YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 Plasmid xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas 5 6
Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21
3 4 7
Q1
8 9 10 11
Q2
Mohd Shawal Thakib Maidin a, Adelene Ai-Lian Song a, Tannaz Jalilsood a, Chin Chin Sieo b,c, Khatijah Yusoff b,c, Raha Abdul Rahim a,c,⇑ a
Department of Cell and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia c Institute of Bioscience Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b
12 13
a r t i c l e
1 2 5 7 16 17 18 19 20
i n f o
Article history: Received 23 November 2013 Accepted 16 May 2014 Available online xxxx Communicated by C. Jeffery Smith
21 22 23 24 25 26
Keywords: Heat shock promoter LAB Lactococcus lactis Lactobacillus plantarum
a b s t r a c t A vector that drives the expression of the reporter gusA gene in both Lactobacillus plantarum and Lactococcus lactis was constructed in this study. This vector contained a newly characterized heat shock promoter (Phsp), amplified from an Enterococcus faecium plasmid, pAR6. Functionality and characterization of this promoter was initially performed by cloning Phsp into pNZ8008, a commercial lactococcal plasmid used for screening of putative promoters which utilizes gusA as a reporter. It was observed that Phsp was induced under heat, salinity and alkaline stresses or a combination of all three stresses. The newly characterized Phsp promoter was then used to construct a novel Lactobacillus vector, pAR1801 and its ability to express the gusA under stress-induced conditions was reproducible in both Lb. plantarum Pa21 and L. lactis M4 hosts. Ó 2014 Published by Elsevier Inc.
28 29 30 31 32 33 34 35 36 37 38 39 40
41 42
1. Introduction
43
Lactic acid bacteria (LAB) are ‘‘generally regarded as safe’’ (GRAS) organisms that are widely utilized as starter culture, food preservative and flavor enhancer in the food and beverage industry. LAB are also used for unconventional purposes including production of viral and eukaryotic proteins (Kunji et al., 2003; Madsen et al., 1999) and for vaccine delivery (Madsen et al., 1999; Ramasamy et al., 2006; Van Niel and Hahn-Hägerdal, 1999). In addition, the ability of LAB to secrete recombinant proteins directly into the culture medium increases the value of these bacteria. Advanced molecular technique tools are needed to produce LAB with desirable characteristics. As a result, Lactococcus lactis and Lactobacillus plantarum have
44 45 46 47 48 49 50 51 52 53 54 55
⇑ Corresponding author at: Department of Cell and Molecular Biology,
Q3
Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. E-mail address: [email protected] (R.A. Rahim).
become model microorganisms in LAB research due to the extensive development of molecular and post-genomics tools available for these two microorganisms (Fitzsimons et al., 1994; Hols et al., 1994; Jones et al., 2004; Pavan et Q4 al., 2000; Ramasamy et al., 2006). To date, various plasmid vectors have been constructed based on the origin of cryptic plasmids from several Lactobacillus and Lactococcus species, such as Lb. plantarum (Sorvig et al., 2005), Lactobacillus fermentum (Pavlova et al., 2002), Lactobacillus paracasei (Kojic et al., 2010) and L. lactis (Raha et al., 2006). While there are currently quite a few available plasmids for genetic modifications designed for these hosts, the number, variety and flexibility of these plasmids are still very much lacking compared to those available for Escherichia coli. Therefore, there is a need for development of new vectors for these hosts, especially those with special characteristics which can coalesce with the use of LAB in the food industry such as food-grade expression systems.
http://dx.doi.org/10.1016/j.plasmid.2014.05.003 0147-619X/Ó 2014 Published by Elsevier Inc.
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 2
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Pa21 was isolated from another Malaysian native plant, Pandanus amaryllifolius while Lb. plantarum ATCC14917 was purchased from American Type Culture Collection (ATCC). The E. faecium and Lb. plantarum strains were cultured aseptically as stand cultures in de Man Rogosa and Sharpe (MRS) broth media (Merck, Germany) for enrichment at 30 °C and 37 °C for 16 h, respectively. L. lactis M4 strain was cultured in M17 medium (Merck, Germany) containing 0.5% (w/v) glucose (GM17) at 30 °C for 16 h as stand cultures (Terzaghi and Sandine, 1975). Transformants were selected with the supplementation of chloramphenicol at a final concentration of 7.5 lg/ml and 5bromo-4-chloro-3-indolyl glucuronide (X-Gluc) (Fermentas, USA) at a final concentration of 0.5 mM on GM17 agar plates.
108
2.2. Promoter sequence analysis
123
The potential Pribnow box and 35 site of Phsp were predicted with BPROM (Softberry, USA), an online bacterial r70 promoter (major E. coli promoter class) recognition program with about 80% accuracy and specificity that can be accessed freely at (http://linux1.softberry.com/).
124
100
When it comes to expression of heterologous proteins, inducible promoters are preferred compared to constitutive promoters as they offer better control of gene expression, especially if the heterologous protein is toxic to the cell in high concentrations. In L. lactis, the nisin-controlled gene expression system (NICE) is the most commonly used system for heterologous protein production as it allows gene expression under the influence of the food-grade inducer, nisin (Mierau and Kleerebezem, 2005). However, nisin and many other inducers can be expensive and economically not practical in an industrial setting. Therefore, auto-inducible promoters are viable options as they do not need exogenous inducers to drive gene expression while allowing certain control over gene expression which can be manipulated by changing culture conditions. In this study, we characterize a heat-shock promoter, Phsp from Enterococcus faecium with the intention of using it to construct a novel Lactobacillus vector which can be auto-induced for expression of heterologous proteins under industrial conditions. The heat shock protein promoter (Phsp) was isolated from the enterococcal plasmid, pAR6 and was found to regulate the expression of a-crystallin heat shock protein (hsp) in the plasmid. Following characterization of Phsp, the promoter was exploited to develop a novel vector, pAR1801, which replicates in Lb. plantarum and L. lactis.
2.3. PCR amplification of Phsp and PLDH
129
101
2. Materials and methods
130
102
2.1. Bacterial strains, plasmids and culture conditions
103
Bacterial strains and plasmids used in this study are listed in Table 1. E. faecium HB6 harboring the plasmid, pAR6 was isolated and identified from the leaves’ surface of the indigenous Malaysian local herb, Andrographis paniculata. The plasmid free strain of Lactobacillus plantarum
The Phsp and PLDH (positive control) sequences were isolated from the previously isolated enterococcal plasmid pAR6 and Lb. plantarum ATCC14917 genomic DNA, respectively, by PCR amplification. Based on the pAR6 plasmid full sequence (GenBank accession no: KC167328) and Lb. plantarum L-(+)-lactate dehydrogenase promoter sequence (GenBank accession no: NZ_GL379768 NZ_ACGZ02000000), primers were carefully designed to include the Pribnow box (10), 35 sequence and
75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
104 105 106 107
Table 1 Bacterial strains and plasmids used in this study. Strain/plasmid
Relevant characteristics
Source
Strains L. lactis NZ9000 L. lactis M4 Lb. plantarum Pa18
Standard host strain, host strain for plasmid pNZ8008 Milk isolated host strain, host strain for plasmids pNZ8008Phsp and pNZ8008PLDH Malaysia local plant, Pandanus amaryllifolius isolate, pR18 host
Lb. plantarum Pa21
Malaysia local plant, Pandanus amaryllifolius isolate, plasmid-free strain
Lb. plantarum ATCC 14917 E. faecium HB6
Pickled cabbage isolated strain
Kuipers et al., 1998 Noreen et al., 2011 Microbial Biotechnology Lab, UPM Microbial Biotechnology Lab, UPM ATCC
Malaysian local herbal plant isolate
This study
Plasmid isolated from E. faecium HB6 Cmr, 4.9 kb, lactococcal vector carrying the gusA gene fused to the nisA promoter Cmr, 4.8 kb, lactococcal vector carrying the gusA gene fused to the Phsp promoter Cmr, 5.0 kb, lactococcal vector carrying the gusA gene fused to the PLDH promoter Cmr, 3.3 kb, L. lactis expression vector Cmr, 3.3 kb, pNZ8048 derivative, Pnis replaced with Phsp LinAr, 3.2 kb, Lb. plantarum Pa18 isolated plasmid Cmr, 3.6 kb, pR18 derivative, Lactobacillus expression vector harboring Phsp promoter Cmr, 5.4 kb, pAR1801 derivative, carrying gusA gene downstream of Phsp
This study de Ruyter et al., 1996 This study This study Kuipers et al., 1998 This study This study This study
Plasmids pAR6 pNZ8008 pNZ8008Phsp pNZ8008PLDH pNZ8048 pNZ8048-Phsp pR18 pAR1801 pAR1801-GUS
This study
ATCC, American Type Culture Collection.
