VIROLOGY
180,406-410
(1991)
Deletion
of 55 Open Reading Frames from the Termini
of Vaccinia Virus
MARION E. PERKUS, SCOTT J. GOEBEL, STEPHEN W. DAVIS, GERARD P. JOHNSON, ELIZABETH K. NORTON, AND ENZO PAOLETTI’ Virogenetics
Corporation,
465 Jordan Road, Rensselaer
Received July 25, 1990; accepted
Technology September
Park, Troy, New York 12180 27, 1990
Each copy of the inverted terminal repeat of vaccinia virus consists of 8 kb of DNA containing 9 ORFS flanked near the terminus of the genome by 4 kb of repetitive DNA which in turn contains blocks of tandem repeats. Using plasmids containing repetitive DNA as the external arm, we have generated deletions at both the left and the right termini of the vaccinia genome. We report here the engineered deletion within a single vaccinia virus of 32.7 kb of DNA (including 38 ORFS) from the left terminus and 14.9 kb of DNA (including 17 ORFS) from the right terminus. o 1991 Academic press, IW.
Restriction enzyme analysis of representative strains of orthopoxviruses (I) revealed a central region of the genome which was highly conserved and terminal regions with considerable variation. These data suggested that genetic information essential for virus replication was located internally, within the central region of the genome, whereas genetic elements specifying functions ancillary to virus replication such as host and tissue tropisms were localized at the termini. Deletions in the terminal regions have been described for vaccinia (2-7) rabbitpox (8, 9), cowpox (10, 1 I), and monkeypox (12). Transposition of deleted sequences have been noted in cowpox (IO), rabbitpox (8) monkeypox (12), and vaccinia (7). Recently we have reported the engineered deletion of 21.7 kbp towards the left end of the (WR) vaccinia genome (13). The double-stranded DNA genome of vaccinia virus is cross-linked by an incompletely base-paired terminal loop (14). Internal to the terminal loop are tandem repeats. A cloned version of the (WR) vaccinia genome was shown to contain 13 tandem copies of a 70-bp repeat unit separated by 435 bp of nonrepetitive DNA from an additional block of 17 tandem repeats of the 70-bp unit (15). The terminal loop and repetitive DNA form the distal portions of the vaccinia inverted terminal repetition. The inverted terminal repetition of approximately 10 kbp for WR (16) and 12 kbp for the Copenhagen strain (17) contains a number of genes repeated in both left and right copies of the inverted terminal repeat. In an ongoing project to define the minimal number of essential virus genes, we have derived deletions of DNA at the right and left termini of the vaccinia ge-
’ To whom requests for reprints should be addressed. 283-0936. 0042.6822/91
$3.00
Copyright 0 1991 by Academic Press. Inc. All rights of reproduction in any form reserved.
nome. We report here the engineered deletion within a single vaccinia virus (Copenhagen strain) of 32.7 kbp of DNA (including 38 ORFS) from the left terminus and 14.9 kbp of DNA (including 17 ORFS) from the right. Vaccinia contains two human host range genes, Kl L, (78) and C7L (19), see Ref. (( 17) for terminology). Deletion of both Kl L and C7L abrogates the ability of vaccinia to plaque on human MRC-5 cells. We decided to take advantage of this host restriction as a selection for generating extensive deletions in the vaccinia genome, particularly near the termini. Vaccinia deletion mutant vP668, which is deleted for 12 ORFS C7L through Kl L (nt 18,805-29,108) (17) does not plaque on MRC-5 cells (unpublished data). In contrast, vaccinia deletion mutant vP681, which is deleted for 11 ORFs, CGLthrough Kl L(nt 19,457-29,108) but retains the human host range gene C7L, does plaque on MRC-5 cells. The extent of deletions in vP668 and vP681 is indicated schematically in Fig. 1. In the course of a project unrelated to the work described here, we developed a series of vaccinia deletion plasmids (COPCS) which utilize the C7L human host range gene as a selectable marker in the generation of vaccinia recombinants (unpublished). Members of the COPCS series contain a left vaccinia arm consisting of 0.7 kb of DNA derived from HindIll C immediately to the left of C6L (I 7). The right vaccinia arm in COPCS plasmids consists of 0.7 kb of DNA derived from Hindlll K immediately to the right of Kl L (17). Since the left arm contains the C7L human host range gene, in vivo recombination between a COPCS plasmid and vP668 results in a recombinant vaccinia virus capable of growth on MRC-5 cells. In plasmid pCOPCS-4, the two vaccinia arms are separated by a polylinker region including a Bglll site. To test whether the 10 ORFs immediately to the right of Kl L were essential for vaccinia growth, the deletion
FAX 518.
406
SHORT COMMUNICATIONS C
HidIll q
NMK
F
EPOIGLJH ---.
I
---__-
I- -em_“______ ?L:J-!%!“:h
D
B
A , :
I I
B 1: : _--___-___
VP668 VP681 VP749 VP759 VP774 VP796 vP811 FIG. 1. Vaccinia virus deletion mutants. The HindIll map of wildtype vaccinia is indicated on the top line. Repetitive DNA at the termini of the genome is indicated by solid boxes. The regions of DNA near the left and right termini encompassing various engineered deletions are expanded (dashed lines). Extent of deletions present in vaccinia deletion mutants are indicated by solid bars. Generation of vaccinia deletion mutants is described in the text.
