486
MOLECULAR BIOLOGY
[53]
[53] C l o n i n g o f L e u k o t r i e n e A 4 H y d r o l a s e c D N A By
OLOF R~DMARK, COLIN FUNK, J! YI Fu, TAKASHI MATSUMOTO, HANS JORNVALL, BENGT SAMUELSSON, MICHIKO MINAMI, SHIGEO OHNO, HIROSHI KAWASAKI,YOUSUKE SEYAMA, KOICHI SUZUKI, and TAKAO SHIM1ZU
Leukotriene A4 hydrolase (EC 3.3.2.6) is a soluble epoxide hydrolase which catalyzes the enzymatic hydrolysis of leukotriene A4 (LTA4) to the chemotactic agent leukotriene B4.1 After initial purification and characterization of the enzyme, 2 it was determined to be different from other epoxide hydrolases, and further studies were initiated. The cloning of LTA4 hydrolase was carried out successfully using two different strategies, i.e., screening ofhgtl 1 cDNA libraries (which express recombinant protein) with polyclonal antiserum, and screening of a hgtl0 cDNA library with a single isomer oligonucleotide probe (48-mer) whose structure was based on mammalian codon usage frequencies. 3"4 Prior to this, screening of plasmid (pBR322) cDNA libraries with mixed shorter oligonucleotide probes (16-mers) was unsuccessful. Thus, the use of better quality cDNA synthesized according to the RNase H method, 5 in hgt 10/11 vectors, 6 as well as the use of more efficient probes, were beneficial. Identification of Clones Using Antiserum A commercially available hgtl I cDNA library (Clontech, Palo Alto, CA) constructed from human lung poly(A) RNA was screened with polyclonal antiserum. The serum was obtained from rabbits injected with LTA4 hydrolase purified from human leukocytes. 2 In addition to the regular purification procedure, the enzyme used as antigen was further refined by SDS-polyacrylamide gel electrophoresis according to Laemmli. 7 For each I p . B o r g e a t , a n d B . S a m u e l s s o n , Proc. Natl. Acad. Sci. U.S.A. 7 6 , 3213 (1979).
20. Rfidmark,T. Shimizu, H. Jfrnvall, and B. Samuelsson,J. Biol. Chem. 259, 12339 (1984). 3 C. D. Funk, O. Rfidmark, J. Y. Fu, T. Matsumoto, H. Jrrnvall, T. Shimizu, and B. Samuelsson,Proc. Natl. Acad. Sci. U.S.A. 84, 6677 (1987). 4 M. Minami,S. Ohno, H. Kawasaki,O. Rfidmark,B. Samuelsson,H. JOrnvall,T. Shimizu, Y. Seyama,and K. Suzuki,J. Biol. Chem. 262, 13873(1987). 5 U. Gublerand B. J. Hoffman,Gene 25, 263. (1983). 6 T. V. Huynh,R. A. Young,and R. W. Davis, in "DNACloning"(D. M. Glover,ed.), Vol. 1, pp. 49-78. IRL, Oxford, 1983. 7 U. K. Laemmli,Nature (London)227, 680 (1970). METHODS IN ENZYMOLOGY, VOL. 187
Copyright © 1990by Academic Press, Inc. All rights of reproduction in any form reserved.