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
109 110 111 112 113 114 115 116 117 118 119 120 121 122
125
126 127 128
131 132 133 134 135 136 137 138
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx Table 2 List of primers used in this study. Primer
Sequence (50 –30 )
PhspF
CGCGAGATCTCTATCATGAGTATTTACGAG
PhspR
AAGTCTGCAGGAGTTACGTTGTTGAATCTC
PLDHF
AGATAGATCTTACCAAAACAGGCCGAACCG
PLDHR
CTACTGCAGCAACAGCACCGTCGCCGACTA AATAGCGACGGAGAGTTAGG CCAGACTGAATGCCCACAGG
P8008flankF P8008flankR P8048cassetteF
TAGCGGCCGCCGACGGCAATAGTTACCCTT
P8048cassetteR
ATAGTCGACTTCTGCTCCCGCCCTTATGG
Pr18cassetteF
ATGTCGACCACTACGTTCGCCCTTGCTG
Pr18cassetteR
TGCGGCCGCACGTGTAAGTGCGCATTGTC
gusF
TACTGCAGtGAGGAGTCCCTTATGTTACG
gusR
ATATTCTAGACACTCGAGAAGCTTTCATTG
The primer nucleotides underlined were for introducing restriction sites. The start (ATG) and stop (TCA) codon is shown in bold.
139 140 141 142 143 144 145 146 147 148 149 150 151 152 153
ribosome binding site (RBS). The sequences of all primers are shown in Table 2. PCR amplification of the Phsp and PLDH sequences were carried out with Pfu DNA polymerase (Fermentas, USA). The PCR reaction mix comprised of 1 PCR Buffer with MgSO4 (Fermentas, USA), 0.2 mM of dNTP Mix (Fermentas, USA), 0.08 mM of forward and reverse primers for each sequences, respectively, 200 ng of template and 1.25 U/lL of Pfu DNA polymerase. The PCR reaction was initiated with denaturation of template at 95 °C for 5 min, followed by 25 cycles of template denaturation at 95 °C for 1 min, primer annealing at 63 °C for 1 min and extension at 72 °C for 1 min. Final extension was performed at 72 °C for 5 min. A negative control reaction without template DNA was carried out under the same conditions.
3
minor modifications. The GUS activity was calculated spectrophotometrically as nmoles/min/mg protein unit using para-nitrophenyl-b-D-glucuronic acid (PNPG) as the substrate. Total protein concentration was determined using Bradford assay.
176
2.6. Stress test
181
Stress response of Phsp was studied in triplicates by growing L. lactis M4 harboring pNZ8008Phsp under heat, salt and pH stresses or a combination of stress conditions. For heat stress, cells were grown at 37 °C compared to the normal growth temperature of 30 °C. For salinity stress, cells were grown at NaCl concentrations of 1–5% (w/v) and for pH stress, cells were grown at pH 5–10 (normal growth condition is pH 7). The stress response tests were replicated for Lb. plantarum harboring pAR1801-GUS. In all cases, cell densities were normalized for GUS activity reading.
182
2.7. Construction of Lactobacillus–Lactococcus shuttle vector
193
The new shuttle vector, pAR1801 was constructed as shown in Fig. 1. The expression vector was developed based on a combination of the Lactobacillus plasmid, pR18 and the lactococcal plasmid, pNZ8048. The Pnis of pNZ8048 was first replaced by Phsp at the BglII and PstI sites. A fragment containing the chloramphenicol resistance gene, Phsp, MCS and terminator sequence was then amplified using primers P8048cassetteF and P8048cassetteR (Table 2). This fragment was digested with NotI and SalI and fused with the fragment containing the pR18 replicative backbone which was amplified using the primers pR18cassetteF and pR18cassetteR. The newly constructed plasmid was transformed into Lb. plantarum Pa21 host according to the protocol described by Alegre et al. (2004) with minor modifications. Plasmids were then isolated from the positive transformants and were confirmed by sequencing. The gusA gene was then cloned into the MCS of the newly constructed pAR1801 vector via the PstI and XbaI sites, resulting with pAR1801-GUS. The PstI and XbaI RE sites were introduced into the gusA gene by PCR amplification of gusA using the gusF and gusR primers. The ligated pAR1801 vector containing gusA was then transformed into Lb. plantarum Pa21 and L. lactis M4 hosts. The positive transformants were verified by X-gluc selective agar plates, plasmid extraction followed by RE digestion of the plasmid prep.
194
177 178 179 180
183 184 185 186 187 188 189 190 191 192
195 196 197 198 199 200 201 202 203 204 205 206 207
154
2.4. Cloning of Phsp and PLDH into pNZ8008
155
165
Phsp and PLDH were cloned into pNZ8008 at the BglII and PstI sites, displacing the original Pnis promoter. The recombinant plasmid was transformed into L. lactis M4 via electroporation as described by Holo and Nes (1989) with minor modifications. The transformants were screened on SGM17 (GM17 supplemented with 0.5 M sucrose) containing 7.5 lg/mL chloramphenicol after incubation at 30 °C for 24–48 h. The pNZ8008Phsp and pNZ8008PLDH recombinant plasmids were verified by X-Gluc selective agar plates and BglII/PstI double restriction enzyme digestion of the isolated plasmid.
166
2.5. Assay for GUS activity
2.8. Stability of the plasmid in Lb. plantarum and L. lactis
221
167
Positive transformants were indicated by positive GUS activity which yielded blue colonies on GM17 chloramphenicol plates supplemented with 0.5 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) (Fermentas, USA). L. lactis M4 harboring pNZ8008Phsp were grown under different stress condition (see following section for types of stress conditions) until the cells reached stationary phase. Quantitative GUS assay was conducted as described by de Ruyter et al. (1996) with
Plasmid stability test was carried out as described by Imanaka and Aiba (1981) with minor modifications. Overnight cultures of Lb. plantarum Pa21-pAR1801 and L. lactis M4-pAR1801 were diluted (1:100) in GM17 and MRS broth, respectively, without chloramphenicol. The cultures were allowed to grow continuously at the log phase by inoculation into fresh media for 100 generations (65 generations for L. lactis M4-pAR1801). The cells were then spread onto GM17 and MRS agar, respectively, and incu-
222
156 157 158 159 160 161 162 163 164
168 169 170 171 172 173 174 175
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
208 209 210 211 212 213 214 215 216 217 218 219 220
223 224 225 226 227 228 229 230
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 4
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Fig. 1. Schematic diagram showing the construction of a new Lactobacillus–Lactococcus shuttle expression vector, pAR1801 and the cloning of gusA gene into the vector. A fragment containing the chloramphenicol resistance gene, Phsp, MCS and terminator sequence from pNZ8048Phsp was amplified and fused with the fragment containing the pR18 replicative backbone.
231 232 233 234 235 236
bated at 30 °C for 16 h. A total of 100 colonies of L. lactis NZ-pAR1801 and Lb. plantarum Pa21-pAR1801 were picked randomly and sub-cultured on GM17 and MRS agar supplemented with chloramphenicol. The number of colonies which were able to grow was counted and calculated as a percentage of plasmid stability.
237
3. Results and discussion
238
3.1. Promoter sequence analysis
239
The heat shock protein promoter (Phsp) regulates the expression of a-crystallin heat shock protein (hsp) in the isolated enterococcal pAR6 plasmid. The a-crystallin hsp is a small hsp that plays a role as a molecular chaperone which helps the protein to fold under stress conditions (Han et al., 2008; Narberhaus, 2002; Yura et al., 1993). As per previous findings, the Phsp characterized in the current study was not limited to heat stress alone and was found to be triggered under various stress conditions such as high salinity and high pH. The Phsp promoter was identified by sequence analysis of pAR6 which brought to the finding of a potential Pribnow box (10), 35 site, ribosome binding site (RBS), start codon and class three stress gene repressor (CtsR) binding site as shown in Fig. 2. Moreover, the RBS sequence (GAAAG) which is similar with the RBS sequence of Phsp from the Streptococcus thermophilus plasmid pER341 was identified upstream from the start codon, ATG (Somkuti et al., 1998). The CtsR binding site was detected based on
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257
the conserved heptanucleotide sequence described by Derre et al. (1996, 1999) and Fiocco et al. (2009a,b) located Q5 between the 10 and 35 binding site. Multiple sequence alignment analysis (ClustalW) showed that the Phsp sequence of pAR6 is highly similar with plasmid pJS33 from E. faecium strain JH95 (GenBank accession no: EU370687.1) and plasmid pEFR from E. faecium (GenBank accession no: AF511037.1) with the difference of only one nucleic acid. Regulation of protein expression by the Phsp system under stress condition is controlled by CtsR, which is found in Gram-positive bacteria (Derre et al., 1999; Fiocco et al., 2009a; Kruger and Hecker, 1998; Varmanen et al., 2000). CtsR recognition sequences are highly conserved in this group of bacteria with the presence of a tandem heptanucleotide repeat of A/GGTCAAA/T in the promoter sequence (Derre et al., 1999, 2000). The tandem heptanucleotide repeat was identified as AGTCAAA AAA GGTCAGT which is identical to the consensus sequence of RGTCADN NAN RGTCADN among low G + C Gram-positive bacteria (5, 6, 10). CtsR negatively regulates Phsp by binding specifically at the transcriptional start site between 10 and 35 regions although the promoter is able to constitutively express at low levels under normal non-stress conditions (Kruger and Hecker, 1998). This means that Phsp is not tightly regulated which is what was observed in the current study as low level of GUS activity could be detected under non-stress conditions (data not shown). Under stressed conditions, the classical winged helix-turn-helix (HTH) dimeric DNA-binding protein of CtsR undergoes structural change and deregulates the promoter allowing
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
5
Fig. 2. Nucleotide sequence of Phsp promoter. The potential Pribnow box (10), 35 and ribosome binding site (RBS) are underlined. The amino acid sequence indicates the open reading frame of the hsp gene. The start codon (ATG) is indicated with capital letters. Class three stress gene repressor (CtsR) binding site is in box.