in pCOPCS-4 was expanded to the right. In the resulting plasmid, pMPCTFRA, (Fig. 2) the rightmost ORF deleted, F4L, encodes the small subunit of ribonucleotide reductase (20). pMPCTFRA was constructed by replacing the vaccinia HindIll K right flanking arm in pCOPCS-4 by a right flanking arm derived from vaccinia HindIll F as follows. Plasmid pSD521, a pUC derivative containing vaccinia sequences from the HindIll K/F junction through the unique BamHl site in HindIll F, was digested with C/al upstream from the F4L coding sequences and with Bglll within the F4L ORF. Synthetic oligonucleotides MPSYN256 (5’ CGATGTACAAAAAATCCAAGTACAGGCATATAGATAACTGA 3’) and MPSYN257 (5’ GATCTCAGTTATCTATATGCCTGTACTTGGATTTTTTGTACAT 3’) were annealed and ligated between the C/al and f3g/ll sites in pSD521. In the resulting plasmid, pMP256/257, the region upstream from ORF F4L is recreated and linked to a f3g/lI site. To obtain a right vaccinia flanking arm for use in the construction of a deletion plasmid, pMP256/ 257 was digested with Bglll and EcoRl and the 2.3-kb fragment containing vaccinia sequences upstream from the F4L gene was isolated. The vaccinia arm derived from HindIll K was removed from pCOPCS-4 by digestion with Bg/lI and EcoRI. The 3.5-kb Bglll-EcoRl vector fragment from pCOPCS-4 was ligated with the 2.3-kb fragment containing the right arm from HindIll F. The resulting plasmid, pMPCTFRA (Fig. 2) contains a left vaccinia arm from HindIll C including ORF C7L and an additional 170 bp of vaccinia DNA to the left and a right vaccinia arm from HindIll F flanking a deletion of 21 ORFS (ORFS C6L-F4L). pMPCTFRA was used as donor plasmid for in vivo recombination with vaccinia virus vP668 and recombinant virus selected by plaquing on MRC-5 cells. Viable vaccinia virus progeny, vP749, was isolated, indicating that the 21 genes en-
407
coded by ORFS C6L through F4L are not essential for virus replication in vitro. To delete all ORFS from the left end of the genome up to and including ORF F4L, plasmid pMPLENDA was constructed (Fig. 2). A right flanking arm from Hindlll F was obtained from pMPCTFRA (Fig. 2). The left arm for deletion plasmid pMPLENDA was obtained by cloning the terminal Xhol fragment from vaccinia virus as follows.
Arm from Hindlll F
vP452
Arm from Hind III B
CM Hindlll MPSYN2611262
I
( pMPVCEND
j
i
LEFT DELETION PLASMID
DMPRENDA
\I
RIGHT DELETION PLASMID
FIG. 2. Construction of plasmids for the generation of large deletions near the termini of the vaccinia genome. The terminal Xhol fragment of vaccinia virus vP452 (21) was isolated and cloned into pUC8 as described in the text, generating pSD522. pSD522 was digested with C/al and HindIll and ligated with annealed synthetic oligonucleotides MPSYNPGl/MPSYN262 (sequence in text) generating pMPVCEND. pMPVCEND was digested with Hindlll, blunt ended with Klenow fragment of E. co/i polymerase, and digested with Bglll. The resulting vector fragment was used in the construction of plasmids for the deletion of sequences near both vaccinia termini. The construction of pMPCTFRA is described in the text. A vaccinia arm from /-/indIll F was isolated as a SmallBgllI fragment from pMPCTFRA. This fragment was ligated with the vector fragment from pMPVCEND, generating the left deletion plasmid, pMPLENDA. The construction of pSD478 is described in the text. A vaccinia arm from HindIll B was isolated as an EcoRl (Klenow)/Bg/ll fragment from pSD478. This fragment was ligated with the vector fragment from pMPVCEND, generating the right deletion plasmid, pMPRENDA. Code: solid arc, repetitive vaccinia DNA containing tandem repeats; open arc, nonrepetitive vaccinia DNA; A, site of deletion.
408
SHORT COMMUNICATIONS
Since it has been reported (16) that the heterogeneity of the vaccinia genomic termini can be eliminated by viral plaque cloning, we isolated the terminal Xhol fragment from a plaque-cloned vaccinia recombinant, vP452. vP452 has been deleted of the thymidine kinase and hemagglutinin genes (21) and contains discrete genomic termini. DNA was extracted from vP452 and digested with Xhol and the two-molar 7-kbp band isolated from an agarose gel. Isolated fragment was digested with Bal-31 exonuclease, blunt-ended with the Klenow fragment of E.co/i polymerase, and inserted into the Smal site of pUC8, producing pSD522 (Fig. 2). DNA sequence analysis of pSD522 derivatives indicated that the terminal 4.3 kb of the vaccinia genome consisted mainly of repetitive DNA organized into two blocks of tandem repeat units, For the complete DNA sequence of the vaccinia virus Copenhagen strain, see Ref. (17). To generate a plasmid containing vaccinia repetitive DNA but devoid of vaccinia coding sequence, pSD522 was digested with C/al and HindIll and a 7-kbp vector fragment isolated. Synthetic oligonucleotides MPSYN261 (5’ CGATTCAGACACACGCTTTGAGTl-TTGTTGAATCGAGATCTA 3’) and MPSYN262 (5’ AGCTTAGATCTCGATTCAACAAAACTCAAAGCGTGTGTCTGAAT 3’) were annealed and ligated into the pSD522 vector fragment generating pMPVCEND (Fig. 2). pMPVCEND contains vaccinia DNA beginning 128 bases from the end of the vaccinia genome through both blocks of tandem repeats ending at the C/al site at nt 4301 (17). A small ORF (nt 4256-4298) which crossed the C/al site at nt 4268 (I 7) was reconstructed in the synthetic oligonucleotides MPSYN261/ MPSYN262, which also introduced a Bglll site for ease of future cloning steps. pMPVCEND was used as the plasmid vector, providing the external arm for the construction of plasmids designed to delete coding sequences from both termini of vaccinia (Fig. 2 and below) To construct pMPLENDA, the left terminus deletion plasmid, a right flanking arm from HindIll F was obtained from pMPCTFRA by digestion with Smal at the pUC/vaccinia junction and with f?g/ll at the vaccinia deletion site and a 2.3-kbp fragment isolated (Fig. 2). pMPVCEND was digested with Hindlll, blunt-ended with Klenow fragment of E. co/i polymerase, and cut with Bglll. The two fragments were ligated generating pMPLENDA (Fig. 2). In pMPLENDA the left vaccinia arm is composed of the tandem repeat units, the right vaccinia arm is derived from HindIll F, and the leftmost 38 ORFS of vaccinia (C23L through F4L) are deleted. Sequence analysis (17) and comparison of the left and right termini of vaccinia indicated that the left copy of the terminal repetition extended to nt 12,068. Nt