[53]
CLONING OF
LTA4HYDROLASE c D N A
487
booster, a gel slice containing approx 40/~g of protein is homogenized in PBS (I ml) plus Freund's complete adjuvant (1 ml) and injected. The specificity of the antiserum was estimated from Western blots. The proteins in the 10,000 g supernatant (50/xl) obtained after sonication of a human leukocyte suspension (108 cells/ml) are separated by electrophoresis in SDS-polyacrylamide (8% gel) and electroblotted 8 to nitrocellulose (Hybond C, Amersham, Buckinghamshire, England). When probed with the antiserum (1 : 100) one major band appeared, with the same retention as standard LTA4 hydrolase. In some samples, bands also appeared at MW 50,000-55,000, probably representing breakdown products of LTA4 hydrolase. Before use in the screening of hgtl 1 libraries, antibodies reactive to Escherichia coli epitopes were removed as described. 6 Briefly, a suspension of nontransformed E. coli is sonicated and nitrocellulose filters are soaked with this lysate. After washing the filters with TBS (50 mM TrisHCI, pH 8; 100 mM NaC1), they are soaked with the antiserum (1 : 10, v/v in TBS), thus binding antibodies that recognize E. coli proteins. The purified antiserum is diluted further to 1 : 100, v/v and used in screening as described. 6 P h a g e (104 per plate) are plated on E. coli Y 1090 and incubated at 42 ° for 3.5 hr. The plates are then overlaid with nitrocellulose filters (Millipore HATF) presoaked with 10 mM isopropyl-/3-o-galactoside (IPTG), in order to induce synthesis of recombinant protein. After further incubation at 37 ° for 3.5 to 4 hr, or preferably overnight, filters are removed, briefly airdried, and washed with TBS. Filters are treated with 20% fetal calf serum in TBS for 30 min (blocking) and incubated with the antiserum for 2 hr at room temperature. Next, filters are washed with TBS, TBS plus 0.1% Nonidet (NP-40) (Sigma, St. Louis, MO), and again with TBS (5 min each), before incubation in a solution of ~25I-labeled protein A in TBS plus 20% fetal calf serum for 1 hr at room temperature. The specific activity of ~25I-iabeled protein A is 1110 MBq/mg (Amersham IM 144). Typically 106 cpm per filter (82 mm) is used and the volume is 2-5 mi/filter. After repeated washing, filters are air-dried and autoradiographed at - 7 0 ° for 1 to 2 days (Fuji RX film) with an intensifying screen. Putative positive clones are carried through two or three additional rounds of screening at reduced density until homogeneous clones are obtained. In the original procedure, 6 incubation of IPTG-impregnated filters on the plates for 3.5 to 4 hr at 37°, prior to probing with antiserum, was recommended. In our hands, incubation overnight gives much clearer results. Thus, a clone blurt6-1 was isolated from a human lung hgtl 1 cDNA 8 H. Towbin, T. Staehelin, and J. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4350 ( 19791.
488
MOLECULAR BIOLOGY
1
A 2
3
1
B 2
3
[53]
1
C 2
3
kDa
67--
;30--
FIG. 1. Antibody selection assay of clone MuH6°I. The clone is plated lytically and synthesis of lacZ fusion protein induced by IPTG on overlaid nitrocellulose filters. Proteins transferred to the filters are incubated with LTA4 hydrolase antiserum (1 : 100 dilution, 10 ml). Antibodies selectively bound are eluted at pH 2.6 and immediately neutralized to pH 8.0. Human leukocyte LTA4 hydrolase (200 ng, lanes 1; 400 ng, lanes 2; 800 ng, lanes 3) is subjected to electrophoresis in an 8% SDS-polyacrylamide gel, transferred to nitrocellulose, and allowed to react with the selected antibodies. (A) Antibodies selected from clone Mull6-1; (B) antibodies selected from the parent vector hgtll, lacking a cDNA insert; (C) non-selected LTA4 hydrolase antiserum (1 : 100 dilution, 10 ml). Markers indicate retentions of bovine serum albumin (67 kDa) and carbonate dehydratase (30 kDa).
library. Antibody selection assay (Fig. 1) confirmed the identity of this clone. When digested with EcoRI two inserts were found, around 200 and 570 base pairs (bp), respectively. These were separated and religated to h arms by standard procedures 9 and the ligation mixture added to a phage protein extract (Promega, WI, according to the manufacturer) to give 9 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982.