289 290
for the RNA polymerase ErA holoenzyme to bind and start the transcription process (Elsholz et al., 2010, 2011).
291
3.2. Verification of Phsp functionality
292
306
In order to verify the functionality of Phsp which was identified by sequence analysis, the promoter was amplified and cloned into the lactococcal vector, pNZ8008. The vector, pNZ8008 is a promoter screening vector which allows the original Pnis to be displaced by putative promoters which drives the expression of the downstream gusA reporter gene. The resulting pNZ8008Phsp plasmid was transformed into the L. lactis M4 host. Apart from chloramphenicol selection, positive transformants were also selected by formation of blue colonies caused by the breakdown of the X-Gluc substrate by the GUS enzyme. Therefore, the formation of blue colonies confirms the functionality of Phsp which was able to drive the expression of the gusA gene. PLDH was also cloned into pNZ8008 as a positive control.
307
3.3. Stress response challenge
308
L. lactis M4 harboring pNZ8008Phsp was induced under heat, salt, pH and a combination of stresses mimicking industrial stress conditions such as cheese making (Ahmed et al., 2006) or as starter cultures in alkaline fermented food such as Spanish-style green olives (Sanchez et al., 2001). The strength of the promoter in response to stress was measured based on GUS activity which was quantified spectrophotometrically. The pNZ8008PLDH vector containing the Lactobacillus PLDH promoter (Chaillou et al., 1998; Oozeer et al., 2005) was utilized as a positive control to compare the strength of Phsp with an established LAB strong promoter in L. lactis M4 host. Heat stress was performed at 37 °C since cell growth was disrupted at temperatures higher than that. Cells cultured at 37 °C exhibited higher expression levels of gusA compared to expression at 30 °C with 548.16 and 382.61 unit, respectively, as seen in Fig. 3. Salt stress was conducted with the addition of 1–5% (w/v) NaCl in GM17 chloramphenicol broth. However, cell growths were halted at salt concentration higher than 3% and could not be analyzed for GUS activity. Cells grown at 3% (w/v) salt (Fig. 3) gave a significantly higher reading for GUS activity at 1027.13 units
293 294 295 296 297 298 299 300 301 302 303 304 305
309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329
compared to 1% (w/v) NaCl (580.73 units) and 2% (w/v) NaCl (774.97 units), respectively. For pH stress, pH 5–10 was chosen in this study as cells were unable to grow outside of this range although a pH range of 4.0–5.0 and 7.5– 8.0 were reported to be the lower and higher limit, respectively, for Lactococcus lactis depending on the medium composition and strain (34, 38). The GUS activity was found to be directly proportional with increasing pH where the highest GUS activity was found at pH 10 (1006.31 units). The information obtained from the GUS activity under all the stresses mentioned above were then used to maximize protein expression. Initially, the cells were cultured in a combination of stress conditions at 37 °C, 3% (w/v) salt concentration and pH 10. However, the harsh conditions limited the growth of the cells and resulted in undetectable GUS enzyme activity. When the conditions were altered by lowering the pH to 9, cell growth was permitted and GUS activity was detected and calculated. Although this combination of stress gave the highest GUS formation reaction (based on slope of graph of OD405nm vs time; data not shown here), specific activity was only at 981.97 units, slightly lower than readings from 3% salt concentration and pH 10. This was because it was observed that amount of total protein produced was proportional with the amount of stress subjected to the cells. PLDH, which was used as the positive control gave 1544.72 units reading.
330
3.4. Construction of Lactobacillus expression vector
357
The newly characterized Phsp was used to construct a new Lactobacillus vector, pAR1801 using the replicative backbone of pR18, a cryptic plasmid isolated from Lb. plantarum Pa18. Although pAR1801 contained the Lactobacillus replicative backbone, thereby allowing it to be stably maintained in Lb. plantarum Pa21, it was also found to be able to replicate in L. lactis M4 although not as stably as in Lb. plantarum Pa21 as plasmids were lost after 65 generations. Lb. plantarum Pa21 harboring pAR1801-GUS was also subjected to the stress tests previously described for L. lactis M4 harboring pNZ8008-Phsp and results were found to be similar (Fig. 4), showing that Phsp functioned in the same way in the newly constructed pAR1801 as in pNZ8008-Phsp. The general pattern observed was that GUS specific activity increased with increasing stress.
358
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
359 360 361 362 363 364 365 366 367 368 369 370 371 372
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 6
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Fig. 3. GUS activity profile of L. lactis M4 harboring pNZ8008Phsp in response to heat, salt and pH stress or a combination of stresses. PLDH indicates the positive control.
Fig. 4. GUS activity profile of Lb. plantarum Pa21 harboring pAR1801-GUS in response to heat, salt and pH stress or a combination of stresses. PLDH indicates the positive control.
373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397
However, for Pa21(pAR1801-GUS), 3% salt stress gave the highest GUS activity followed by a combination of stresses. Although Phsp was isolated from E. faecium HB6, the existence of the CtsR concensus region in other Gram-positive bacteria indicated that Phsp could also function in Lactococcus and Lactobacillus sp. This was clearly proven by the expression of gusA in the stress response experiments using both L. lactis M4 and Lb. plantarum Pa21 hosts. Apart from demonstrating the functionality of Phsp, the construction of the novel vector, pAR1801 also serves as an alternative to the current existing vectors for gene manipulation. The new pAR1801 is valuable as it can potentially be used in harsh conditions such as those found in an industrial setting. For example, Lactobacillus and Lactococcus are commonly used as starter cultures in dairies and fermented food. Although Phsp was not highly induced under low pH which is usually the condition in dairy industries, some processes like curd processing in cheese-making require high temperatures from 35 to 55 °C which will still induce Phsp. Also, salt which is commonly added as flavor in food can double up as an inducer for Phsp expressing an enzyme of interest, for example, glutamate dehydrogenase, which is able to stimulate amino acid conversion to aromatic compounds (Tanous et al., 2006). The ability of Phsp to be auto-induced by stress negates the need for
expensive inducers such as nisin which is the food-grade inducer for the most commonly used NICE expression system in L. lactis (Mierau and Kleerebezem, 2005). While induction of the Phsp in this study was limited by the ability of Lb. plantarum and L. lactis to grow under extremely harsh conditions, it will be interesting to see if Phsp can also be functional in other extremophiles and if gene expression regulated by Phsp can be further increased under more extreme conditions.
398
4. Conclusion
407
A novel vector, pAR1801, which could replicate in both Lb. plantarum and L. lactis was constructed in this study. This vector contained Phsp, a promoter induced by heat, salt and alkaline stress which was able to drive the expression of gusA at about 65% strength of PLDH which is established to be a strong constitutive promoter.
408
5. Uncited references
414
Cotter and Hill (2003), de Vos (1987), Kok et al. (1984), Mercenier et al. (2000), Rossi et al. (2001), Sanchez et al. Q6 (2008), Van Roosmalen et al. (2006).
415
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
399 400 401 402 403 404 405 406
409 410 411 412 413
416 417
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx 418
Acknowledgments
419 421
This work was supported by a research grant from the Ministry of Science, Technology and Innovation of Malaysia under the grant number 02-01-04-SF1608.
