 18, 841 (2003). 21. N. LeBlanca, J. Gantelius, J. M. Schwenkc, K. Stahla, J. Blombergd, 5. K. G. Maciorowski, P. Herrera, F. T. Jones, S. D. Pillai, and S. C. H. Andersson-Svahnb, and S. Belaka, Development of a magnetic Ricke, Cultural and immunological detection methods for salmonella bead microarray for simultaneous and simple detection of four pesspp, in animal feeds—A review. Vet. Res. Commun. 30, 127 tiviruses. J. Virol. Methods 155, 1 (2009). (2006). 22. V. N. Morozov, S. Groves, M. J. Turell, and C. Bailey, Three 6. O. Lazcka, F. J. Del Campo, and F. X. Munoz, Pathogen detection: minutes-long electrophoretically assisted zeptomolar microfluidic A perspective of traditional methods and biosensors. Biosens. Bioimmunoassay with magnetic-beads detection. J. Am. Chem. Soc. electron. 22, 1205 (2007). 129, 12628 (2007). 7. Y. X. Wang, Z. Z. Ye, and Y. B. Ying, New trends in impedimet23. Y. M. Shlyapnikov, E. A. Shlyapnikova, T. Y. Morozova, I. P. ric biosensors for the detection of foodborne pathogenic bacteria. Beletsky, and V. N. Morozov, Detection of microarray-hybridized Sensors 12, 3449 (2012). oligonucleotides with magnetic beads. Anal. Biochem. 399, 125 8. L. L. C. Estevanato, L. M. Lacava, L. C. F. Carvalho, R. B. Azevedo, (2010). O. Silva, F. Pelegrini, S. N. Báo, P. C. Morais, and Z. G. M. 24. C. Li, C. Ma, F. Wang, Z. Xi, Z. Wang, Y. Deng, and N. He, PrepaLacava, Long-term biodistribution and biocompatibility investigation ration and biomedical applications of core–shell silica/magnetic of dextran-coated magnetite nanoparticle using mice as the animal nanoparticle composites. J. Nanosci. Nanotechnol. 12, 2964 (2012). model. J. Biomed. Nanotechnol. 8, 301 (2012). 25. R. Krishna, E. Titus, R. Krishna, N. Bardhan, D. Bahadur, and 9. N. He, F. Wang, C. Ma, C. Li, X. Zeng, Y. Deng, L. Zhang, J. Gracio, Wet-chemical green synthesis of L-lysine amino acid staand Z. Li, Chemiluminescence analysis for HBV-DNA hybridizabilized biocompatible iron-oxide magnetic nanoparticles. J. Nanosci. tion detection with magnetic nanoparticles based DNA extraction Nanotechnol. 12, 6645 (2012). from positive whole blood samples. J. Biomed. Nanotechnol. 9, 267 26. X. Li, F. Zhang, C. Ma, E. Saul, and N. He, Green synthesis of uni(2013). form magnetite (Fe3 O4 ) nanoparticles and micron cubes. J. Nanosci. 10. H. Sun, Q. H. Mo, J. C. Lin, Z. Yang, C. N. Tu, D. Y. Gu, L. Shi, and Nanotechnol. 12, 2939 (2012). W. P. Lu, Rapid simultaneous screening of seven clinically important 27. D. R. Baselt, G. U. Lee, M.Natesan, S. W. Metzger, P. E. Sheehan, enteric pathogens using a magnetic bead based DNA microarray. and R. J. Colton, A biosensor based on magnetoresistance technolWorld. J. Microb. Biot. 27, 163 (2011). ogy. Biosens. Bioelectron. 13, 731 (1998). 11. Y. Tang, Z. Li, N.He, L. Zhang, C. Ma, X. Li, C. Li, Z. Wang, 28. V. N. Morozov and T. Y. Morozova, Active bead-linked immunoasY. Deng, and L. He, Preparation of functional magnetic nanoparticles say on protein microarrays. Anal. Chim. Acta 564, 40 (2006). mediated with PEG-4000 and application in pseudomonas aerugi29. H. J. Qi, S. H. Chen, M. L. Zhang, H. Shi, and S. Q. nosa rapid detection. J. Biomed. Nanotechnol. 9, 312 (2013). Wang, DNA microarrays for visual detection of human pathogenic
aid of a commonly used CCD camera. Using home-made SA-MNPs, this approach may also present an attractive possibility from an economical point of view. With various attractive advantages and relatively low limit of detection (316 CFU/mL), this method shows great potential utilization for diagnosis of infectious diseases in both conventional laboratories and on-site observations.