[53]
CLONING OF L T A 4 HYDROLASE c D N A
489
infectious phages. When screened with the antiserum, only some phages containing the shorter (200 bp) insert (blurt6-la) gave positive signals, thus indicating that nonrelated cDNAs were ligated together in one clone in the cDNA synthesis. The insert of blurt6- la was subcloned in M 13 for production of single-strand DNA which was sequenced by the Sanger dideoxy chain-termination method. A coding sequence was found, corresponding to 29 amino acids of a CNBr fragment of LTA4 hydrolase. This identified MuH6-1a as a partial LTA4 hydrolase cDNA clone. The sequence of the 570 bp fragment of Mull6-1 was also determined; it was subsequently confirmed that it had no relation to the LTA4 hydrolase cDNA clones. The artifact of one clone carrying multiple nonrelated inserts was encountered once more in the further screening for longer clones. Thus the insert of blurt6-1 a was labeled by nick translation and the same lung hgt I 1 cDNA library screened by plaque hybridization. In this procedure, phages are plated on E. coli Y1090 and grown for 6 hr at 37°. Nitrocellulose filters (Millipore HATF) are overlaid for 1 min and processed as described. 9 5 × 105 clones were screened; the longest clone hybridizing with hluH6-1a gave two inserts upon EcoRI digestion (770 and 405 bp). Sequencing showed that the 405 bp fragment overlaps with hluH6-1a. The 770 bp fragment, however, had multiple termination codons in all reading frames, and was judged as nonrelated. Full-length cDNA was isolated from a human placenta hgtl 1 library, also from Clontech. Here, 4 x 105 clones were screened, and 19 clones that hybridized strongly exhibited a characteristic 1.1 kb/0.8 kb double insert pattern after EcoRI digestion, indicating the presence of an internal EcoRI site. The original hluH6-1a hybridized to the 0.8 kb insert. Appropriate restriction fragments of a clone kpll6A were subcloned in M13 and sequenced, hpll6A contained a 1910 bp insert (excluding the EcoRI linkers) with a continuous reading frame of 1830 bp terminated by a stop codon (TAA), encoding a protein of 610 amino acids. The noncoding regions were short, especially at the 3' end (47 bp) and a polyadenylation signal as well as poly(A) tail were lacking. This is explained by the presence of another internal EcoRI site (see below: cloning with 48-mer). Screening with 48-mer A 48-mer oligonucleotide was designed from the amino acid sequence of a cyanogen bromide fragment of LTA hydrolase, according to the mammalian codon usage frequencies (see Fig. 2)4.1° An 8-mer primer, complementary to the 5' end of the 48-mer is also prepared. Two complementary probes are labeled with 32p as follows. First, the 48-mer is phos~o R. Lathe, J. Mol. Biol. 183, 1 (1985).
490 Primer Probe
MOLECULAR BIOLOGY E8 E48
3'-TGTTCAGG-5' 5 '- A A G T T C A C C C G G C C C C T G T T C A A G G A C C T G G C C G C C T T T G A C A A G T C C .
LTA85 Peptide
[53l
(1696-1743) #I I
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
°
.
.
.
.
.
.
3' °
, ° °
AAGTTTACCCGGCCCTTATTCAAGGATCTTGCTGCCTTTGACAAATCC LysPheThrArgProLeuPheLysAspLeuAlaAlaPheAspLysSer
FIG. 2. Sequence of oligonucleotide probe. The 48-mer oligonucleotide and antistrand 8-mer oligonucleotide primer are synthesized, based on the sequence of a LTA4 hydrolase CNBr fragment [peptide 11 (ref. 4) ]. The corresponding sequence found in clone LTA85 was homologous (about 85%) to the probe E48.