422
References
423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491
Ahmed, T., Kanwal, R., Ayub, N., 2006. Influence of temperature on growth pattern of Lactococcus lactis, Streptococcus cremoris and Lactobacillus acidophilus isolated from camel milk. Biotechnology 5, 481–486. Alegre, M.T., Rodriguez, M.C., Mesas, J.M., 2004. Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA. FEMS. Microbiol. Lett. 241 (73), 77. Chaillou, S., Postma, P.W., Pouwels, P.H., 1998. Functional expression in Lactobacillus plantarum of xylP encoding the isoprimeverose transporter of Lactobacillus pentosus. J. Bacteriol. 180, 4011–4014. Cotter, P.D., Hill, C., 2003. Surviving the acid test: responses of grampositive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67, 429–453. de Ruyter, P.G., Kuipers, O.P., Beerthuyzen, M.M., van Alen-Boerrigter, I., de Vos, W.M., 1996. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J. Bacteriol. 178, 3434–3439. Derre, I., Rapoport, G., Msadek, T., 1999. CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol. Microbiol. 31, 117–131. Derre, I., Rapoport, G., Msadek, T., 2000. The CtsR regulator of stress response is active as a dimer and specifically degraded in vivo at 37 degrees C. Mol. Microbiol. 38 (335), 347. de Vos, W.M., 1987. Gene cloning and expression in lactic streptococci. FEMS. Microbiol. Rev. 46, 281–295. Elsholz, A.K., Hempel, K., Pother, D.C., Becher, D., Hecker, M., Gerth, U., 2011. CtsR inactivation during thiol-specific stress in low GC, Gram+ bacteria. Mol. Microbiol. 79, 772–785. Elsholz, A.K., Michalik, S., Zuhlke, D., Hecker, M., Gerth, U., 2010. CtsR, the gram positive master regulator of protein quality control, feels the heat. EMBO J. 29 (3621), 3629. Fiocco, D., Capozzi, V., Collins, M., Gallone, A., Hols, P., Guzzo, J., Weidmann, S., Rieu, A., Msadek, T., Spano, G., 2009a. Characterization of the CtsR stress response regulon in Lactobacillus plantarum. J. Bacteriol. 192, 896–900. Fiocco, D., Collins, M., Muscariello, L., Hols, P., Kleerebezem, M., Msadek, T., Spano, G., 2009b. The Lactobacillus plantarum ftsH gene is a novel member of the CtsR stress response regulon. J. Bacteriol. 191, 1688– 1694. Fitzsimons, A., Hols, P., Jore, J., Leer, R.J., O’Connell, M., Delcour, J., 1994. Development of an amylolytic Lactobacillus plantarum silage strain expressing the Lactobacillus amylovorus alpha-amylase gene. Appl. Environ. Microbiol. 60, 3529–3553. Han, M.J., Yun, H., Lee, S.Y., 2008. Microbial small heat shock proteins and their use in biotechnology. Biotechnol. Adv. 26, 591–609. Holo, H., Nes, I.F., 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55, 3119–3123. Hols, P., Ferain, T., Garmyn, D., Bernard, N., Delcour, J., 1994. Use of homologous expression-secretion signals and vector-free stable chromosomal integration in engineering of Lactobacillus plantarum for a-amylase and levanase expression. Appl. Environ. Microbiol. 60, 1401–1413. Imanaka, T., Aiba, S., 1981. A perspective on the application of genetic engineering: stability of recombinant plasmid. Ann. NY. Acad. Sci. 369, 1–14. Jones, M.L., Chen, H., Ouyang, W., Metz, T., Prakash, S., 2004. Microencapsulated genetically engineered Lactobacillus plantarum 80 (pCBH1) acid deconjugation and its implication in lowering cholesterol. J. Biomed. Biotechnol. 1, 61–69. Kojic, M., Lozo, J., Jovcic, B., Strahinic, I., Fira, D., Topisirovic, L., 2010. A successful use of a new shuttle cloning vector Pa13 for the cloning of the bacteriocins BACSJ and ACIDOCIN 8912. Arch. Biol. Sci. 62, 231– 243. Kok, J., van der Vossen, J.M.B.M., Venema, G., 1984. Construction of plasmid cloning vectors for lactic streptococci which also replicate in Bacillus subtilis and Escherichia coli. Appl. Environ. Microbiol. 48, 726– 731. Kruger, E., Hecker, M., 1998. The first gene of the Bacillus subtilis clpC operon, ctsR, encodes a negative regulator of its own operon and other class III heat shock genes. J. Bacteriol. 180, 6681–6688.
420
7
Kuipers, O.P., de Ruyter, P.G.G.A., Kleerebezem, M., de Vos, W.M., 1998. Quorum sensing controlled gene expression in lactic acid bacteria. J. Biotechnol. 64, 15–21. Kunji, E.R.S., Slotboom, D.J., Poolman, B., 2003. Lactococcus lactis as host for overproduction of functional membrane proteins. Biochim. Biophys. Acta. 1610, 97–108. Madsen, S.M., Arnau, J., Vrang, A., Givskov, M., Israelsen, H., 1999. Molecular characterization of the pH-inducible and growth phasedependent promoter P170 of Lactococcus lactis. Mol. Microbiol. 32, 75–87. Mercenier, A., Muller-Alouf, H., Grangette, C., 2000. Lactic acid bacteria as live vaccines. Curr. Issues. Mol. Biol. 2, 17–25. Mierau, I., Kleerebezem, M., 2005. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl. Microbiol. Biotechnol. 68, 705–717. Narberhaus, F., 2002. Alpha-crystallin-type heat shock proteins: socializing minichaperones in the context of a multichaperone network. Microbiol. Mol. Biol. Rev. 66, 64–93. Noreen, N., Hooi, W.Y., Baradaran, A., Rosfarizan, M., Sieo, C.C., Rosli, M.I., Yusoff, K., Raha, A.R., 2011. Lactococcus lactis M4, a potential host for the expression of heterologous proteins. Microb. Cell Fact. 10, 28. Oozeer, R., Furet, J.P., Goupil-Feuillerat, N., Anba, J., Mengaud, J., Corthier, G., 2005. Differential activities of four Lactobacillus casei promoters during bacterial transit through the gastrointestinal tracts of human-microbiota-associated mice. Appl. Environ. Microbiol. 71, 1356–1363. Pavan, S., Hols, P., Delcour, J., Geoffroy, M.C., Grangette, C., Kleerebezem, M., Mercenier, A., 2000. Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Appl. Environ. Microbiol. 66, 4427–4432. Pavlova, S.L., Kilic, A.O., Topisirovic, L., Miladinov, N., Hatzos, C., Tao, L., 2002. Characterisation of a cryptic plasmid from Lactobacillus fermentum KC5b and its use for constructing a stable Lactobacillus cloning vector. Plasmid 47, 182–192. Raha, A.R., Hooi, W.Y., Mariana, N.S., Radu, S., Varma, N.R., Yusoff, K., 2006. DNA sequence analysis of a small cryptic plasmid from Lactococcus lactis subsp. lactis M[14]. Plasmid 56, 53–61. Ramasamy, R., Yasawardena, S., Zomer, A., Venema, G., Kok, J., Leenhouts, K., 2006. Immunogenicity of a malaria parasite antigen displayed by Lactococcus lactis in oral immunisations. Vaccine 24, 3900–3908. Rossi, F., Rudella, A., Marzotto, M., Dellaglio, F., 2001. Vector-free cloning of a bacterial endo 1,4-b-glucanase in Lactobacillus plantarum and its effect on the acidifying activity in silage: use of a recombinant cellulolytic Lactobacillus plantarum as silage inoculant. Antonie Leeuwenhoek 80, 139–147. Sanchez, A.-H., Rejano, L., MontanÕ, A., de Castro, A., 2001. Utilization at high pH of starter cultures of lactobacilli for Spanish-style green olive fermentation. Int. J. Food Microbiol. 67, 115–122. Sanchez, C., Neves, A.R., Cavalheiro, J., dos Santos, M.M., Garcia-Quintans, N., Lopez, P., Santos, H., 2008. Contribution of citrate metabolism to the growth of Lactococcus lactis CRL[264] at low pH. Appl. Environ. Microbiol. 74, 1136–1144. Somkuti, G.A., Solaiman, D.K., Steinberg, D.H., 1998. Structural and functional properties of the hsp l6.4-bearing plasmid pER341 in Streptococcus thermophilus. Plasmid 40, 61–72. Sorvig, E., Mathiesen, G., Naterstad, K., Eijsink, V.G., Axelsson, L., 2005. High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiology 151, 2439–2449. Tanous, C., Chambellon, E., Delespaul, G., Yvon, M., 2006. Glutamate dehydrogenase activity can be naturally transmitted to Lactococcus lactis strains to stimulate the amino acid conversion to aroma compounds. Appl Environ Microbiol. 72, 1402–1409. Terzaghi, B.E., Sandine, W.E., 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29, 807–813. Van Niel, E.W.J., Hahn-Hägerdal, B., 1999. Nutrients requirements of lactococci in defined growth media. Appl. Microbiol. Biotechnol. 52, 617–627. Van Roosmalen, M.L., Kanninga, R., El Khattabi, M., Neef, J., Audouy, S., Bosma, T., Kuipers, A., Post, E., Steen, A., Kok, J., Buist, G., Kuipers, O.P., Robillard, G., Leenhouts, K., 2006. Mucosal vaccine delivery of antigens tightly bound to an adjuvant particle made from foodgrade bacteria. Methods 38, 144–149. Varmanen, P., lngmer, H., Vogensen, F.K., 2000. ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology 146, 1447–1455. Yura, T., Nagai, H., Mori, H., 1993. Regulation of the heat-shock response in bacteria. Annu. Rev. Microbial. 47, 321–350.