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1259
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens microorganisms based on tyramine signal amplification coupled with gold label silver stain. Anal. Bioanal. Chem. 398, 2745 (2010). 30. F. Wang, C. Ma, X. Zeng, C. Li, Y. Deng, and N. He, Chemiluminescence molecular detection of sequence-specific HBV-DNA using magnetic nanoparticles. J. Biomed. Nanotechnol. 8, 786 (2012). 31. Q. He, L. Shao, J. Yu, S. Ji, H. Wang, Y. Mao, and J. Chen, Urinary proteome analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with magnetic beads for identifying the pathologic presentation of clinical early IgA nephropathy. J. Biomed. Nanotechnol. 8, 133 (2012).
Li et al.
32. M. Wang, J. Zhang, Z. Yuan, W. Yang, Q. Wu, and H. Gu, Targeted thrombolysis by using of magnetic mesoporous silica nanoparticles. J. Biomed. Nanotechnol. 8, 624 (2012). 33. H. N. Liu, S. Li, L. S. Liu, L.Tian, and N. Y. He, An integrated and sensitive detection platform for biosensing application based on Fe@Au magnetic nanoparticles as bead array carries. Biosens. Bioelectron. 26, 1442 (2010). 34. S. Chemburu, E. Wilkinsa, and I. Abdel-Hamidb, Detection of pathogenic bacteria in food samples using highly-dispersed carbon particles. Biosens. Bioelectron. 21, 491 (2005).
Delivered by Publishing Technology to: Rice University IP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 Copyright: American Scientific Publishers
1260
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
Copyright © 2013 American Scientific Publishers All rights reserved Printed in the United States of America
Vol. 9, 1254–1260, 2013 www.aspbs.com/jbn
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens Song Li1 ∗ , Hongna Liu2 , Yan Deng1 , Lin Lin1 , and Nongyue He1 2 1
Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology, Hunan University of Technology, Zhuzhou 412007, P. R. China 2 State Key Laboratory of Bioelectronics, Department of Biological Science and Medical Engineering, Southeast University, Nanjing, 210096, China
Foodborne diseases are a widespread and growing public health problem affecting both developed and developing countries, microbiologically contaminated food and water are the major causes of diarrhoeal diseases. Methods based on polymerase chain reaction (PCR) and microarrays are rapid and sensitive enough to detect very small quantities of microorganisms, however, the requirement for expensive equipments limits their application. In the present paper, we describe a method based on multiplex PCR and magnetic nanoparticles labelling for simultaneous detection of four major Delivered by Publishing Technology Rice University foodborne pathogens, including Escherichia coli O157:H7, Salmonellato: enterica, Vibrio cholera and Campylobacter jejuni. IP: 154.48.196.142 On: Wed, 04 Nov single 2015 strand 06:25:42 The process utilizes an oligonucleotide array onto which 5 biotinylated PCR products were hybridized and Copyright: American (SA-MNPs), Scientific Publishers visualized with streptavidin-coated magnetic nanoparticles the signal from which could be detected by the naked eye, microscope or CCD camera. By employing SA-MNPs as visible labels, the microarray unambiguously distinguished all 4 pathogens with detection sensitivity up to 316 CFU/mL. Due to its high sensitivity, specificity and simple detection procedure, the magnetic bead assay provides a powerful tool for the detection and identification of foodborne pathogens in a modestly equipped laboratory.
KEYWORDS: Magnetic Nanoparticles Labeling, Multiplex PCR, Foodborne Pathogen, Microarray, Visual Detection.