12,068 (in Hindlll C) is equivalent to nt 179,669 in HindIll B, 12,068 nucleotides from the right end of the genome (17). The leftmost nine ORFS in Hindlll C (C23L through Cl 5L) correspond to the rightmost nine ORFS in HindIll B (B29R through B21 R) (17). To delete genes near the right terminus up to and including the hemorrhagic (p) region (ORFS B13R and B14R) (17) plasmid pMPRENDA was constructed (Fig. 2). An /Vcoll/Vrul fragment from HindIll B containing the CLregion (ORFS B13R and B14R) was cloned into a pUC vector, generating pSD477. Plasmid pSD478 contains a multiple cloning region including a Bglll site replacing the entire I* region (nt 172,550-173,550) in pSD477. To accomplish this a duplex composed of annealed synthetic oligonucleotides SD41 mer (5’ CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3’) and SD39mer (5’ AACGGATCCCTCGAGCCCGGGGAGCTCAGATCTAGTAAT 3’) was utilized. To obtain a flanking vaccinia arm to the left of the p region, pSD478 was digested at the pUC/vaccinia junction with EcoRI, blunt-ended with Klenow fragment of E. co/i polymerase, and further digested with Bglll. A 0.3-kb fragment leftward of the p coding sequences was isolated and ligated with a vector fragment obtained by cutting pMPVCEND with Hindlll, blunt-ending with Klenow fragment, and digesting with Bglll (Fig. 2). In the resulting plasmid, pMPRENDA, the left vaccinia arm contains DNA sequences upstream from the B13R p ORF including the promoter region. The right vaccinia arm consists of tandem repeats equivalent to those present in pMPLENDA. The vaccinia arms in pMPRENDAflank a deletion of 17 ORFS (B13R through B29R; 14,873 bd (17). To generate the terminal deletions in the vaccinia genome we took advantage of two selection systems: the first utilizes the vaccinia host range gene, C7L (19) with selection of progeny virus on human MRC-5 cells as was used in the generation of VP749 (C6L-F4L deletion); the second utilizes the E. co/i gene encoding guanine phosphoribosyl transferase with selection of recombinant vaccinia progeny using mycophenolic acid (22, 23). A 660-bp BgllllBamHI fragment containing the C7L host range gene and its endogenous promoter (19) was inserted into pMPLENDA and into pMPRENDA. A 670-bp BgllIIBamHI fragment containing the Ecogpt gene was derived from pSV2gpt (ATCC #37145) (24) by the addition of a BarnHI linker at the Ahalll site downstream from the coding sequences (25). The BgllIIBamHI fragments containing either the C7L host range gene or the Ecogpt gene were inserted into Bglll-digested pMPLENDA or pMPRENDA, producing a total of four plasmids (Table 1A). In both pMPLAC7 and pMPRAC7 the C7L host range gene is under the control of its own endogenous promoter,
SHORT COMMUNICATIONS
409
TABLE 1 A. CONSTRUCTIONOF PLASMIDSFOR DELETIONSNEARCOPENHAGENTERMINI Plasmid substrate
Selectable
pMPLENDA pMPLENDA pMPRENDA pMPRENDA
marker
C7L Ecogpt C7L Ecogpt
Plasmid product
Deletion
pMPLAC7 PMPLwt pMPRAC7 PMPRgpt
C23L-F4L C23L-F4L B13R-B29R Bl3R-B29R
B. IN VIVO RECOMBINATIONSUSING DELETIONPLASMIDSWITH COPENHAGENVACCINIA VIRUS
vP668 (TK-, [C7L-Kl L]-) vP668 (TK-, [C7L-Kl LJ-) vP617 (TK-, ATI-, HA-) vP723 (TK-, ATI-, HA-, p-) VP796 (TK-, ATI-, HA-, [C23L-F4L]-, fcogpt+)
Vaccinia deletion mutant
Plasmid
Rescuing virus pMPLAC7 pMPRAC7 pMPRgpt pMPLgpt pMPRAC7
whereas the Ecogpt gene is under the control of the F4L promoter in pMPLgpt or the B13R h promoter (17) in pMPRgpt. Vaccinia virus progeny derived from in vivo recombination using donor plasmid containing the C7L host range function were selected by plating on MRC-5 cells, whereas progeny obtained by insertion of the Ecogpt gene were obtained by selection on VERO cells in the presence of mycophenolic acid (Table 1 B). As shown in Table 1 B, the 32.7-kb left terminal deletion [C23L-F4L] is contained in vaccinia recombinants VP789 and vP796. This indicates that single copy genes C14L through C8L are nonessential. (Single copy genes C7L through F4L were tested previously, Fig. 1). The 14.9-kb right terminal deletion [B13RB29R] is contained in vaccinia recombiants vP774 and vP759, indicating that single copy genes B13R-B20R are nonessential. vP81 1 contains both left and right deletions combined in a single vaccinia recombinant, demonstrating that all genes in the terminal redundancy are nonessential for virus growth. The extents of the terminal deletions are shown schematically in Fig. 1. The y deletion in rescuing virus vP723 is equivalent to the p deletion in plasmid pSD478 (Fig. 2). The TK, HA, and ATI deletions equivalent to those present in vP617 and vP723 have been previously described (19, 21). Figure 3B shows the HindIll restriction pattern of deletion mutants VP759 (right end deletion, lane 2), VP796 (left end deletion, lane 4), and vP81 1 (left and right end deletions, lane 3) compared to control virus vP723 (lane 1). Figure 3A shows an autoradiogram of the same gel probed with a mixture of vaccinia sequences from the deleted regions. The radiolabeled