492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
No. of Pages 7, Model 3G
31 May 2014 Plasmid xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas 5 6
Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21
3 4 7
Q1
8 9 10 11
Q2
Mohd Shawal Thakib Maidin a, Adelene Ai-Lian Song a, Tannaz Jalilsood a, Chin Chin Sieo b,c, Khatijah Yusoff b,c, Raha Abdul Rahim a,c,⇑ a
Department of Cell and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia c Institute of Bioscience Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b
12 13
a r t i c l e
1 2 5 7 16 17 18 19 20
i n f o
Article history: Received 23 November 2013 Accepted 16 May 2014 Available online xxxx Communicated by C. Jeffery Smith
21 22 23 24 25 26
Keywords: Heat shock promoter LAB Lactococcus lactis Lactobacillus plantarum
a b s t r a c t A vector that drives the expression of the reporter gusA gene in both Lactobacillus plantarum and Lactococcus lactis was constructed in this study. This vector contained a newly characterized heat shock promoter (Phsp), amplified from an Enterococcus faecium plasmid, pAR6. Functionality and characterization of this promoter was initially performed by cloning Phsp into pNZ8008, a commercial lactococcal plasmid used for screening of putative promoters which utilizes gusA as a reporter. It was observed that Phsp was induced under heat, salinity and alkaline stresses or a combination of all three stresses. The newly characterized Phsp promoter was then used to construct a novel Lactobacillus vector, pAR1801 and its ability to express the gusA under stress-induced conditions was reproducible in both Lb. plantarum Pa21 and L. lactis M4 hosts. Ó 2014 Published by Elsevier Inc.
28 29 30 31 32 33 34 35 36 37 38 39 40
41 42
1. Introduction
43
Lactic acid bacteria (LAB) are ‘‘generally regarded as safe’’ (GRAS) organisms that are widely utilized as starter culture, food preservative and flavor enhancer in the food and beverage industry. LAB are also used for unconventional purposes including production of viral and eukaryotic proteins (Kunji et al., 2003; Madsen et al., 1999) and for vaccine delivery (Madsen et al., 1999; Ramasamy et al., 2006; Van Niel and Hahn-Hägerdal, 1999). In addition, the ability of LAB to secrete recombinant proteins directly into the culture medium increases the value of these bacteria. Advanced molecular technique tools are needed to produce LAB with desirable characteristics. As a result, Lactococcus lactis and Lactobacillus plantarum have
44 45 46 47 48 49 50 51 52 53 54 55
⇑ Corresponding author at: Department of Cell and Molecular Biology,
Q3
Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. E-mail address: [email protected] (R.A. Rahim).
become model microorganisms in LAB research due to the extensive development of molecular and post-genomics tools available for these two microorganisms (Fitzsimons et al., 1994; Hols et al., 1994; Jones et al., 2004; Pavan et Q4 al., 2000; Ramasamy et al., 2006). To date, various plasmid vectors have been constructed based on the origin of cryptic plasmids from several Lactobacillus and Lactococcus species, such as Lb. plantarum (Sorvig et al., 2005), Lactobacillus fermentum (Pavlova et al., 2002), Lactobacillus paracasei (Kojic et al., 2010) and L. lactis (Raha et al., 2006). While there are currently quite a few available plasmids for genetic modifications designed for these hosts, the number, variety and flexibility of these plasmids are still very much lacking compared to those available for Escherichia coli. Therefore, there is a need for development of new vectors for these hosts, especially those with special characteristics which can coalesce with the use of LAB in the food industry such as food-grade expression systems.
http://dx.doi.org/10.1016/j.plasmid.2014.05.003 0147-619X/Ó 2014 Published by Elsevier Inc.
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 2
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Pa21 was isolated from another Malaysian native plant, Pandanus amaryllifolius while Lb. plantarum ATCC14917 was purchased from American Type Culture Collection (ATCC). The E. faecium and Lb. plantarum strains were cultured aseptically as stand cultures in de Man Rogosa and Sharpe (MRS) broth media (Merck, Germany) for enrichment at 30 °C and 37 °C for 16 h, respectively. L. lactis M4 strain was cultured in M17 medium (Merck, Germany) containing 0.5% (w/v) glucose (GM17) at 30 °C for 16 h as stand cultures (Terzaghi and Sandine, 1975). Transformants were selected with the supplementation of chloramphenicol at a final concentration of 7.5 lg/ml and 5bromo-4-chloro-3-indolyl glucuronide (X-Gluc) (Fermentas, USA) at a final concentration of 0.5 mM on GM17 agar plates.
108
2.2. Promoter sequence analysis
123
The potential Pribnow box and 35 site of Phsp were predicted with BPROM (Softberry, USA), an online bacterial r70 promoter (major E. coli promoter class) recognition program with about 80% accuracy and specificity that can be accessed freely at (http://linux1.softberry.com/).
124
100
When it comes to expression of heterologous proteins, inducible promoters are preferred compared to constitutive promoters as they offer better control of gene expression, especially if the heterologous protein is toxic to the cell in high concentrations. In L. lactis, the nisin-controlled gene expression system (NICE) is the most commonly used system for heterologous protein production as it allows gene expression under the influence of the food-grade inducer, nisin (Mierau and Kleerebezem, 2005). However, nisin and many other inducers can be expensive and economically not practical in an industrial setting. Therefore, auto-inducible promoters are viable options as they do not need exogenous inducers to drive gene expression while allowing certain control over gene expression which can be manipulated by changing culture conditions. In this study, we characterize a heat-shock promoter, Phsp from Enterococcus faecium with the intention of using it to construct a novel Lactobacillus vector which can be auto-induced for expression of heterologous proteins under industrial conditions. The heat shock protein promoter (Phsp) was isolated from the enterococcal plasmid, pAR6 and was found to regulate the expression of a-crystallin heat shock protein (hsp) in the plasmid. Following characterization of Phsp, the promoter was exploited to develop a novel vector, pAR1801, which replicates in Lb. plantarum and L. lactis.
2.3. PCR amplification of Phsp and PLDH
129
101
2. Materials and methods
130
102
2.1. Bacterial strains, plasmids and culture conditions
103
Bacterial strains and plasmids used in this study are listed in Table 1. E. faecium HB6 harboring the plasmid, pAR6 was isolated and identified from the leaves’ surface of the indigenous Malaysian local herb, Andrographis paniculata. The plasmid free strain of Lactobacillus plantarum
The Phsp and PLDH (positive control) sequences were isolated from the previously isolated enterococcal plasmid pAR6 and Lb. plantarum ATCC14917 genomic DNA, respectively, by PCR amplification. Based on the pAR6 plasmid full sequence (GenBank accession no: KC167328) and Lb. plantarum L-(+)-lactate dehydrogenase promoter sequence (GenBank accession no: NZ_GL379768 NZ_ACGZ02000000), primers were carefully designed to include the Pribnow box (10), 35 sequence and
75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
104 105 106 107
Table 1 Bacterial strains and plasmids used in this study. Strain/plasmid
Relevant characteristics
Source
Strains L. lactis NZ9000 L. lactis M4 Lb. plantarum Pa18
Standard host strain, host strain for plasmid pNZ8008 Milk isolated host strain, host strain for plasmids pNZ8008Phsp and pNZ8008PLDH Malaysia local plant, Pandanus amaryllifolius isolate, pR18 host
Lb. plantarum Pa21
Malaysia local plant, Pandanus amaryllifolius isolate, plasmid-free strain
Lb. plantarum ATCC 14917 E. faecium HB6
Pickled cabbage isolated strain
Kuipers et al., 1998 Noreen et al., 2011 Microbial Biotechnology Lab, UPM Microbial Biotechnology Lab, UPM ATCC
Malaysian local herbal plant isolate
This study
Plasmid isolated from E. faecium HB6 Cmr, 4.9 kb, lactococcal vector carrying the gusA gene fused to the nisA promoter Cmr, 4.8 kb, lactococcal vector carrying the gusA gene fused to the Phsp promoter Cmr, 5.0 kb, lactococcal vector carrying the gusA gene fused to the PLDH promoter Cmr, 3.3 kb, L. lactis expression vector Cmr, 3.3 kb, pNZ8048 derivative, Pnis replaced with Phsp LinAr, 3.2 kb, Lb. plantarum Pa18 isolated plasmid Cmr, 3.6 kb, pR18 derivative, Lactobacillus expression vector harboring Phsp promoter Cmr, 5.4 kb, pAR1801 derivative, carrying gusA gene downstream of Phsp
This study de Ruyter et al., 1996 This study This study Kuipers et al., 1998 This study This study This study
Plasmids pAR6 pNZ8008 pNZ8008Phsp pNZ8008PLDH pNZ8048 pNZ8048-Phsp pR18 pAR1801 pAR1801-GUS
This study
ATCC, American Type Culture Collection.