INTRODUCTION Food safety is a global health goal and the foodborne diseases pose a major crisis on health. Although the safety of food has dramatically improved overall, progress is uneven and foodborne outbreaks from microbial contamination, chemicals and toxins are common in many countries.1–4 Therefore, rapid and accurate detection of pathogenic bacteria is key to prevention and identification of problems related to health and safety. Conventional and standard bacterial detection methods such as culture and colony counting methods, immunology-based methods,5–7 may take up to several hours or even a few days to yield an answer. To make the real need for obtaining analytical results in the shortest time possible, the ∗
Author to whom correspondence should be addressed. Email: [email protected] Received: 1 October 2012 Accepted: 25 December 2012
1254
J. Biomed. Nanotechnol. 2013, Vol. 9, No. 7
conventional standard detection methods may insufficient and, therefore, new methods are needed. Over the recent years, many researchers have geared their efforts towards development of rapid detection methods. The advent of new technologies,8–12 based on biosensors, has brought in new and promising approaches for food pathogen detection. Microarrays are one of the main new breakthroughs in molecular analysis through miniaturization of assays and ability to enable monitoring of large number of genes simultaneously. Fluorescence detection has been a conventional method for DNA microarrays. Many researchers have used fluorescence for the detection and identification of intestinal pathogens in clinical specimens.13–20 Although fluorescent-based techniques are highly sensitive, the cost of detection equipment, including precise optics, laser diode, filters, and photo multiplier tube, makes them unattractive to most end users. To meet the requirements for less expensive equipment, some researches put 1550-7033/2013/9/1254/007
doi:10.1166/jbn.2013.1610
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
efforts on using nanomaterials as labels,21–33 which allows visual signal detection on microarray. In this study, we describe a DNA microarray assay using multiplex PCR and magnetic nanoparticles labeling for simultaneous detection of four clinically important foodborne pathogens, Escherichia coli O157:H7, Salmonella enterica, Vibrio cholera and Campylobacter jejuni. Multiplex asymmetric PCR system was established to simultaneously amplify the target genes of the four pathogens using two stages amplification. Subsequently, biotinylated single strand PCR products were hybridized on a detection microarray and streptavidin-coated magnetic nanoparticles were added to the slide surface for visualizing the hybridization results.
MATERIALS AND METHODS
reverse primer was labeled with biotin. The 5 -aminolabeled oligonucleotides with 10-nt poly T-linker were designed as target capture probes for array fabrication. All oligonucleotides used in this research were synthesized by Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd. (Shanghai, China). All sequences were selected from the conserved region and were crosscompared against each other to avoid cross-homology. Bacteria Culture and DNA Extraction A total of four reference strains of foodborne pathogens including Escherichia coli O157:H7 (rfbE), Salmonella enterica (invA), Vibrio cholera (OMPW) and Campylobacter jejuni (ceuE) were obtained from The American Type Culture Collection (ATCC, USA). All strains were colony purified before growing them in an appropriate liquid medium. After overnight incubation from fresh colonies, bacterial cells were collected by centrifugation and subjected to genomic DNA isolation. Genomic DNAs were extracted from 1 mL of bacterial culture liquids using Qiagen mini kit following the manufacture’s instructions. The concentrations of DNA samples were determined using NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, USA) and they ranged from 20 to 100 ng/L.
Reagents 3-mercaptopropyltriethoxysilane (MPTS) and 11-mercaptoundecanoic acid (MUA) (HOOCC11 SH) were obtained from Aldrich-sigma. EDC (1-Ethyl-3-(3-dimethyllaminopropyl) carbodiimide hydrochloride), MES (2-N -morpholino ethanesulfonic acid) and streptavidin were obtained from Shanghai Sangon Biologic Engineering Technology and Service Co. Ltd. (Shanghai, China). Mini DNA extraction kit and Hot StarTaq Master Mix Kit were obtained from Qiagen. Epoxide by Coated Slides Technology Delivered Publishing to: Rice University PCR Amplification IP:Hybridization 154.48.196.142 On: Wed, Nov four 2015reference 06:25:42strains of foodborne pathogens were purchased from Corning Inc. solution The04 above Copyright: American Scientific Publishers was obtained from Invitrogen Corporation. Hybridization were used to assess the specificity of multiplex PCR. The chamber was obtained from Thermo Fisher Scientific Inc. oligonucleotides used in PCR amplification are listed in Table I. Multiplex PCR was performed in a two stages Synthesis of Oligonucleotides PCR model. Stage I was for gene specific amplification, The sequences of all oligonucleotides including geneinvolving 30 L of reaction mixture composed of 15 L of Qiagen 2× Master Mix, 2 L of template DNA, 1 L specific PCR primers, communal PCR primers, geneof primer mixture containing all 4 primer sets. Each primer specific probes, quality control (QC) probes used for this had a 10 mol/L concentration per reaction. The cycling experiment are shown in Table I. The 5 end of communal Table I.