([C23L-F4L]-, C7L+) ([Bi 3R-B29R]-, C7L+) ([B13R-B29R]-, Ecogpt+) ([C23L-F4L]-. Ecogpt+) ([B13R-B29R]-,
C7L+)
VP789 VP774 VP759 VP796 vp811
probe includes the entire Hindlll K, M, and N fragments plus portions of HindIll C, F, and B. Probe from the left end deleted region (HindIll, C, F, K, M, and N) hybridizes to the appropriate bands in the control virus, vP723 (lane 1) and VP759 (right end deletion, lane 2) but not to vP81 1 (left plus right end deletions, lane 3) or VP796 (left end deletion, lane 4). Probe from the right end deleted region (HindIll B) hybridizes to the HindIll B band in vP723 (lane 1) and VP796 (left end deletion, lane 4) but does not hybridize to VP759 (right end deletion, lane 2) or vP81 1 (left and right end deletions, lane 3) as expected. Figure 3C shows an autoradiogram of the same gel probed with labeled repetitive vaccinia DNA derived from the terminus (pMPVCEND). As expected, the HindIll C left terminal fragment in vP723 (lane 1) and VP759 (lane 2) is replaced by a smaller terminal fragment in deletion mutants VP796 (left end deletion, lane 4) and vP81 1 (left and right end deletions, lane 3). Similarly, the HindIll B right terminal fragment in vP723 (lane 1) and VP796 (lane 4) is replaced by a smaller terminal fragment in VP759 (right end deletion, lane 2) and vP81 1 (left and right end deletion lane 3). Confirmation of the precision of the deletions was obtained by PCR analysis and DNA sequence analysis of the deletion junctions (data not presented). The results reported above demonstrate that significant stretches of DNA in both right and left termini of the vaccinia genome contain information that is not essential for replication of the virus in tissue culture. Elimination of these sequences should provide a genetically stabilized genome since rearrangement of the nonessential DNA deleted from the termini is no longer possible. Furthermore, as suggested by other studies (26, Messer et al., unpublished) deletion of these se-
410
SHORT COMMUNICATIONS
A 1234
B 1234
C
REFERENCES
1234
,B -C -term
FIG. 3. Southern blot hybridization analysis of vaccinia deletion mutants. DNA from recombinant vaccinia virus was digested with HindIll and electrophoresed in duplicate sets on an agarose gel. DNA was transferred to Hybond-N membrane (Amersham, Arlington Heights, IL). Lane 1, vP723; lane 2, vP759; lane 3, vP811; lane 4, vP796. (A) One blot was probed with a mixture of 32P-labeled vaccinia DNA from the deleted regions (fragments HindIll N, M, and K and portions of /iindlll C, F, and B). An autoradiogram is shown. (B) The agarose gel was stained with ethidium bromide and DNAvisualized by long-wave ultraviolet light. (C)The duplicate blot was probed with 3”P-labeled fragment from pMPVCEND, containing repetitive DNA derived from the vaccinia terminus. An autoradiogram is shown.
quences should result in further attenuated vaccinia viruses useful as vectors for recombinant vaccines. ACKNOWLEDGMENTS This study was supported in part by US. Army Support Contract DAMD17-85-C-5232. We thank K. Dombrowski for typing the manuscript.
1. MACKETT, M., and ARCHARD. L. C., /. Gen Viral. 45, 683-701 (1979). 2. PANICALI, D., DAVIS, S. W., MERGER. S. R., and PAOLET~I, E., 1. Viral. 37, 1000-1010 (1981). 3. Moss, B., WINTERS, E., and COOPER, J. A., /. Viral. 40, 387-395 (1981). 4. DRILLIEN, R., KOEHREN. F., and KIRN, A., Virology 111, 488-499 (1981). 5. PAEZ, E., DALLO, S., and ESTEBAN,M., froc. Nat/. Acad. Sci. USA 82, 3365-3369 (1985). 6. PERKUS,M. E., PANICALI, D., MERCER, S., and PAOLEITI, E., Viralogy152,285-297(1986). 7. KOTWAL, G. J., and Moss, B., Virology 167, 524-537 (1988). 8. MOYER, R. W., and ROTHE, C. T., Virology 102, 119-l 32 (1980). 9. LAKE, J. R., and COOPER, P. D., /. Gen. Viral. 48, 135-l 47 (1980). 10. PICKUP, D., INK, B. S., PARSONS,B. L.. Hu, W., and JOKLIK,W. K., hoc. Nat/. Acad. Sci. USA 81, 6817-6821 (1984). 11. ARCHARD, L. C., and MACKETT, M., /. Gen. Viral. 45, 51.-63 (1979). 12. ESPOSITO,J. J., CABRADILLA, C. D., NAKANO, I. H., and OBIJESKI, J. F., Virology 109, 231-243 (1981). 73. PERKUS,M. E.. LIMBACH, K., and PAOLE~I, E., /. Viol. 63, 38293836 (1989). 14. BAROUDY, B. M., VENKATESAN, S., and Moss, B., Cell 28, 315324 (1982). 15. WITTEK, R.. and Moss, B., Cell 21, 277-284 (1980). 16. WIITEK, R., MULLER, H. K., MENNA, A., and WYLER, R., FfBS Left. 90, 41-46 (1978). 17. GOEBEL, S. J., JOHNSON,G. P., PERKUS,M. E., DAVIS, S. W., WINSLOW, J. P., and PAOLEITI, E., Virology 179, 247-266 (1990). 18. GILLARD, S., SPEHNER, D.. DRILLIEN, R.. and KIRN, A., Proc. Nat/. Acad. Sci. USA 83, 5573-5577 (1986). 19. PERKUS,M. E., GOEBEL, S. J., DAVIS, S. W., JOHNSON,G. P., NORTON, E. K., and PAOLETTI, E., Vkology 179, 276-286 (1990). 20. SLABAUGH,M., ROSEMAN, N., DAVIS, R., and MATHEWS, C.,/. Viral. 62, 519-527 (1988). 21. Guo, P., GOEBEL, S., DAVIS, S., PERKUS,M. E., LANGUET, B., DESMETTRE, P., ALLEN, G., and PAOLETTI, E., J. Viral. 63, 41894198 (1989). 22. BOYLE, D. B., and COUPAR. B. E. H., Gene 65, 123-128 (1988). 23. FALKNER, F. G., and Moss, B., 1. Viral. 62, 1849-1854 (1988). 24. MULLIGAN, R. C.. and BERG, P.. Science 209, 1422-l 427 (1980). 25. PRATT, D., and SUBRAMANI, S., Nucleic Acids Res. 11, 88178823 (1983). 26. DALLO, S.. and ESTEBAN, M., Virology 156, 408-422 (1987).