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
109 110 111 112 113 114 115 116 117 118 119 120 121 122
125
126 127 128
131 132 133 134 135 136 137 138
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx Table 2 List of primers used in this study. Primer
Sequence (50 –30 )
PhspF
CGCGAGATCTCTATCATGAGTATTTACGAG
PhspR
AAGTCTGCAGGAGTTACGTTGTTGAATCTC
PLDHF
AGATAGATCTTACCAAAACAGGCCGAACCG
PLDHR
CTACTGCAGCAACAGCACCGTCGCCGACTA AATAGCGACGGAGAGTTAGG CCAGACTGAATGCCCACAGG
P8008flankF P8008flankR P8048cassetteF
TAGCGGCCGCCGACGGCAATAGTTACCCTT
P8048cassetteR
ATAGTCGACTTCTGCTCCCGCCCTTATGG
Pr18cassetteF
ATGTCGACCACTACGTTCGCCCTTGCTG
Pr18cassetteR
TGCGGCCGCACGTGTAAGTGCGCATTGTC
gusF
TACTGCAGtGAGGAGTCCCTTATGTTACG
gusR
ATATTCTAGACACTCGAGAAGCTTTCATTG
The primer nucleotides underlined were for introducing restriction sites. The start (ATG) and stop (TCA) codon is shown in bold.
139 140 141 142 143 144 145 146 147 148 149 150 151 152 153
ribosome binding site (RBS). The sequences of all primers are shown in Table 2. PCR amplification of the Phsp and PLDH sequences were carried out with Pfu DNA polymerase (Fermentas, USA). The PCR reaction mix comprised of 1 PCR Buffer with MgSO4 (Fermentas, USA), 0.2 mM of dNTP Mix (Fermentas, USA), 0.08 mM of forward and reverse primers for each sequences, respectively, 200 ng of template and 1.25 U/lL of Pfu DNA polymerase. The PCR reaction was initiated with denaturation of template at 95 °C for 5 min, followed by 25 cycles of template denaturation at 95 °C for 1 min, primer annealing at 63 °C for 1 min and extension at 72 °C for 1 min. Final extension was performed at 72 °C for 5 min. A negative control reaction without template DNA was carried out under the same conditions.
3
minor modifications. The GUS activity was calculated spectrophotometrically as nmoles/min/mg protein unit using para-nitrophenyl-b-D-glucuronic acid (PNPG) as the substrate. Total protein concentration was determined using Bradford assay.
176
2.6. Stress test
181
Stress response of Phsp was studied in triplicates by growing L. lactis M4 harboring pNZ8008Phsp under heat, salt and pH stresses or a combination of stress conditions. For heat stress, cells were grown at 37 °C compared to the normal growth temperature of 30 °C. For salinity stress, cells were grown at NaCl concentrations of 1–5% (w/v) and for pH stress, cells were grown at pH 5–10 (normal growth condition is pH 7). The stress response tests were replicated for Lb. plantarum harboring pAR1801-GUS. In all cases, cell densities were normalized for GUS activity reading.
182
2.7. Construction of Lactobacillus–Lactococcus shuttle vector
193
The new shuttle vector, pAR1801 was constructed as shown in Fig. 1. The expression vector was developed based on a combination of the Lactobacillus plasmid, pR18 and the lactococcal plasmid, pNZ8048. The Pnis of pNZ8048 was first replaced by Phsp at the BglII and PstI sites. A fragment containing the chloramphenicol resistance gene, Phsp, MCS and terminator sequence was then amplified using primers P8048cassetteF and P8048cassetteR (Table 2). This fragment was digested with NotI and SalI and fused with the fragment containing the pR18 replicative backbone which was amplified using the primers pR18cassetteF and pR18cassetteR. The newly constructed plasmid was transformed into Lb. plantarum Pa21 host according to the protocol described by Alegre et al. (2004) with minor modifications. Plasmids were then isolated from the positive transformants and were confirmed by sequencing. The gusA gene was then cloned into the MCS of the newly constructed pAR1801 vector via the PstI and XbaI sites, resulting with pAR1801-GUS. The PstI and XbaI RE sites were introduced into the gusA gene by PCR amplification of gusA using the gusF and gusR primers. The ligated pAR1801 vector containing gusA was then transformed into Lb. plantarum Pa21 and L. lactis M4 hosts. The positive transformants were verified by X-gluc selective agar plates, plasmid extraction followed by RE digestion of the plasmid prep.
194
177 178 179 180
183 184 185 186 187 188 189 190 191 192
195 196 197 198 199 200 201 202 203 204 205 206 207
154
2.4. Cloning of Phsp and PLDH into pNZ8008
155
165
Phsp and PLDH were cloned into pNZ8008 at the BglII and PstI sites, displacing the original Pnis promoter. The recombinant plasmid was transformed into L. lactis M4 via electroporation as described by Holo and Nes (1989) with minor modifications. The transformants were screened on SGM17 (GM17 supplemented with 0.5 M sucrose) containing 7.5 lg/mL chloramphenicol after incubation at 30 °C for 24–48 h. The pNZ8008Phsp and pNZ8008PLDH recombinant plasmids were verified by X-Gluc selective agar plates and BglII/PstI double restriction enzyme digestion of the isolated plasmid.
166
2.5. Assay for GUS activity
2.8. Stability of the plasmid in Lb. plantarum and L. lactis
221
167
Positive transformants were indicated by positive GUS activity which yielded blue colonies on GM17 chloramphenicol plates supplemented with 0.5 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) (Fermentas, USA). L. lactis M4 harboring pNZ8008Phsp were grown under different stress condition (see following section for types of stress conditions) until the cells reached stationary phase. Quantitative GUS assay was conducted as described by de Ruyter et al. (1996) with
Plasmid stability test was carried out as described by Imanaka and Aiba (1981) with minor modifications. Overnight cultures of Lb. plantarum Pa21-pAR1801 and L. lactis M4-pAR1801 were diluted (1:100) in GM17 and MRS broth, respectively, without chloramphenicol. The cultures were allowed to grow continuously at the log phase by inoculation into fresh media for 100 generations (65 generations for L. lactis M4-pAR1801). The cells were then spread onto GM17 and MRS agar, respectively, and incu-
222
156 157 158 159 160 161 162 163 164
168 169 170 171 172 173 174 175
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
208 209 210 211 212 213 214 215 216 217 218 219 220
223 224 225 226 227 228 229 230
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 4
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Fig. 1. Schematic diagram showing the construction of a new Lactobacillus–Lactococcus shuttle expression vector, pAR1801 and the cloning of gusA gene into the vector. A fragment containing the chloramphenicol resistance gene, Phsp, MCS and terminator sequence from pNZ8048Phsp was amplified and fused with the fragment containing the pR18 replicative backbone.
231 232 233 234 235 236
bated at 30 °C for 16 h. A total of 100 colonies of L. lactis NZ-pAR1801 and Lb. plantarum Pa21-pAR1801 were picked randomly and sub-cultured on GM17 and MRS agar supplemented with chloramphenicol. The number of colonies which were able to grow was counted and calculated as a percentage of plasmid stability.
237
3. Results and discussion
238
3.1. Promoter sequence analysis
239
The heat shock protein promoter (Phsp) regulates the expression of a-crystallin heat shock protein (hsp) in the isolated enterococcal pAR6 plasmid. The a-crystallin hsp is a small hsp that plays a role as a molecular chaperone which helps the protein to fold under stress conditions (Han et al., 2008; Narberhaus, 2002; Yura et al., 1993). As per previous findings, the Phsp characterized in the current study was not limited to heat stress alone and was found to be triggered under various stress conditions such as high salinity and high pH. The Phsp promoter was identified by sequence analysis of pAR6 which brought to the finding of a potential Pribnow box (10), 35 site, ribosome binding site (RBS), start codon and class three stress gene repressor (CtsR) binding site as shown in Fig. 2. Moreover, the RBS sequence (GAAAG) which is similar with the RBS sequence of Phsp from the Streptococcus thermophilus plasmid pER341 was identified upstream from the start codon, ATG (Somkuti et al., 1998). The CtsR binding site was detected based on
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257
the conserved heptanucleotide sequence described by Derre et al. (1996, 1999) and Fiocco et al. (2009a,b) located Q5 between the 10 and 35 binding site. Multiple sequence alignment analysis (ClustalW) showed that the Phsp sequence of pAR6 is highly similar with plasmid pJS33 from E. faecium strain JH95 (GenBank accession no: EU370687.1) and plasmid pEFR from E. faecium (GenBank accession no: AF511037.1) with the difference of only one nucleic acid. Regulation of protein expression by the Phsp system under stress condition is controlled by CtsR, which is found in Gram-positive bacteria (Derre et al., 1999; Fiocco et al., 2009a; Kruger and Hecker, 1998; Varmanen et al., 2000). CtsR recognition sequences are highly conserved in this group of bacteria with the presence of a tandem heptanucleotide repeat of A/GGTCAAA/T in the promoter sequence (Derre et al., 1999, 2000). The tandem heptanucleotide repeat was identified as AGTCAAA AAA GGTCAGT which is identical to the consensus sequence of RGTCADN NAN RGTCADN among low G + C Gram-positive bacteria (5, 6, 10). CtsR negatively regulates Phsp by binding specifically at the transcriptional start site between 10 and 35 regions although the promoter is able to constitutively express at low levels under normal non-stress conditions (Kruger and Hecker, 1998). This means that Phsp is not tightly regulated which is what was observed in the current study as low level of GUS activity could be detected under non-stress conditions (data not shown). Under stressed conditions, the classical winged helix-turn-helix (HTH) dimeric DNA-binding protein of CtsR undergoes structural change and deregulates the promoter allowing
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
5
Fig. 2. Nucleotide sequence of Phsp promoter. The potential Pribnow box (10), 35 and ribosome binding site (RBS) are underlined. The amino acid sequence indicates the open reading frame of the hsp gene. The start codon (ATG) is indicated with capital letters. Class three stress gene repressor (CtsR) binding site is in box.