Oligonucleotides used in this study. Oligo name
Sequence (5 –3 )
rfbE forward primer rfbE reverse primer rfbE detector invA forward primer invA reverse primer invA detector ceuE forward primer ceuE reverse primer ceuE detector OMPW forward primer OMPW reverse primer OMPW detector Communal forward primer Communal reverse primer QC probe QC detector Array marker
caggccacgttttgtcatgcAGGATTAGCTGTACATAGGC ttctttgcgttatgtctctg TGTTCTAACTGGGCTAATCC NH2 -(T)10 -TTATAGGATGACAAATATCTGCGCTGCTATA caggccacgttttgtcatgcCTGGTACTAATGGTGATGATC ttctttgcgttatgtctctg TGT AGA ACG ACC CCA TAA AC NH2 -(T)10 -ATTGGTTCGTCATTCCATTACCTACCTTGA caggccacgttttgtcatgcAAC AAA CCT AGT GTA GGT GG ttctttgcgttatgtctctg ACCATAAAGTTTTGCAACGC NH2 -(T)10 -TAGCTCCAACTTTATTTGTAGGTCTTGATA caggccacgttttgtcatgcTCAATATTACTTATAGGGATGGCTA ttctttgcgttatgtctctg TGGATCTTCAGA ACCACTTC NH2 -ATGGCTATCAGTAATGTTTCGAAAGGGCA caggccacgttttgtcatgc Biotin-ttctttgcgttatgtctctg Biotin-CACATTTGTCACTGCATCTCCGTGGTATAC NH2 -(T)10 -GTATACCACGGAGATGCAGTGACAAATGTG NH2 -TTTTTTTTTT-Cy3
Microorganism Escherichia coli O157:H7
Salmonella enterica
Campylobacter jejuni
Vibrio cholera
Positive control
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1255
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
conditions of stage I were as follows: 95 C for 15 min for initial activation of Taq DNA polymerase; 15 cycles of denaturing at 94 C for 30 s, annealing at 55 C for 30 s, and extension at 72 C for 30 s. Stage II PCR was for single strand target amplification using communal primers, involving 30 L reaction mixture composed of 15 L of Qiagen 2× Master Mix, 3 L of PCR products from stage I as template, 1.5 L of forward communal primer (2.5 mol/L) and 1.5 L of biotinylated reverse communal primer (10 mol/L), then H2 O was added to total 30 L. The cycling profile consisted of an initial melting step of 15 min at 95 C, followed by 45 cycles of 30 s at 94 C, 30 s at 55 C, and 30 s at 72 C.
Li et al.
2000; Robbins Scientific Corp., Sunnyvale, CA) at 52 C for 15 min with gentle shaking. The SA-MNPs were gathered onto the array spots by streptavidin-biotin binding reaction. After the binding of SA-MNPs to the biotinylated PCR products on the array, the slides were gently washed at room temperature with 0.1 M PBS buffer to remove non-bound material and hot dried. The final hybridization results were imaged by a CCD camera under microscope. Data Analysis The hybridization images obtained from CCD camera under microscope were analyzed using the software of Image J. For each image, the average intensity of positive control (PC), detected target and negative control (NC) was determined. When the average signal intensity of one spot was over 1000 and the ratio in comparison with that of the negative control was greater than 10, then the signal of this spot was considered to be positive.
Microarray Preparation and Hybridization The epoxide modified glass slides were selected as substrates for microarray. 40 M of DNA probes diluted in 200 mM phosphate buffer (PH 8.0) were printed onto slides following Corning manufacture instruction. For each target, the representing spots were printed in duplicate RESULTS AND DISCUSSION on each array to ensure data reliability and accuracy Development of the Method of pathogen detection. After spotting, slides were placed In this study, we describe a DNA microarray assay with into a wet-box for 12 h at 37 C to immobilize probes. the help of SA-MNPs-mediated signal detection for simulThe slides printed with DNA probes were blocked using taneous screening of four clinically important foodborne blocking solution (0.1% SDS, 100 mM Tris HCl, 0.5% pathogens. Four pathogens were amplified by multiplex Ethanol Amine, pH 9.0) at room temperature for 30 min. Delivered Publishing Technology to: Rice University PCR using gene-specific primers at the first stage, and one The blocking solution was then removedbyand slides were IP: sodium 154.48.196.142 On: Wed,pair 04 Nov 2015 06:25:42 of communal primers in which the reverse primers washed successively with 1 g/L dodecyl sulfate Copyright: American Scientific Publishers were labeled with biotin at the 5 end, were designed (SDS)-4 × SSC, 1 g/L SDS-0.1 × SSC and deionized water to perform asymmetric PCR amplificatiom at the secat room temperature, 5 min for each wash. After that, ond stage. The amplified single strand-DNA (ss-DNA) slides were dried with N2 gas and stored at room temperwas then hybridized with its capture probe on the array ature until used. directly. After hybridization and washing, the hybridized The prepared microarray was framed with a 65 L biotinylated PCR products were visualized by means of hybridization chamber and the hybridization mixture was the streptavidin-coated