phorylated at the 5' end, using [A-32p]ATP and T4 polynucleotide kinase. The 8-mer primer dissolved in annealing buffer (50 mM Tris-HCl, pH 7.5) is added to give a ratio of 50 pmol of 8-mer per 10 pmol of 48-mer. After incubation, first at 85 ° for 5 min, and then at 65 ° for 10 min, the mixture is gradually cooled to room temperature during more than 1 hr. Additions are now made to the annealed mixture to give a final volume of 50/xl containing 1 mM dGTP, I mM dATP, 1 mM dTTP, 10/.tCi [a-32p]dCTP (3000 Ci/ mmol, Du Pont), 10 mM MgC12, and 10 mM dithiothreitol. The Klenow fragment of DNA polymerase I is added and the mixture incubated for 1 hr at 12°. After addition of unlabeled dCTP (1 raM), the incubation is continued for another 20 min to complete the synthesis of antistrand oligonucleotide. Unincorporated radioactivity is removed by gel filtration on Sephadex G-50. A human spleen hgtl0 cDNA library was constructed as described. 11 Double-stranded cDNA longer than 2 kb is purified by electrophoresis on low-gelling temperature agarose, before ligation to the hgtl0 arms. 6 About 5 X 10 4 plaques were transferred to nylon membranes (Biodyne A, Pall) using standard methods. 9 The 48-met probe is hybridized at 50 ° ir~ a solution of 6x SSC, 5x Denhardt's, 0.5% sodium dodecyl sulfate (SDS), 400 ttg/ml heat-denatured salmon sperm DNA, 20/zg/ml E. coli DNA, and the radiolabeled probe (2 x l 0 6 cpm/ml). After washing with 6 x SSC, 0.1% SDS at 50 ° the filters are exposed to Fuji RX films at - 8 0 ° using Du Pont Lightning Plus intensifying screens. The screening of 5 x 104 plaques of the spleen library gave 5 positive clones, whose inserts were practically identical, as determined by restriction mapping. A clone with an insert of 2.1 kb (LTA85) was further analyzed. Digestion of LTA85 with EcoRI gave three fragments of sizes 1.0, 0.85, and 0.1 kb showing the presence of two internal EcoRI sites. H S. Ohno, Y. Emori, H. Sugihara, S. Imajoh, and K. Suzuki, this series, Vol. 139, pp. 363-379.
[54]
5 - L I P O X Y G E N A S E C L O N I N G A N D EXPRESSION
491
Various fragments of LTA85 were subcloned in vectors pUC8 or pUC18, and sequenced by the dideoxy-sequencing method, as modified.12 Of the complete sequence (2060 bp), 1833 bp encodes an open reading frame corresponding to a protein of 610 amino acids (excluding the initial methionine), A polyadenylation signal (AATAAA) appears at base 1971. When the sequence of the clones hpll6A and LTA85 are compared, the open reading frames are identical, encoding a protein with MW 69,158. Longer 5' as well as 3' noncoding sequences are present in LTA85. Regarding the 5' noncoding sequences, these are identical up to position - 27, with in-frame stop codons at - 15. Computer-aided analysis of the deduced amino acid sequence shows no significant homology with other proteins, including rabbit and rat liver microsomal epoxide hydrolases. Regarding the properties of LTA4 hydrolase, a segment from amino acids 170-185 is the most hydrophobic part of the enzyme, possibly involved in binding of the hydrophobic substrate LTA4. A plasmid for expression of LTA4 hydrolase in E. coli is constructed, using the cDNA insert of LTA85. J3 Acknowledgments This study was supported by grants from the Swedish Medical Research Council (03X217, 03X-3532,03X-7467),and fromthe Ministryof Education, Scienceand Culture of Japan. t2 M. Hattori and Y. Sakaki, Anal. Biochem. 152, 232 (1986). 13 M. Minami, Y. Minami, Y. Emori, H. Kawasaki, S. Ohno, K. Suzuki, N. Ohishi. T. Shimizu, and Y. Seyama FEBS Lett. 229, 279 (1988).
[54] M o l e c u l a r B i o l o g y a n d C l o n i n g o f A r c h i d o n a t e 5-Lipoxygenase
By COLIN D. FUNK, TAKASHI MATSUMOTO,and BENGT SAMUELSSON Arachidonate 5-1ipoxygenase (Ecl. 13.11.34) is a complex enzyme requiring calcium, ATP, and various unknown cellular stimulatory factors for maximal conversion of arachidonic acid (20:4) to 5-hydroperoxy6,8,10,14-eicosatetraenoic acid (5-HPETE) and its subsequent metabolite 5,6-oxido-7,9,11,14-eicosatetraenoic acid [leukotriene A4 (LTA4) ]. 1-4 The i C. A. Rouzer, T. Matsumoto, and B. Samuelsson, Proc. Natl. Acad. Sci. U.S.A. 83, 857 (I 986). 2 T. Shimizu, T. Izumi, Y. Seyama, K. Tadokoro, O. Rfidmark, and B. Samuelsson, Proc. Natl. Acad. Sci. U.S.A. 83, 4175 (1986).
METHODS IN ENZYMOLOGY, VOL. 187
Copyright © 1990by Academic Press, Inc. All rights of reproduction in any form reserved.