289 290
for the RNA polymerase ErA holoenzyme to bind and start the transcription process (Elsholz et al., 2010, 2011).
291
3.2. Verification of Phsp functionality
292
306
In order to verify the functionality of Phsp which was identified by sequence analysis, the promoter was amplified and cloned into the lactococcal vector, pNZ8008. The vector, pNZ8008 is a promoter screening vector which allows the original Pnis to be displaced by putative promoters which drives the expression of the downstream gusA reporter gene. The resulting pNZ8008Phsp plasmid was transformed into the L. lactis M4 host. Apart from chloramphenicol selection, positive transformants were also selected by formation of blue colonies caused by the breakdown of the X-Gluc substrate by the GUS enzyme. Therefore, the formation of blue colonies confirms the functionality of Phsp which was able to drive the expression of the gusA gene. PLDH was also cloned into pNZ8008 as a positive control.
307
3.3. Stress response challenge
308
L. lactis M4 harboring pNZ8008Phsp was induced under heat, salt, pH and a combination of stresses mimicking industrial stress conditions such as cheese making (Ahmed et al., 2006) or as starter cultures in alkaline fermented food such as Spanish-style green olives (Sanchez et al., 2001). The strength of the promoter in response to stress was measured based on GUS activity which was quantified spectrophotometrically. The pNZ8008PLDH vector containing the Lactobacillus PLDH promoter (Chaillou et al., 1998; Oozeer et al., 2005) was utilized as a positive control to compare the strength of Phsp with an established LAB strong promoter in L. lactis M4 host. Heat stress was performed at 37 °C since cell growth was disrupted at temperatures higher than that. Cells cultured at 37 °C exhibited higher expression levels of gusA compared to expression at 30 °C with 548.16 and 382.61 unit, respectively, as seen in Fig. 3. Salt stress was conducted with the addition of 1–5% (w/v) NaCl in GM17 chloramphenicol broth. However, cell growths were halted at salt concentration higher than 3% and could not be analyzed for GUS activity. Cells grown at 3% (w/v) salt (Fig. 3) gave a significantly higher reading for GUS activity at 1027.13 units
293 294 295 296 297 298 299 300 301 302 303 304 305
309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329
compared to 1% (w/v) NaCl (580.73 units) and 2% (w/v) NaCl (774.97 units), respectively. For pH stress, pH 5–10 was chosen in this study as cells were unable to grow outside of this range although a pH range of 4.0–5.0 and 7.5– 8.0 were reported to be the lower and higher limit, respectively, for Lactococcus lactis depending on the medium composition and strain (34, 38). The GUS activity was found to be directly proportional with increasing pH where the highest GUS activity was found at pH 10 (1006.31 units). The information obtained from the GUS activity under all the stresses mentioned above were then used to maximize protein expression. Initially, the cells were cultured in a combination of stress conditions at 37 °C, 3% (w/v) salt concentration and pH 10. However, the harsh conditions limited the growth of the cells and resulted in undetectable GUS enzyme activity. When the conditions were altered by lowering the pH to 9, cell growth was permitted and GUS activity was detected and calculated. Although this combination of stress gave the highest GUS formation reaction (based on slope of graph of OD405nm vs time; data not shown here), specific activity was only at 981.97 units, slightly lower than readings from 3% salt concentration and pH 10. This was because it was observed that amount of total protein produced was proportional with the amount of stress subjected to the cells. PLDH, which was used as the positive control gave 1544.72 units reading.
330
3.4. Construction of Lactobacillus expression vector
357
The newly characterized Phsp was used to construct a new Lactobacillus vector, pAR1801 using the replicative backbone of pR18, a cryptic plasmid isolated from Lb. plantarum Pa18. Although pAR1801 contained the Lactobacillus replicative backbone, thereby allowing it to be stably maintained in Lb. plantarum Pa21, it was also found to be able to replicate in L. lactis M4 although not as stably as in Lb. plantarum Pa21 as plasmids were lost after 65 generations. Lb. plantarum Pa21 harboring pAR1801-GUS was also subjected to the stress tests previously described for L. lactis M4 harboring pNZ8008-Phsp and results were found to be similar (Fig. 4), showing that Phsp functioned in the same way in the newly constructed pAR1801 as in pNZ8008-Phsp. The general pattern observed was that GUS specific activity increased with increasing stress.
358
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
359 360 361 362 363 364 365 366 367 368 369 370 371 372
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 6
M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx
Fig. 3. GUS activity profile of L. lactis M4 harboring pNZ8008Phsp in response to heat, salt and pH stress or a combination of stresses. PLDH indicates the positive control.
Fig. 4. GUS activity profile of Lb. plantarum Pa21 harboring pAR1801-GUS in response to heat, salt and pH stress or a combination of stresses. PLDH indicates the positive control.
373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397
However, for Pa21(pAR1801-GUS), 3% salt stress gave the highest GUS activity followed by a combination of stresses. Although Phsp was isolated from E. faecium HB6, the existence of the CtsR concensus region in other Gram-positive bacteria indicated that Phsp could also function in Lactococcus and Lactobacillus sp. This was clearly proven by the expression of gusA in the stress response experiments using both L. lactis M4 and Lb. plantarum Pa21 hosts. Apart from demonstrating the functionality of Phsp, the construction of the novel vector, pAR1801 also serves as an alternative to the current existing vectors for gene manipulation. The new pAR1801 is valuable as it can potentially be used in harsh conditions such as those found in an industrial setting. For example, Lactobacillus and Lactococcus are commonly used as starter cultures in dairies and fermented food. Although Phsp was not highly induced under low pH which is usually the condition in dairy industries, some processes like curd processing in cheese-making require high temperatures from 35 to 55 °C which will still induce Phsp. Also, salt which is commonly added as flavor in food can double up as an inducer for Phsp expressing an enzyme of interest, for example, glutamate dehydrogenase, which is able to stimulate amino acid conversion to aromatic compounds (Tanous et al., 2006). The ability of Phsp to be auto-induced by stress negates the need for
expensive inducers such as nisin which is the food-grade inducer for the most commonly used NICE expression system in L. lactis (Mierau and Kleerebezem, 2005). While induction of the Phsp in this study was limited by the ability of Lb. plantarum and L. lactis to grow under extremely harsh conditions, it will be interesting to see if Phsp can also be functional in other extremophiles and if gene expression regulated by Phsp can be further increased under more extreme conditions.
398
4. Conclusion
407
A novel vector, pAR1801, which could replicate in both Lb. plantarum and L. lactis was constructed in this study. This vector contained Phsp, a promoter induced by heat, salt and alkaline stress which was able to drive the expression of gusA at about 65% strength of PLDH which is established to be a strong constitutive promoter.
408
5. Uncited references
414
Cotter and Hill (2003), de Vos (1987), Kok et al. (1984), Mercenier et al. (2000), Rossi et al. (2001), Sanchez et al. Q6 (2008), Van Roosmalen et al. (2006).
415
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
399 400 401 402 403 404 405 406
409 410 411 412 413
416 417
YPLAS 2207
No. of Pages 7, Model 3G
31 May 2014 M.S.T. Maidin et al. / Plasmid xxx (2014) xxx–xxx 418
Acknowledgments
419 421
This work was supported by a research grant from the Ministry of Science, Technology and Innovation of Malaysia under the grant number 02-01-04-SF1608.