magnetic beads. Figure 1 shows the then added, with 10 L of biotinylated multiplex PCR schematic of magnetic beads labeling technique used in products, 32.5 L of hybridization buffer with 1 pmol of the detection of biotinylated targets on an oligonucleotide positive control probe (biotin labelled QC probe) which array. The final hybridization results are in visual foris complementary with QC detector on the array, and mat based on magnetic bead labeling technique, without 22.5 L of H2 O, all of these to a total volume of 65 L. need for expensive fluorescent probes and signal detection The frame was covered with a piece of plastic foil of the equipment. The approach described here offers an emergsame size. The microarray was incubated in a hybridizaing application for molecular diagnosis in food safety tion oven at 52 C for 50 min. After hybridization, the that is amenable for use in a modestly equipped laboratory. hybridization frame was peeled off over each array and the slides placed in the dish followed by twice washing with 2 × SSC solution, 0.1% SDS for 2 min, then twice with Foodborne Pathogen Detection 0.1 × SSC, 0.1% SDS for 2 min, and H2 O for 1 min. Multiplex PCR was evaluated using a mixture of genomic DNAs that were isolated individually from each culDetection with SA-Coated Magnetic Beads ture of bacteria. DNA mixture 1 contained an equal concentration of each genomic DNA from Escherichia Streptavidin coated magnetic nanoparticles were prepared coli O157:H7 and Vibrio cholera. DNA mixture 2 conaccording to the previously published paper,34 the SAtained an equal concentration of each genomic DNA from MNPs were dispersed in PBS buffer with the concentraSalmonella enterica, and Campylobacter jejuni. Followtion of 4 mg/mL. After hybridization, the microarray was ing two stages multiplex PCR, the DNAs amplified from reframed with another chamber and 65 L of 4 mg/mL DNA mixture 1 and mixture 2 were employed to evalustreptavidin coated magnetic beads were added in. The ate the performance of the microarray, respectively. For slides were incubated in a hybridization oven (Model 1256
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
Figure 1. Schematic of magnetic beads labelling techniques used in the detection of biotinylated target on oligonucleotide array. SA-coated magnetic beads discover biotinylated oligonucleotides hybridized with complementary oligonucleotides linked to microarrays.
each species, one capture probe representing the gene tarpositive signals on the array were unambiguous and could be distinguished from background by naked eyes. get was designed and printed in duplicate on each array for pathogen detection. Figure 2(A) shows the array layout for the four reference strains test. For detection of DNA mixSensitivity Comparison of SA-Magnetic Beads ture 1, the probes rfbE and OMPW which were designed with Dynal MyOne Streptavidin Beads for identification of Escherichia coli O157:H7 and VibApplication of Dynal MyOne streptavidin coated magnetic rio cholera showed unambiguously visible hybridization beads (Invitrogen Inc. Carlsbad, CA) as labels to be used results (Fig. 2(B)). After data analysis, the signal intensiin microarray detection has been reported.21 23 29 Howties of rfbE and OMPW were 8907 and 7865 (Fig. 2(D)) ever, the relatively lager size of MyOne beads (∼ 1 m) and the signal/noise ratio were 20.5 and 18.2, respectively. may affect the sensitivity of array detection. In this study, Similarly, both invA and ceuE also yielded viable sigwe compared the detection limit between our home-made Delivered by Publishing Rice University nal with intensities of 8645 and 6432 (Figs. 2(C), (E)), Technology SA-MNPsto:and Dynal MyOne beads. Various concentraIP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 and the signal/noise ratio were 15.6 andCopyright: 11.6, respectively. tions of biotinylated QC American Scientific Publishers probe (10 pmol/L, 1 pmol/L, 0.1 pmol/L, 0.01 pmol/L) instead of biotinylated asymAccording to the above criteria, they were all considered as metric PCR products being selected for hybridization positive. Furthermore, the microarray images that showed (A)
(B)
(D)
(C)
(E)
Figure 2. Multiple foodborne pathogens detection based on multiplex PCR and magnetic beads labelling technique. (A) The array layout for the four reference strains detection; (B) Escherichia coli O157:H7 (rfbE), and Vibrio cholera (OMPW); (C) Salmonella enterica (invA)and Campylobacter jejuni (ceuE); (D) The relative intensities of target rfbE and OMPW; (E) The relative intensities of target invA and ceuE. J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1257
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens (A)
(B)
Li et al.