180,406-410
(1991)
Deletion
of 55 Open Reading Frames from the Termini
of Vaccinia Virus
MARION E. PERKUS, SCOTT J. GOEBEL, STEPHEN W. DAVIS, GERARD P. JOHNSON, ELIZABETH K. NORTON, AND ENZO PAOLETTI’ Virogenetics
Corporation,
465 Jordan Road, Rensselaer
Received July 25, 1990; accepted
Technology September
Park, Troy, New York 12180 27, 1990
Each copy of the inverted terminal repeat of vaccinia virus consists of 8 kb of DNA containing 9 ORFS flanked near the terminus of the genome by 4 kb of repetitive DNA which in turn contains blocks of tandem repeats. Using plasmids containing repetitive DNA as the external arm, we have generated deletions at both the left and the right termini of the vaccinia genome. We report here the engineered deletion within a single vaccinia virus of 32.7 kb of DNA (including 38 ORFS) from the left terminus and 14.9 kb of DNA (including 17 ORFS) from the right terminus. o 1991 Academic press, IW.
Restriction enzyme analysis of representative strains of orthopoxviruses (I) revealed a central region of the genome which was highly conserved and terminal regions with considerable variation. These data suggested that genetic information essential for virus replication was located internally, within the central region of the genome, whereas genetic elements specifying functions ancillary to virus replication such as host and tissue tropisms were localized at the termini. Deletions in the terminal regions have been described for vaccinia (2-7) rabbitpox (8, 9), cowpox (10, 1 I), and monkeypox (12). Transposition of deleted sequences have been noted in cowpox (IO), rabbitpox (8) monkeypox (12), and vaccinia (7). Recently we have reported the engineered deletion of 21.7 kbp towards the left end of the (WR) vaccinia genome (13). The double-stranded DNA genome of vaccinia virus is cross-linked by an incompletely base-paired terminal loop (14). Internal to the terminal loop are tandem repeats. A cloned version of the (WR) vaccinia genome was shown to contain 13 tandem copies of a 70-bp repeat unit separated by 435 bp of nonrepetitive DNA from an additional block of 17 tandem repeats of the 70-bp unit (15). The terminal loop and repetitive DNA form the distal portions of the vaccinia inverted terminal repetition. The inverted terminal repetition of approximately 10 kbp for WR (16) and 12 kbp for the Copenhagen strain (17) contains a number of genes repeated in both left and right copies of the inverted terminal repeat. In an ongoing project to define the minimal number of essential virus genes, we have derived deletions of DNA at the right and left termini of the vaccinia ge-
’ To whom requests for reprints should be addressed. 283-0936. 0042.6822/91
$3.00
Copyright 0 1991 by Academic Press. Inc. All rights of reproduction in any form reserved.
nome. We report here the engineered deletion within a single vaccinia virus (Copenhagen strain) of 32.7 kbp of DNA (including 38 ORFS) from the left terminus and 14.9 kbp of DNA (including 17 ORFS) from the right. Vaccinia contains two human host range genes, Kl L, (78) and C7L (19), see Ref. (( 17) for terminology). Deletion of both Kl L and C7L abrogates the ability of vaccinia to plaque on human MRC-5 cells. We decided to take advantage of this host restriction as a selection for generating extensive deletions in the vaccinia genome, particularly near the termini. Vaccinia deletion mutant vP668, which is deleted for 12 ORFS C7L through Kl L (nt 18,805-29,108) (17) does not plaque on MRC-5 cells (unpublished data). In contrast, vaccinia deletion mutant vP681, which is deleted for 11 ORFs, CGLthrough Kl L(nt 19,457-29,108) but retains the human host range gene C7L, does plaque on MRC-5 cells. The extent of deletions in vP668 and vP681 is indicated schematically in Fig. 1. In the course of a project unrelated to the work described here, we developed a series of vaccinia deletion plasmids (COPCS) which utilize the C7L human host range gene as a selectable marker in the generation of vaccinia recombinants (unpublished). Members of the COPCS series contain a left vaccinia arm consisting of 0.7 kb of DNA derived from HindIll C immediately to the left of C6L (I 7). The right vaccinia arm in COPCS plasmids consists of 0.7 kb of DNA derived from Hindlll K immediately to the right of Kl L (17). Since the left arm contains the C7L human host range gene, in vivo recombination between a COPCS plasmid and vP668 results in a recombinant vaccinia virus capable of growth on MRC-5 cells. In plasmid pCOPCS-4, the two vaccinia arms are separated by a polylinker region including a Bglll site. To test whether the 10 ORFs immediately to the right of Kl L were essential for vaccinia growth, the deletion
FAX 518.
406
SHORT COMMUNICATIONS C
HidIll q
NMK
F
EPOIGLJH ---.
I
---__-
I- -em_“______ ?L:J-!%!“:h
D
B
A , :
I I
B 1: : _--___-___
VP668 VP681 VP749 VP759 VP774 VP796 vP811 FIG. 1. Vaccinia virus deletion mutants. The HindIll map of wildtype vaccinia is indicated on the top line. Repetitive DNA at the termini of the genome is indicated by solid boxes. The regions of DNA near the left and right termini encompassing various engineered deletions are expanded (dashed lines). Extent of deletions present in vaccinia deletion mutants are indicated by solid bars. Generation of vaccinia deletion mutants is described in the text.