422
References
423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491
Ahmed, T., Kanwal, R., Ayub, N., 2006. Influence of temperature on growth pattern of Lactococcus lactis, Streptococcus cremoris and Lactobacillus acidophilus isolated from camel milk. Biotechnology 5, 481–486. Alegre, M.T., Rodriguez, M.C., Mesas, J.M., 2004. Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA. FEMS. Microbiol. Lett. 241 (73), 77. Chaillou, S., Postma, P.W., Pouwels, P.H., 1998. Functional expression in Lactobacillus plantarum of xylP encoding the isoprimeverose transporter of Lactobacillus pentosus. J. Bacteriol. 180, 4011–4014. Cotter, P.D., Hill, C., 2003. Surviving the acid test: responses of grampositive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67, 429–453. de Ruyter, P.G., Kuipers, O.P., Beerthuyzen, M.M., van Alen-Boerrigter, I., de Vos, W.M., 1996. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J. Bacteriol. 178, 3434–3439. Derre, I., Rapoport, G., Msadek, T., 1999. CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol. Microbiol. 31, 117–131. Derre, I., Rapoport, G., Msadek, T., 2000. The CtsR regulator of stress response is active as a dimer and specifically degraded in vivo at 37 degrees C. Mol. Microbiol. 38 (335), 347. de Vos, W.M., 1987. Gene cloning and expression in lactic streptococci. FEMS. Microbiol. Rev. 46, 281–295. Elsholz, A.K., Hempel, K., Pother, D.C., Becher, D., Hecker, M., Gerth, U., 2011. CtsR inactivation during thiol-specific stress in low GC, Gram+ bacteria. Mol. Microbiol. 79, 772–785. Elsholz, A.K., Michalik, S., Zuhlke, D., Hecker, M., Gerth, U., 2010. CtsR, the gram positive master regulator of protein quality control, feels the heat. EMBO J. 29 (3621), 3629. Fiocco, D., Capozzi, V., Collins, M., Gallone, A., Hols, P., Guzzo, J., Weidmann, S., Rieu, A., Msadek, T., Spano, G., 2009a. Characterization of the CtsR stress response regulon in Lactobacillus plantarum. J. Bacteriol. 192, 896–900. Fiocco, D., Collins, M., Muscariello, L., Hols, P., Kleerebezem, M., Msadek, T., Spano, G., 2009b. The Lactobacillus plantarum ftsH gene is a novel member of the CtsR stress response regulon. J. Bacteriol. 191, 1688– 1694. Fitzsimons, A., Hols, P., Jore, J., Leer, R.J., O’Connell, M., Delcour, J., 1994. Development of an amylolytic Lactobacillus plantarum silage strain expressing the Lactobacillus amylovorus alpha-amylase gene. Appl. Environ. Microbiol. 60, 3529–3553. Han, M.J., Yun, H., Lee, S.Y., 2008. Microbial small heat shock proteins and their use in biotechnology. Biotechnol. Adv. 26, 591–609. Holo, H., Nes, I.F., 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55, 3119–3123. Hols, P., Ferain, T., Garmyn, D., Bernard, N., Delcour, J., 1994. Use of homologous expression-secretion signals and vector-free stable chromosomal integration in engineering of Lactobacillus plantarum for a-amylase and levanase expression. Appl. Environ. Microbiol. 60, 1401–1413. Imanaka, T., Aiba, S., 1981. A perspective on the application of genetic engineering: stability of recombinant plasmid. Ann. NY. Acad. Sci. 369, 1–14. Jones, M.L., Chen, H., Ouyang, W., Metz, T., Prakash, S., 2004. Microencapsulated genetically engineered Lactobacillus plantarum 80 (pCBH1) acid deconjugation and its implication in lowering cholesterol. J. Biomed. Biotechnol. 1, 61–69. Kojic, M., Lozo, J., Jovcic, B., Strahinic, I., Fira, D., Topisirovic, L., 2010. A successful use of a new shuttle cloning vector Pa13 for the cloning of the bacteriocins BACSJ and ACIDOCIN 8912. Arch. Biol. Sci. 62, 231– 243. Kok, J., van der Vossen, J.M.B.M., Venema, G., 1984. Construction of plasmid cloning vectors for lactic streptococci which also replicate in Bacillus subtilis and Escherichia coli. Appl. Environ. Microbiol. 48, 726– 731. Kruger, E., Hecker, M., 1998. The first gene of the Bacillus subtilis clpC operon, ctsR, encodes a negative regulator of its own operon and other class III heat shock genes. J. Bacteriol. 180, 6681–6688.
420
7
Kuipers, O.P., de Ruyter, P.G.G.A., Kleerebezem, M., de Vos, W.M., 1998. Quorum sensing controlled gene expression in lactic acid bacteria. J. Biotechnol. 64, 15–21. Kunji, E.R.S., Slotboom, D.J., Poolman, B., 2003. Lactococcus lactis as host for overproduction of functional membrane proteins. Biochim. Biophys. Acta. 1610, 97–108. Madsen, S.M., Arnau, J., Vrang, A., Givskov, M., Israelsen, H., 1999. Molecular characterization of the pH-inducible and growth phasedependent promoter P170 of Lactococcus lactis. Mol. Microbiol. 32, 75–87. Mercenier, A., Muller-Alouf, H., Grangette, C., 2000. Lactic acid bacteria as live vaccines. Curr. Issues. Mol. Biol. 2, 17–25. Mierau, I., Kleerebezem, M., 2005. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl. Microbiol. Biotechnol. 68, 705–717. Narberhaus, F., 2002. Alpha-crystallin-type heat shock proteins: socializing minichaperones in the context of a multichaperone network. Microbiol. Mol. Biol. Rev. 66, 64–93. Noreen, N., Hooi, W.Y., Baradaran, A., Rosfarizan, M., Sieo, C.C., Rosli, M.I., Yusoff, K., Raha, A.R., 2011. Lactococcus lactis M4, a potential host for the expression of heterologous proteins. Microb. Cell Fact. 10, 28. Oozeer, R., Furet, J.P., Goupil-Feuillerat, N., Anba, J., Mengaud, J., Corthier, G., 2005. Differential activities of four Lactobacillus casei promoters during bacterial transit through the gastrointestinal tracts of human-microbiota-associated mice. Appl. Environ. Microbiol. 71, 1356–1363. Pavan, S., Hols, P., Delcour, J., Geoffroy, M.C., Grangette, C., Kleerebezem, M., Mercenier, A., 2000. Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Appl. Environ. Microbiol. 66, 4427–4432. Pavlova, S.L., Kilic, A.O., Topisirovic, L., Miladinov, N., Hatzos, C., Tao, L., 2002. Characterisation of a cryptic plasmid from Lactobacillus fermentum KC5b and its use for constructing a stable Lactobacillus cloning vector. Plasmid 47, 182–192. Raha, A.R., Hooi, W.Y., Mariana, N.S., Radu, S., Varma, N.R., Yusoff, K., 2006. DNA sequence analysis of a small cryptic plasmid from Lactococcus lactis subsp. lactis M[14]. Plasmid 56, 53–61. Ramasamy, R., Yasawardena, S., Zomer, A., Venema, G., Kok, J., Leenhouts, K., 2006. Immunogenicity of a malaria parasite antigen displayed by Lactococcus lactis in oral immunisations. Vaccine 24, 3900–3908. Rossi, F., Rudella, A., Marzotto, M., Dellaglio, F., 2001. Vector-free cloning of a bacterial endo 1,4-b-glucanase in Lactobacillus plantarum and its effect on the acidifying activity in silage: use of a recombinant cellulolytic Lactobacillus plantarum as silage inoculant. Antonie Leeuwenhoek 80, 139–147. Sanchez, A.-H., Rejano, L., MontanÕ, A., de Castro, A., 2001. Utilization at high pH of starter cultures of lactobacilli for Spanish-style green olive fermentation. Int. J. Food Microbiol. 67, 115–122. Sanchez, C., Neves, A.R., Cavalheiro, J., dos Santos, M.M., Garcia-Quintans, N., Lopez, P., Santos, H., 2008. Contribution of citrate metabolism to the growth of Lactococcus lactis CRL[264] at low pH. Appl. Environ. Microbiol. 74, 1136–1144. Somkuti, G.A., Solaiman, D.K., Steinberg, D.H., 1998. Structural and functional properties of the hsp l6.4-bearing plasmid pER341 in Streptococcus thermophilus. Plasmid 40, 61–72. Sorvig, E., Mathiesen, G., Naterstad, K., Eijsink, V.G., Axelsson, L., 2005. High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiology 151, 2439–2449. Tanous, C., Chambellon, E., Delespaul, G., Yvon, M., 2006. Glutamate dehydrogenase activity can be naturally transmitted to Lactococcus lactis strains to stimulate the amino acid conversion to aroma compounds. Appl Environ Microbiol. 72, 1402–1409. Terzaghi, B.E., Sandine, W.E., 1975. Improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29, 807–813. Van Niel, E.W.J., Hahn-Hägerdal, B., 1999. Nutrients requirements of lactococci in defined growth media. Appl. Microbiol. Biotechnol. 52, 617–627. Van Roosmalen, M.L., Kanninga, R., El Khattabi, M., Neef, J., Audouy, S., Bosma, T., Kuipers, A., Post, E., Steen, A., Kok, J., Buist, G., Kuipers, O.P., Robillard, G., Leenhouts, K., 2006. Mucosal vaccine delivery of antigens tightly bound to an adjuvant particle made from foodgrade bacteria. Methods 38, 144–149. Varmanen, P., lngmer, H., Vogensen, F.K., 2000. ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology 146, 1447–1455. Yura, T., Nagai, H., Mori, H., 1993. Regulation of the heat-shock response in bacteria. Annu. Rev. Microbial. 47, 321–350.
492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571
Please cite this article in press as: Maidin, M.S.T., et al. Construction of a novel inducible expression vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21. Plasmid (2014), http://dx.doi.org/10.1016/j.plasmid.2014.05.003