(C)
Figure 3. Sensitivity comparison of SA-magnetic beads with Dyna MyOne beads. (A) The image generated by using SA-MNPs; (B) The image generated by using Dyno MyOne beads. (C) The relative intensities of SA-MNPs and Dyno MyOne beads.
with the QC detector on array and then home-made SAthe detection method of using home-made SA-MNPs as MNPs and Dynal MyOne beads were added separately to labels showed higher sensitivity than the Dynal MyOne compare the sensitivity between them. Figures 3(A), (B) beads. show the hybridization results imaged by CCD camera, all giving visual results at the concentration of Limit of Detection (LOD) Test 10 pmol/L, 1 pmol/L, and 0.1 pmol/L. When the To determine the analytical sensitivity of this method, biotinylated oligonucleotide concentration was decreased Salmonella enterica was selected as the target in evaluation to 0.01 pmol/L, the image detected by Dynal MyOne of sensitivity. The bacterial solution of Salmonella enterica beads (Fig. 3(B)) looked not as bright as that from homewas serially diluted from 106 CFU/mL to 102 CFU/mL in made SA-MNPs (Fig. 3(A)). Figure 3(C) shows the relturn (ten-fold each time). Each concentration was tested ative intensities of the signal on the array, the signal in 10 to: replicates assays. DNA extracted from the serial Delivered by Publishing Technology Rice University intensity from 0.01 pmol/L IP: oligonuclotide detected 154.48.196.142 On:by Wed,dilutions 04 Nov 2015 06:25:42 was used as the template for multiplex PCR American Publishers Dynal MyOne beads was only 943,Copyright: which is lower than Scientific amplification. PCR products derived from the series of the 1000 and can be considered as negative. On the contemplates were mixed with hybridization buffer and incutrary, the signal intensity from 0.01 pmol/L detected by bated on separate slides in parallel with the hybridization. SA-MNPS was 2354.1, which was considered as positive. The images were obtained by CCD camera and the intenPrevious research showed that the home-made SA-MNPs sities were generated by Image J. The Limit of Detection have average diameter of 36 nm. Compared with Dynal (LOD) was defined as the level at which 95% of the samMyOne beads of 1.0 m in diameter, the home-made SAples yielded a positive result and the LOD results of this MNPs have smaller size and larger specific surface area, test are summarized in Table II. Only relevant dilutions which means more SA-MNPs can deposit on an unit area (above and below the 95% LOD) are indicated. After calthan the MyOne beads. Furthermore, we have evaluated culation, the result indicates that the LOD of this method the binding capacity of biotin labeled oligonucleotieds on was 316 CFU/mL. the two kinds of streptavidin coated magnetic beads. The results showed that the home-made SA-MNPs are capaCONCLUSION ble of binding 7-fold higher biotinylated oligonucleotides Though there are various foodborne pathogens that have than Dynal MyOne beads (Data not shown). Therefore, been identified for food borne illnesses, Escherichia coli biotinylated oligonucleotides on the array bonded with O157:H7, Salmonella enterica, Vibrio cholera and Campymore SA-MNPs and allowed the home-made SA-MNPs to lobacter jejuni have been generally found to be responenhance the assay sensitivity for visual detection. Overall, sible for majority of foodborne outbreaks.7 35 This study has reported a simple, rapid, sensitive and cheap microarTable II. Limit of detection (LOD) of this method. ray assay for the simultaneous detection of four clinically important foodborne pathogens in visualized format invA based on magnetic bead labelling technique and multiplex The concentration of sample (CFU/ml) % (+) (%) PCR. Combined with high efficient PCR amplification, an 1 × 105 100 appropriate sensitivity can be achieved for the multiplexed 100 1 × 104 microarray detection. While the naked eye readout allows 3 1 × 10 100 an instant interpretation of the multiplex results, recording 2 90 1 × 10 and transmission of the results can be facilitated by the 1258
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
Li et al.