MOLECULAR BIOLOGY
[53]
[53] C l o n i n g o f L e u k o t r i e n e A 4 H y d r o l a s e c D N A By
OLOF R~DMARK, COLIN FUNK, J! YI Fu, TAKASHI MATSUMOTO, HANS JORNVALL, BENGT SAMUELSSON, MICHIKO MINAMI, SHIGEO OHNO, HIROSHI KAWASAKI,YOUSUKE SEYAMA, KOICHI SUZUKI, and TAKAO SHIM1ZU
Leukotriene A4 hydrolase (EC 3.3.2.6) is a soluble epoxide hydrolase which catalyzes the enzymatic hydrolysis of leukotriene A4 (LTA4) to the chemotactic agent leukotriene B4.1 After initial purification and characterization of the enzyme, 2 it was determined to be different from other epoxide hydrolases, and further studies were initiated. The cloning of LTA4 hydrolase was carried out successfully using two different strategies, i.e., screening ofhgtl 1 cDNA libraries (which express recombinant protein) with polyclonal antiserum, and screening of a hgtl0 cDNA library with a single isomer oligonucleotide probe (48-mer) whose structure was based on mammalian codon usage frequencies. 3"4 Prior to this, screening of plasmid (pBR322) cDNA libraries with mixed shorter oligonucleotide probes (16-mers) was unsuccessful. Thus, the use of better quality cDNA synthesized according to the RNase H method, 5 in hgt 10/11 vectors, 6 as well as the use of more efficient probes, were beneficial. Identification of Clones Using Antiserum A commercially available hgtl I cDNA library (Clontech, Palo Alto, CA) constructed from human lung poly(A) RNA was screened with polyclonal antiserum. The serum was obtained from rabbits injected with LTA4 hydrolase purified from human leukocytes. 2 In addition to the regular purification procedure, the enzyme used as antigen was further refined by SDS-polyacrylamide gel electrophoresis according to Laemmli. 7 For each I p . B o r g e a t , a n d B . S a m u e l s s o n , Proc. Natl. Acad. Sci. U.S.A. 7 6 , 3213 (1979).
20. Rfidmark,T. Shimizu, H. Jfrnvall, and B. Samuelsson,J. Biol. Chem. 259, 12339 (1984). 3 C. D. Funk, O. Rfidmark, J. Y. Fu, T. Matsumoto, H. Jrrnvall, T. Shimizu, and B. Samuelsson,Proc. Natl. Acad. Sci. U.S.A. 84, 6677 (1987). 4 M. Minami,S. Ohno, H. Kawasaki,O. Rfidmark,B. Samuelsson,H. JOrnvall,T. Shimizu, Y. Seyama,and K. Suzuki,J. Biol. Chem. 262, 13873(1987). 5 U. Gublerand B. J. Hoffman,Gene 25, 263. (1983). 6 T. V. Huynh,R. A. Young,and R. W. Davis, in "DNACloning"(D. M. Glover,ed.), Vol. 1, pp. 49-78. IRL, Oxford, 1983. 7 U. K. Laemmli,Nature (London)227, 680 (1970). METHODS IN ENZYMOLOGY, VOL. 187
Copyright © 1990by Academic Press, Inc. All rights of reproduction in any form reserved.