in pCOPCS-4 was expanded to the right. In the resulting plasmid, pMPCTFRA, (Fig. 2) the rightmost ORF deleted, F4L, encodes the small subunit of ribonucleotide reductase (20). pMPCTFRA was constructed by replacing the vaccinia HindIll K right flanking arm in pCOPCS-4 by a right flanking arm derived from vaccinia HindIll F as follows. Plasmid pSD521, a pUC derivative containing vaccinia sequences from the HindIll K/F junction through the unique BamHl site in HindIll F, was digested with C/al upstream from the F4L coding sequences and with Bglll within the F4L ORF. Synthetic oligonucleotides MPSYN256 (5’ CGATGTACAAAAAATCCAAGTACAGGCATATAGATAACTGA 3’) and MPSYN257 (5’ GATCTCAGTTATCTATATGCCTGTACTTGGATTTTTTGTACAT 3’) were annealed and ligated between the C/al and f3g/ll sites in pSD521. In the resulting plasmid, pMP256/257, the region upstream from ORF F4L is recreated and linked to a f3g/lI site. To obtain a right vaccinia flanking arm for use in the construction of a deletion plasmid, pMP256/ 257 was digested with Bglll and EcoRl and the 2.3-kb fragment containing vaccinia sequences upstream from the F4L gene was isolated. The vaccinia arm derived from HindIll K was removed from pCOPCS-4 by digestion with Bg/lI and EcoRI. The 3.5-kb Bglll-EcoRl vector fragment from pCOPCS-4 was ligated with the 2.3-kb fragment containing the right arm from HindIll F. The resulting plasmid, pMPCTFRA (Fig. 2) contains a left vaccinia arm from HindIll C including ORF C7L and an additional 170 bp of vaccinia DNA to the left and a right vaccinia arm from HindIll F flanking a deletion of 21 ORFS (ORFS C6L-F4L). pMPCTFRA was used as donor plasmid for in vivo recombination with vaccinia virus vP668 and recombinant virus selected by plaquing on MRC-5 cells. Viable vaccinia virus progeny, vP749, was isolated, indicating that the 21 genes en-
407
coded by ORFS C6L through F4L are not essential for virus replication in vitro. To delete all ORFS from the left end of the genome up to and including ORF F4L, plasmid pMPLENDA was constructed (Fig. 2). A right flanking arm from Hindlll F was obtained from pMPCTFRA (Fig. 2). The left arm for deletion plasmid pMPLENDA was obtained by cloning the terminal Xhol fragment from vaccinia virus as follows.
Arm from Hindlll F
vP452
Arm from Hind III B
CM Hindlll MPSYN2611262
I
( pMPVCEND
j
i
LEFT DELETION PLASMID
DMPRENDA
\I
RIGHT DELETION PLASMID
FIG. 2. Construction of plasmids for the generation of large deletions near the termini of the vaccinia genome. The terminal Xhol fragment of vaccinia virus vP452 (21) was isolated and cloned into pUC8 as described in the text, generating pSD522. pSD522 was digested with C/al and HindIll and ligated with annealed synthetic oligonucleotides MPSYNPGl/MPSYN262 (sequence in text) generating pMPVCEND. pMPVCEND was digested with Hindlll, blunt ended with Klenow fragment of E. co/i polymerase, and digested with Bglll. The resulting vector fragment was used in the construction of plasmids for the deletion of sequences near both vaccinia termini. The construction of pMPCTFRA is described in the text. A vaccinia arm from /-/indIll F was isolated as a SmallBgllI fragment from pMPCTFRA. This fragment was ligated with the vector fragment from pMPVCEND, generating the left deletion plasmid, pMPLENDA. The construction of pSD478 is described in the text. A vaccinia arm from HindIll B was isolated as an EcoRl (Klenow)/Bg/ll fragment from pSD478. This fragment was ligated with the vector fragment from pMPVCEND, generating the right deletion plasmid, pMPRENDA. Code: solid arc, repetitive vaccinia DNA containing tandem repeats; open arc, nonrepetitive vaccinia DNA; A, site of deletion.
408
SHORT COMMUNICATIONS
Since it has been reported (16) that the heterogeneity of the vaccinia genomic termini can be eliminated by viral plaque cloning, we isolated the terminal Xhol fragment from a plaque-cloned vaccinia recombinant, vP452. vP452 has been deleted of the thymidine kinase and hemagglutinin genes (21) and contains discrete genomic termini. DNA was extracted from vP452 and digested with Xhol and the two-molar 7-kbp band isolated from an agarose gel. Isolated fragment was digested with Bal-31 exonuclease, blunt-ended with the Klenow fragment of E.co/i polymerase, and inserted into the Smal site of pUC8, producing pSD522 (Fig. 2). DNA sequence analysis of pSD522 derivatives indicated that the terminal 4.3 kb of the vaccinia genome consisted mainly of repetitive DNA organized into two blocks of tandem repeat units, For the complete DNA sequence of the vaccinia virus Copenhagen strain, see Ref. (17). To generate a plasmid containing vaccinia repetitive DNA but devoid of vaccinia coding sequence, pSD522 was digested with C/al and HindIll and a 7-kbp vector fragment isolated. Synthetic oligonucleotides MPSYN261 (5’ CGATTCAGACACACGCTTTGAGTl-TTGTTGAATCGAGATCTA 3’) and MPSYN262 (5’ AGCTTAGATCTCGATTCAACAAAACTCAAAGCGTGTGTCTGAAT 3’) were annealed and ligated into the pSD522 vector fragment generating pMPVCEND (Fig. 2). pMPVCEND contains vaccinia DNA beginning 128 bases from the end of the vaccinia genome through both blocks of tandem repeats ending at the C/al site at nt 4301 (17). A small ORF (nt 4256-4298) which crossed the C/al site at nt 4268 (I 7) was reconstructed in the synthetic oligonucleotides MPSYN261/ MPSYN262, which also introduced a Bglll site for ease of future cloning steps. pMPVCEND was used as the plasmid vector, providing the external arm for the construction of plasmids designed to delete coding sequences from both termini of vaccinia (Fig. 2 and below) To construct pMPLENDA, the left terminus deletion plasmid, a right flanking arm from HindIll F was obtained from pMPCTFRA by digestion with Smal at the pUC/vaccinia junction and with f?g/ll at the vaccinia deletion site and a 2.3-kbp fragment isolated (Fig. 2). pMPVCEND was digested with Hindlll, blunt-ended with Klenow fragment of E. co/i polymerase, and cut with Bglll. The two fragments were ligated generating pMPLENDA (Fig. 2). In pMPLENDA the left vaccinia arm is composed of the tandem repeat units, the right vaccinia arm is derived from HindIll F, and the leftmost 38 ORFS of vaccinia (C23L through F4L) are deleted. Sequence analysis (17) and comparison of the left and right termini of vaccinia indicated that the left copy of the terminal repetition extended to nt 12,068. Nt