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens
12. B. Suo, Y. P. He, G. Paoli, A. Gehring, S. I. Tu, and X. M. Shi, Development of an oligonucleotide-based microarray to detect multiple foodborne pathogens. Mol. Cell. Probe. 24, 77 (2010). 13. D. Z. Jin, S. Y. Wen, S. H. Chen, F. Lin, and S. Q. Wang, Detection and identification of intestinal pathogens in clinical specimens using DNA microarrays. Mol. Cell. Probe. 20, 337 (2006). 14. S. C. De Keersmaecker, K. Marchal, T. L. Verhoeven, K. Engelen, J. Vanderleyden, and C. S. Detweiler, Microarray analysis and motif detection reveal new targets of the Salmonella enterica serovar Acknowledgment: This research was financially supTyphimurium HilA regulatory protein, including hilA itself. J. Bacported by the National Key Program for Developing teriol. 187, 4381 (2005). Basic Research of China (2010CB933903), the National 15. I. Abubakar, L. Irvine, C. F. Aldus, G. M. Wyatt, R. Fordham, S. Schelenz, L. Shepstone, A. Howe, M. Peck, and P. R. Hunter, Key Special Science Program (2013ZX10004103-002), A systematic review of the clinical, public health and costNSFC (60801007, 21205013, 61271056 and 60971045), effectiveness of rapid diagnostic tests for the detection and identifiHunan Science and Technology Projects (2012SK3105 cation of bacterial intestinal pathogens in faeces and food. Health. and 2010sk2003), Natural Science Foundation of Hunan Technol. Asses. 11, 36 (2007). Province (12JJ6060), Scientific Research Fund of Hunan 16. B. Liu, Y. Jia, M. Ma, Z. Li, H. Liu, S. Li, Y. Deng, L. Zhang, Z. Lu, W. Wang, and N. He, High throughput SNP detection system Provincial Education Department (11A030), China based on magnetic nanoparticles separation. J. Biomed. Nanotechnol. Postdoctoral Science Foundation (20100471362 and 9, 247 (2013). 2012M511660). 17. G. Xia, W. Gao, K. Ji, S. Liu, B. Wan, J. Luo, and Y. Bai, Single nucleotide polymorphisms analysis of noise-induced hearing loss using three-dimensional polyacrylamide gel-based microarray REFERENCES method. J. Biomed. Nanotechnol. 7, 807 (2011). 1. H. J. Kim, S. H. Park, T. H. Lee, B. H. Nahm, Y. R. Kim, and 18. S. Li, H. Liu, Y. Jia, Y. Deng, L. Zhang, Z. Lu, and N. He, A novel H. Y. Kim, Microarray detection of food-borne pathogens using speSNPs detection method based on gold magnetic nanoparticles array cific probes prepared by comparative genomics. Biosens. Bioelecand single base extension. Theranostics 2, 967 (2012). tron. 24, 238 (2008). 19. A. Bruchet, V. Dugas, I. Laszak, C. Mariet, F. Goutelard, and 2. V. Velusamy, K. Arshak, O. Korostynska, K. Oliwa, and C. Adley, J. Randon, Synthesis and characterization of ammonium functionalAn overview of foodborne pathogenDelivered detection: Inby the Publishing perspective of Technology ized porous poly(glycidyl methacrylate-co-ethylene dimethacrylate) to: Rice University biosensors. Biotechnol. Adv. 28, 232 (2010). monoliths for microscale analysis and its application to DNA purifiIP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 3. E. D. Boer and R. R. Beumer, MethodologyCopyright: for detection American and typcation. J.Publishers Biomed. Nanotechnol. 7, 415 (2011). Scientific ing of foodborne microorganisms. Int. J. Food. Microbiol. 50, 119 20. P. Prabhu and V. Patravale, The upcoming field of theranos(1999). tic nanomedicine: An overview. J. Biomed. Nanotechnol. 8, 859 4. E. C. Alocilja and S. M. Radke, Market analysis of biosensors for (2012). food safety. Biosens. Bioelectron. 18, 841 (2003). 21. N. LeBlanca, J. Gantelius, J. M. Schwenkc, K. Stahla, J. Blombergd, 5. K. G. Maciorowski, P. Herrera, F. T. Jones, S. D. Pillai, and S. C. H. Andersson-Svahnb, and S. Belaka, Development of a magnetic Ricke, Cultural and immunological detection methods for salmonella bead microarray for simultaneous and simple detection of four pesspp, in animal feeds—A review. Vet. Res. Commun. 30, 127 tiviruses. J. Virol. Methods 155, 1 (2009). (2006). 22. V. N. Morozov, S. Groves, M. J. Turell, and C. Bailey, Three 6. O. Lazcka, F. J. Del Campo, and F. X. Munoz, Pathogen detection: minutes-long electrophoretically assisted zeptomolar microfluidic A perspective of traditional methods and biosensors. Biosens. Bioimmunoassay with magnetic-beads detection. J. Am. Chem. Soc. electron. 22, 1205 (2007). 129, 12628 (2007). 