[53]
CLONING OF
LTA4HYDROLASE c D N A
487
booster, a gel slice containing approx 40/~g of protein is homogenized in PBS (I ml) plus Freund's complete adjuvant (1 ml) and injected. The specificity of the antiserum was estimated from Western blots. The proteins in the 10,000 g supernatant (50/xl) obtained after sonication of a human leukocyte suspension (108 cells/ml) are separated by electrophoresis in SDS-polyacrylamide (8% gel) and electroblotted 8 to nitrocellulose (Hybond C, Amersham, Buckinghamshire, England). When probed with the antiserum (1 : 100) one major band appeared, with the same retention as standard LTA4 hydrolase. In some samples, bands also appeared at MW 50,000-55,000, probably representing breakdown products of LTA4 hydrolase. Before use in the screening of hgtl 1 libraries, antibodies reactive to Escherichia coli epitopes were removed as described. 6 Briefly, a suspension of nontransformed E. coli is sonicated and nitrocellulose filters are soaked with this lysate. After washing the filters with TBS (50 mM TrisHCI, pH 8; 100 mM NaC1), they are soaked with the antiserum (1 : 10, v/v in TBS), thus binding antibodies that recognize E. coli proteins. The purified antiserum is diluted further to 1 : 100, v/v and used in screening as described. 6 P h a g e (104 per plate) are plated on E. coli Y 1090 and incubated at 42 ° for 3.5 hr. The plates are then overlaid with nitrocellulose filters (Millipore HATF) presoaked with 10 mM isopropyl-/3-o-galactoside (IPTG), in order to induce synthesis of recombinant protein. After further incubation at 37 ° for 3.5 to 4 hr, or preferably overnight, filters are removed, briefly airdried, and washed with TBS. Filters are treated with 20% fetal calf serum in TBS for 30 min (blocking) and incubated with the antiserum for 2 hr at room temperature. Next, filters are washed with TBS, TBS plus 0.1% Nonidet (NP-40) (Sigma, St. Louis, MO), and again with TBS (5 min each), before incubation in a solution of ~25I-labeled protein A in TBS plus 20% fetal calf serum for 1 hr at room temperature. The specific activity of ~25I-iabeled protein A is 1110 MBq/mg (Amersham IM 144). Typically 106 cpm per filter (82 mm) is used and the volume is 2-5 mi/filter. After repeated washing, filters are air-dried and autoradiographed at - 7 0 ° for 1 to 2 days (Fuji RX film) with an intensifying screen. Putative positive clones are carried through two or three additional rounds of screening at reduced density until homogeneous clones are obtained. In the original procedure, 6 incubation of IPTG-impregnated filters on the plates for 3.5 to 4 hr at 37°, prior to probing with antiserum, was recommended. In our hands, incubation overnight gives much clearer results. Thus, a clone blurt6-1 was isolated from a human lung hgtl 1 cDNA 8 H. Towbin, T. Staehelin, and J. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4350 ( 19791.
488
MOLECULAR BIOLOGY
1
A 2
3
1
B 2
3
[53]
1
C 2
3
kDa
67--
;30--
FIG. 1. Antibody selection assay of clone MuH6°I. The clone is plated lytically and synthesis of lacZ fusion protein induced by IPTG on overlaid nitrocellulose filters. Proteins transferred to the filters are incubated with LTA4 hydrolase antiserum (1 : 100 dilution, 10 ml). Antibodies selectively bound are eluted at pH 2.6 and immediately neutralized to pH 8.0. Human leukocyte LTA4 hydrolase (200 ng, lanes 1; 400 ng, lanes 2; 800 ng, lanes 3) is subjected to electrophoresis in an 8% SDS-polyacrylamide gel, transferred to nitrocellulose, and allowed to react with the selected antibodies. (A) Antibodies selected from clone Mull6-1; (B) antibodies selected from the parent vector hgtll, lacking a cDNA insert; (C) non-selected LTA4 hydrolase antiserum (1 : 100 dilution, 10 ml). Markers indicate retentions of bovine serum albumin (67 kDa) and carbonate dehydratase (30 kDa).
library. Antibody selection assay (Fig. 1) confirmed the identity of this clone. When digested with EcoRI two inserts were found, around 200 and 570 base pairs (bp), respectively. These were separated and religated to h arms by standard procedures 9 and the ligation mixture added to a phage protein extract (Promega, WI, according to the manufacturer) to give 9 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982.