12,068 (in Hindlll C) is equivalent to nt 179,669 in HindIll B, 12,068 nucleotides from the right end of the genome (17). The leftmost nine ORFS in Hindlll C (C23L through Cl 5L) correspond to the rightmost nine ORFS in HindIll B (B29R through B21 R) (17). To delete genes near the right terminus up to and including the hemorrhagic (p) region (ORFS B13R and B14R) (17) plasmid pMPRENDA was constructed (Fig. 2). An /Vcoll/Vrul fragment from HindIll B containing the CLregion (ORFS B13R and B14R) was cloned into a pUC vector, generating pSD477. Plasmid pSD478 contains a multiple cloning region including a Bglll site replacing the entire I* region (nt 172,550-173,550) in pSD477. To accomplish this a duplex composed of annealed synthetic oligonucleotides SD41 mer (5’ CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3’) and SD39mer (5’ AACGGATCCCTCGAGCCCGGGGAGCTCAGATCTAGTAAT 3’) was utilized. To obtain a flanking vaccinia arm to the left of the p region, pSD478 was digested at the pUC/vaccinia junction with EcoRI, blunt-ended with Klenow fragment of E. co/i polymerase, and further digested with Bglll. A 0.3-kb fragment leftward of the p coding sequences was isolated and ligated with a vector fragment obtained by cutting pMPVCEND with Hindlll, blunt-ending with Klenow fragment, and digesting with Bglll (Fig. 2). In the resulting plasmid, pMPRENDA, the left vaccinia arm contains DNA sequences upstream from the B13R p ORF including the promoter region. The right vaccinia arm consists of tandem repeats equivalent to those present in pMPLENDA. The vaccinia arms in pMPRENDAflank a deletion of 17 ORFS (B13R through B29R; 14,873 bd (17). To generate the terminal deletions in the vaccinia genome we took advantage of two selection systems: the first utilizes the vaccinia host range gene, C7L (19) with selection of progeny virus on human MRC-5 cells as was used in the generation of VP749 (C6L-F4L deletion); the second utilizes the E. co/i gene encoding guanine phosphoribosyl transferase with selection of recombinant vaccinia progeny using mycophenolic acid (22, 23). A 660-bp BgllllBamHI fragment containing the C7L host range gene and its endogenous promoter (19) was inserted into pMPLENDA and into pMPRENDA. A 670-bp BgllIIBamHI fragment containing the Ecogpt gene was derived from pSV2gpt (ATCC #37145) (24) by the addition of a BarnHI linker at the Ahalll site downstream from the coding sequences (25). The BgllIIBamHI fragments containing either the C7L host range gene or the Ecogpt gene were inserted into Bglll-digested pMPLENDA or pMPRENDA, producing a total of four plasmids (Table 1A). In both pMPLAC7 and pMPRAC7 the C7L host range gene is under the control of its own endogenous promoter,
SHORT COMMUNICATIONS
409
TABLE 1 A. CONSTRUCTIONOF PLASMIDSFOR DELETIONSNEARCOPENHAGENTERMINI Plasmid substrate
Selectable
pMPLENDA pMPLENDA pMPRENDA pMPRENDA
marker
C7L Ecogpt C7L Ecogpt
Plasmid product
Deletion
pMPLAC7 PMPLwt pMPRAC7 PMPRgpt
C23L-F4L C23L-F4L B13R-B29R Bl3R-B29R
B. IN VIVO RECOMBINATIONSUSING DELETIONPLASMIDSWITH COPENHAGENVACCINIA VIRUS
vP668 (TK-, [C7L-Kl L]-) vP668 (TK-, [C7L-Kl LJ-) vP617 (TK-, ATI-, HA-) vP723 (TK-, ATI-, HA-, p-) VP796 (TK-, ATI-, HA-, [C23L-F4L]-, fcogpt+)
Vaccinia deletion mutant
Plasmid
Rescuing virus pMPLAC7 pMPRAC7 pMPRgpt pMPLgpt pMPRAC7
whereas the Ecogpt gene is under the control of the F4L promoter in pMPLgpt or the B13R h promoter (17) in pMPRgpt. Vaccinia virus progeny derived from in vivo recombination using donor plasmid containing the C7L host range function were selected by plating on MRC-5 cells, whereas progeny obtained by insertion of the Ecogpt gene were obtained by selection on VERO cells in the presence of mycophenolic acid (Table 1 B). As shown in Table 1 B, the 32.7-kb left terminal deletion [C23L-F4L] is contained in vaccinia recombinants VP789 and vP796. This indicates that single copy genes C14L through C8L are nonessential. (Single copy genes C7L through F4L were tested previously, Fig. 1). The 14.9-kb right terminal deletion [B13RB29R] is contained in vaccinia recombiants vP774 and vP759, indicating that single copy genes B13R-B20R are nonessential. vP81 1 contains both left and right deletions combined in a single vaccinia recombinant, demonstrating that all genes in the terminal redundancy are nonessential for virus growth. The extents of the terminal deletions are shown schematically in Fig. 1. The y deletion in rescuing virus vP723 is equivalent to the p deletion in plasmid pSD478 (Fig. 2). The TK, HA, and ATI deletions equivalent to those present in vP617 and vP723 have been previously described (19, 21). Figure 3B shows the HindIll restriction pattern of deletion mutants VP759 (right end deletion, lane 2), VP796 (left end deletion, lane 4), and vP81 1 (left and right end deletions, lane 3) compared to control virus vP723 (lane 1). Figure 3A shows an autoradiogram of the same gel probed with a mixture of vaccinia sequences from the deleted regions. The radiolabeled