7. Y. X. Wang, Z. Z. Ye, and Y. B. Ying, New trends in impedimet23. Y. M. Shlyapnikov, E. A. Shlyapnikova, T. Y. Morozova, I. P. ric biosensors for the detection of foodborne pathogenic bacteria. Beletsky, and V. N. Morozov, Detection of microarray-hybridized Sensors 12, 3449 (2012). oligonucleotides with magnetic beads. Anal. Biochem. 399, 125 8. L. L. C. Estevanato, L. M. Lacava, L. C. F. Carvalho, R. B. Azevedo, (2010). O. Silva, F. Pelegrini, S. N. Báo, P. C. Morais, and Z. G. M. 24. C. Li, C. Ma, F. Wang, Z. Xi, Z. Wang, Y. Deng, and N. He, PrepaLacava, Long-term biodistribution and biocompatibility investigation ration and biomedical applications of core–shell silica/magnetic of dextran-coated magnetite nanoparticle using mice as the animal nanoparticle composites. J. Nanosci. Nanotechnol. 12, 2964 (2012). model. J. Biomed. Nanotechnol. 8, 301 (2012). 25. R. Krishna, E. Titus, R. Krishna, N. Bardhan, D. Bahadur, and 9. N. He, F. Wang, C. Ma, C. Li, X. Zeng, Y. Deng, L. Zhang, J. Gracio, Wet-chemical green synthesis of L-lysine amino acid staand Z. Li, Chemiluminescence analysis for HBV-DNA hybridizabilized biocompatible iron-oxide magnetic nanoparticles. J. Nanosci. tion detection with magnetic nanoparticles based DNA extraction Nanotechnol. 12, 6645 (2012). from positive whole blood samples. J. Biomed. Nanotechnol. 9, 267 26. X. Li, F. Zhang, C. Ma, E. Saul, and N. He, Green synthesis of uni(2013). form magnetite (Fe3 O4 ) nanoparticles and micron cubes. J. Nanosci. 10. H. Sun, Q. H. Mo, J. C. Lin, Z. Yang, C. N. Tu, D. Y. Gu, L. Shi, and Nanotechnol. 12, 2939 (2012). W. P. Lu, Rapid simultaneous screening of seven clinically important 27. D. R. Baselt, G. U. Lee, M.Natesan, S. W. Metzger, P. E. Sheehan, enteric pathogens using a magnetic bead based DNA microarray. and R. J. Colton, A biosensor based on magnetoresistance technolWorld. J. Microb. Biot. 27, 163 (2011). ogy. Biosens. Bioelectron. 13, 731 (1998). 11. Y. Tang, Z. Li, N.He, L. Zhang, C. Ma, X. Li, C. Li, Z. Wang, 28. V. N. Morozov and T. Y. Morozova, Active bead-linked immunoasY. Deng, and L. He, Preparation of functional magnetic nanoparticles say on protein microarrays. Anal. Chim. Acta 564, 40 (2006). mediated with PEG-4000 and application in pseudomonas aerugi29. H. J. Qi, S. H. Chen, M. L. Zhang, H. Shi, and S. Q. nosa rapid detection. J. Biomed. Nanotechnol. 9, 312 (2013). Wang, DNA microarrays for visual detection of human pathogenic
aid of a commonly used CCD camera. Using home-made SA-MNPs, this approach may also present an attractive possibility from an economical point of view. With various attractive advantages and relatively low limit of detection (316 CFU/mL), this method shows great potential utilization for diagnosis of infectious diseases in both conventional laboratories and on-site observations.
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
1259
Development of a Magnetic Nanoparticles Microarray for Simultaneous and Simple Detection of Foodborne Pathogens microorganisms based on tyramine signal amplification coupled with gold label silver stain. Anal. Bioanal. Chem. 398, 2745 (2010). 30. F. Wang, C. Ma, X. Zeng, C. Li, Y. Deng, and N. He, Chemiluminescence molecular detection of sequence-specific HBV-DNA using magnetic nanoparticles. J. Biomed. Nanotechnol. 8, 786 (2012). 31. Q. He, L. Shao, J. Yu, S. Ji, H. Wang, Y. Mao, and J. Chen, Urinary proteome analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with magnetic beads for identifying the pathologic presentation of clinical early IgA nephropathy. J. Biomed. Nanotechnol. 8, 133 (2012).
Li et al.
32. M. Wang, J. Zhang, Z. Yuan, W. Yang, Q. Wu, and H. Gu, Targeted thrombolysis by using of magnetic mesoporous silica nanoparticles. J. Biomed. Nanotechnol. 8, 624 (2012). 33. H. N. Liu, S. Li, L. S. Liu, L.Tian, and N. Y. He, An integrated and sensitive detection platform for biosensing application based on Fe@Au magnetic nanoparticles as bead array carries. Biosens. Bioelectron. 26, 1442 (2010). 34. S. Chemburu, E. Wilkinsa, and I. Abdel-Hamidb, Detection of pathogenic bacteria in food samples using highly-dispersed carbon particles. Biosens. Bioelectron. 21, 491 (2005).
Delivered by Publishing Technology to: Rice University IP: 154.48.196.142 On: Wed, 04 Nov 2015 06:25:42 Copyright: American Scientific Publishers
1260
J. Biomed. Nanotechnol. 9, 1254–1260, 2013