[53]
CLONING OF L T A 4 HYDROLASE c D N A
489
infectious phages. When screened with the antiserum, only some phages containing the shorter (200 bp) insert (blurt6-la) gave positive signals, thus indicating that nonrelated cDNAs were ligated together in one clone in the cDNA synthesis. The insert of blurt6- la was subcloned in M 13 for production of single-strand DNA which was sequenced by the Sanger dideoxy chain-termination method. A coding sequence was found, corresponding to 29 amino acids of a CNBr fragment of LTA4 hydrolase. This identified MuH6-1a as a partial LTA4 hydrolase cDNA clone. The sequence of the 570 bp fragment of Mull6-1 was also determined; it was subsequently confirmed that it had no relation to the LTA4 hydrolase cDNA clones. The artifact of one clone carrying multiple nonrelated inserts was encountered once more in the further screening for longer clones. Thus the insert of blurt6-1 a was labeled by nick translation and the same lung hgt I 1 cDNA library screened by plaque hybridization. In this procedure, phages are plated on E. coli Y1090 and grown for 6 hr at 37°. Nitrocellulose filters (Millipore HATF) are overlaid for 1 min and processed as described. 9 5 × 105 clones were screened; the longest clone hybridizing with hluH6-1a gave two inserts upon EcoRI digestion (770 and 405 bp). Sequencing showed that the 405 bp fragment overlaps with hluH6-1a. The 770 bp fragment, however, had multiple termination codons in all reading frames, and was judged as nonrelated. Full-length cDNA was isolated from a human placenta hgtl 1 library, also from Clontech. Here, 4 x 105 clones were screened, and 19 clones that hybridized strongly exhibited a characteristic 1.1 kb/0.8 kb double insert pattern after EcoRI digestion, indicating the presence of an internal EcoRI site. The original hluH6-1a hybridized to the 0.8 kb insert. Appropriate restriction fragments of a clone kpll6A were subcloned in M13 and sequenced, hpll6A contained a 1910 bp insert (excluding the EcoRI linkers) with a continuous reading frame of 1830 bp terminated by a stop codon (TAA), encoding a protein of 610 amino acids. The noncoding regions were short, especially at the 3' end (47 bp) and a polyadenylation signal as well as poly(A) tail were lacking. This is explained by the presence of another internal EcoRI site (see below: cloning with 48-mer). Screening with 48-mer A 48-mer oligonucleotide was designed from the amino acid sequence of a cyanogen bromide fragment of LTA hydrolase, according to the mammalian codon usage frequencies (see Fig. 2)4.1° An 8-mer primer, complementary to the 5' end of the 48-mer is also prepared. Two complementary probes are labeled with 32p as follows. First, the 48-mer is phos~o R. Lathe, J. Mol. Biol. 183, 1 (1985).
490 Primer Probe
MOLECULAR BIOLOGY E8 E48
3'-TGTTCAGG-5' 5 '- A A G T T C A C C C G G C C C C T G T T C A A G G A C C T G G C C G C C T T T G A C A A G T C C .
LTA85 Peptide
[53l
(1696-1743) #I I
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
°
.
.
.
.
.
.
3' °
, ° °
AAGTTTACCCGGCCCTTATTCAAGGATCTTGCTGCCTTTGACAAATCC LysPheThrArgProLeuPheLysAspLeuAlaAlaPheAspLysSer
FIG. 2. Sequence of oligonucleotide probe. The 48-mer oligonucleotide and antistrand 8-mer oligonucleotide primer are synthesized, based on the sequence of a LTA4 hydrolase CNBr fragment [peptide 11 (ref. 4) ]. The corresponding sequence found in clone LTA85 was homologous (about 85%) to the probe E48.