([C23L-F4L]-, C7L+) ([Bi 3R-B29R]-, C7L+) ([B13R-B29R]-, Ecogpt+) ([C23L-F4L]-. Ecogpt+) ([B13R-B29R]-,
C7L+)
VP789 VP774 VP759 VP796 vp811
probe includes the entire Hindlll K, M, and N fragments plus portions of HindIll C, F, and B. Probe from the left end deleted region (HindIll, C, F, K, M, and N) hybridizes to the appropriate bands in the control virus, vP723 (lane 1) and VP759 (right end deletion, lane 2) but not to vP81 1 (left plus right end deletions, lane 3) or VP796 (left end deletion, lane 4). Probe from the right end deleted region (HindIll B) hybridizes to the HindIll B band in vP723 (lane 1) and VP796 (left end deletion, lane 4) but does not hybridize to VP759 (right end deletion, lane 2) or vP81 1 (left and right end deletions, lane 3) as expected. Figure 3C shows an autoradiogram of the same gel probed with labeled repetitive vaccinia DNA derived from the terminus (pMPVCEND). As expected, the HindIll C left terminal fragment in vP723 (lane 1) and VP759 (lane 2) is replaced by a smaller terminal fragment in deletion mutants VP796 (left end deletion, lane 4) and vP81 1 (left and right end deletions, lane 3). Similarly, the HindIll B right terminal fragment in vP723 (lane 1) and VP796 (lane 4) is replaced by a smaller terminal fragment in VP759 (right end deletion, lane 2) and vP81 1 (left and right end deletion lane 3). Confirmation of the precision of the deletions was obtained by PCR analysis and DNA sequence analysis of the deletion junctions (data not presented). The results reported above demonstrate that significant stretches of DNA in both right and left termini of the vaccinia genome contain information that is not essential for replication of the virus in tissue culture. Elimination of these sequences should provide a genetically stabilized genome since rearrangement of the nonessential DNA deleted from the termini is no longer possible. Furthermore, as suggested by other studies (26, Messer et al., unpublished) deletion of these se-
410
SHORT COMMUNICATIONS
A 1234
B 1234
C
REFERENCES
1234
,B -C -term
FIG. 3. Southern blot hybridization analysis of vaccinia deletion mutants. DNA from recombinant vaccinia virus was digested with HindIll and electrophoresed in duplicate sets on an agarose gel. DNA was transferred to Hybond-N membrane (Amersham, Arlington Heights, IL). Lane 1, vP723; lane 2, vP759; lane 3, vP811; lane 4, vP796. (A) One blot was probed with a mixture of 32P-labeled vaccinia DNA from the deleted regions (fragments HindIll N, M, and K and portions of /iindlll C, F, and B). An autoradiogram is shown. (B) The agarose gel was stained with ethidium bromide and DNAvisualized by long-wave ultraviolet light. (C)The duplicate blot was probed with 3”P-labeled fragment from pMPVCEND, containing repetitive DNA derived from the vaccinia terminus. An autoradiogram is shown.
quences should result in further attenuated vaccinia viruses useful as vectors for recombinant vaccines. ACKNOWLEDGMENTS This study was supported in part by US. Army Support Contract DAMD17-85-C-5232. We thank K. Dombrowski for typing the manuscript.
1. MACKETT, M., and ARCHARD. L. C., /. Gen Viral. 45, 683-701 (1979). 2. PANICALI, D., DAVIS, S. W., MERGER. S. R., and PAOLET~I, E., 1. Viral. 37, 1000-1010 (1981). 3. Moss, B., WINTERS, E., and COOPER, J. A., /. Viral. 40, 387-395 (1981). 4. DRILLIEN, R., KOEHREN. F., and KIRN, A., Virology 111, 488-499 (1981). 5. PAEZ, E., DALLO, S., and ESTEBAN,M., froc. Nat/. Acad. Sci. USA 82, 3365-3369 (1985). 6. PERKUS,M. E., PANICALI, D., MERCER, S., and PAOLEITI, E., Viralogy152,285-297(1986). 7. KOTWAL, G. J., and Moss, B., Virology 167, 524-537 (1988). 8. MOYER, R. W., and ROTHE, C. T., Virology 102, 119-l 32 (1980). 9. LAKE, J. R., and COOPER, P. D., /. Gen. Viral. 48, 135-l 47 (1980). 10. PICKUP, D., INK, B. S., PARSONS,B. L.. Hu, W., and JOKLIK,W. K., hoc. Nat/. Acad. Sci. USA 81, 6817-6821 (1984). 11. ARCHARD, L. C., and MACKETT, M., /. Gen. Viral. 45, 51.-63 (1979). 12. ESPOSITO,J. J., CABRADILLA, C. D., NAKANO, I. H., and OBIJESKI, J. F., Virology 109, 231-243 (1981). 73. PERKUS,M. E.. LIMBACH, K., and PAOLE~I, E., /. Viol. 63, 38293836 (1989). 14. BAROUDY, B. M., VENKATESAN, S., and Moss, B., Cell 28, 315324 (1982). 15. WITTEK, R.. and Moss, B., Cell 21, 277-284 (1980). 16. WIITEK, R., MULLER, H. K., MENNA, A., and WYLER, R., FfBS Left. 90, 41-46 (1978). 17. GOEBEL, S. J., JOHNSON,G. P., PERKUS,M. E., DAVIS, S. W., WINSLOW, J. P., and PAOLEITI, E., Virology 179, 247-266 (1990). 18. GILLARD, S., SPEHNER, D.. DRILLIEN, R.. and KIRN, A., Proc. Nat/. Acad. Sci. USA 83, 5573-5577 (1986). 19. PERKUS,M. E., GOEBEL, S. J., DAVIS, S. W., JOHNSON,G. P., NORTON, E. K., and PAOLETTI, E., Vkology 179, 276-286 (1990). 20. SLABAUGH,M., ROSEMAN, N., DAVIS, R., and MATHEWS, C.,/. Viral. 62, 519-527 (1988). 21. Guo, P., GOEBEL, S., DAVIS, S., PERKUS,M. E., LANGUET, B., DESMETTRE, P., ALLEN, G., and PAOLETTI, E., J. Viral. 63, 41894198 (1989). 22. BOYLE, D. B., and COUPAR. B. E. H., Gene 65, 123-128 (1988). 23. FALKNER, F. G., and Moss, B., 1. Viral. 62, 1849-1854 (1988). 24. MULLIGAN, R. C.. and BERG, P.. Science 209, 1422-l 427 (1980). 25. PRATT, D., and SUBRAMANI, S., Nucleic Acids Res. 11, 88178823 (1983). 26. DALLO, S.. and ESTEBAN, M., Virology 156, 408-422 (1987).