phorylated at the 5' end, using [A-32p]ATP and T4 polynucleotide kinase. The 8-mer primer dissolved in annealing buffer (50 mM Tris-HCl, pH 7.5) is added to give a ratio of 50 pmol of 8-mer per 10 pmol of 48-mer. After incubation, first at 85 ° for 5 min, and then at 65 ° for 10 min, the mixture is gradually cooled to room temperature during more than 1 hr. Additions are now made to the annealed mixture to give a final volume of 50/xl containing 1 mM dGTP, I mM dATP, 1 mM dTTP, 10/.tCi [a-32p]dCTP (3000 Ci/ mmol, Du Pont), 10 mM MgC12, and 10 mM dithiothreitol. The Klenow fragment of DNA polymerase I is added and the mixture incubated for 1 hr at 12°. After addition of unlabeled dCTP (1 raM), the incubation is continued for another 20 min to complete the synthesis of antistrand oligonucleotide. Unincorporated radioactivity is removed by gel filtration on Sephadex G-50. A human spleen hgtl0 cDNA library was constructed as described. 11 Double-stranded cDNA longer than 2 kb is purified by electrophoresis on low-gelling temperature agarose, before ligation to the hgtl0 arms. 6 About 5 X 10 4 plaques were transferred to nylon membranes (Biodyne A, Pall) using standard methods. 9 The 48-met probe is hybridized at 50 ° ir~ a solution of 6x SSC, 5x Denhardt's, 0.5% sodium dodecyl sulfate (SDS), 400 ttg/ml heat-denatured salmon sperm DNA, 20/zg/ml E. coli DNA, and the radiolabeled probe (2 x l 0 6 cpm/ml). After washing with 6 x SSC, 0.1% SDS at 50 ° the filters are exposed to Fuji RX films at - 8 0 ° using Du Pont Lightning Plus intensifying screens. The screening of 5 x 104 plaques of the spleen library gave 5 positive clones, whose inserts were practically identical, as determined by restriction mapping. A clone with an insert of 2.1 kb (LTA85) was further analyzed. Digestion of LTA85 with EcoRI gave three fragments of sizes 1.0, 0.85, and 0.1 kb showing the presence of two internal EcoRI sites. H S. Ohno, Y. Emori, H. Sugihara, S. Imajoh, and K. Suzuki, this series, Vol. 139, pp. 363-379.
[54]
5 - L I P O X Y G E N A S E C L O N I N G A N D EXPRESSION
491
Various fragments of LTA85 were subcloned in vectors pUC8 or pUC18, and sequenced by the dideoxy-sequencing method, as modified.12 Of the complete sequence (2060 bp), 1833 bp encodes an open reading frame corresponding to a protein of 610 amino acids (excluding the initial methionine), A polyadenylation signal (AATAAA) appears at base 1971. When the sequence of the clones hpll6A and LTA85 are compared, the open reading frames are identical, encoding a protein with MW 69,158. Longer 5' as well as 3' noncoding sequences are present in LTA85. Regarding the 5' noncoding sequences, these are identical up to position - 27, with in-frame stop codons at - 15. Computer-aided analysis of the deduced amino acid sequence shows no significant homology with other proteins, including rabbit and rat liver microsomal epoxide hydrolases. Regarding the properties of LTA4 hydrolase, a segment from amino acids 170-185 is the most hydrophobic part of the enzyme, possibly involved in binding of the hydrophobic substrate LTA4. A plasmid for expression of LTA4 hydrolase in E. coli is constructed, using the cDNA insert of LTA85. J3 Acknowledgments This study was supported by grants from the Swedish Medical Research Council (03X217, 03X-3532,03X-7467),and fromthe Ministryof Education, Scienceand Culture of Japan. t2 M. Hattori and Y. Sakaki, Anal. Biochem. 152, 232 (1986). 13 M. Minami, Y. Minami, Y. Emori, H. Kawasaki, S. Ohno, K. Suzuki, N. Ohishi. T. Shimizu, and Y. Seyama FEBS Lett. 229, 279 (1988).
[54] M o l e c u l a r B i o l o g y a n d C l o n i n g o f A r c h i d o n a t e 5-Lipoxygenase
By COLIN D. FUNK, TAKASHI MATSUMOTO,and BENGT SAMUELSSON Arachidonate 5-1ipoxygenase (Ecl. 13.11.34) is a complex enzyme requiring calcium, ATP, and various unknown cellular stimulatory factors for maximal conversion of arachidonic acid (20:4) to 5-hydroperoxy6,8,10,14-eicosatetraenoic acid (5-HPETE) and its subsequent metabolite 5,6-oxido-7,9,11,14-eicosatetraenoic acid [leukotriene A4 (LTA4) ]. 1-4 The i C. A. Rouzer, T. Matsumoto, and B. Samuelsson, Proc. Natl. Acad. Sci. U.S.A. 83, 857 (I 986). 2 T. Shimizu, T. Izumi, Y. Seyama, K. Tadokoro, O. Rfidmark, and B. Samuelsson, Proc. Natl. Acad. Sci. U.S.A. 83, 4175 (1986).
METHODS IN ENZYMOLOGY, VOL. 187
Copyright © 1990by Academic Press, Inc. All rights of reproduction in any form reserved.
