MOLECULAR AND CELLULAR BIOLOGY, Mar. 1991, p. 1488-1499 0270-7306/91/031488-12$02.00/0 Copyright © 1991, American Society for Microbiology

Vol. 11, No. 3

Chicken PBI-Crystallin Gene Expression: Presence of Conserved Functional Polyomavirus Enhancer-Like and Octamer Binding-Like Promoter Elements Found in Non-Lens Genes H. JOHN ROTH,* GOKUL C. DAS,t AND JORAM PIATIGORSKY Laboratory of Molecular and Developmental Biology, National Eye Institute, National Institutes of Health, Bethesda, Maryland 20892 Received 23 August 1990/Accepted 17 December 1990

Expression of the chicken ,Bl-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the OB1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the PB1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the OBl-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the IIB1 promoter, including two Spl sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken OIBl-crystallin gene in the lens. fiber cells (49). This same pattern of expression is exhibited by the ,B1-crystallin mRNA, suggesting transcriptional regulation (28, 49). The molecular mechanisms that control crystallin gene expression in the lens remain unclear. Regulatory elements have been identified in the 5'-flanking regions of the murine (9, 42) and chicken (32, 48) aA-crystallin and murine -y2crystallin (39) genes. In addition to containing several promoter regulatory elements (6, 27), the chicken 81-crystallin gene also has an enhancer in its third intron (25). This study initiates molecular investigations on the expression of 3-crystallin genes. The results indicate that expression of the chicken PB1-crystallin gene in the lens requires at least three distinct cis-acting promoter regulatory elements which show sequence similarities with cis-acting sequence elements present in non-lens genes.

The vertebrate eye lens is a transparent, nonvascularized encapsulated tissue composed of anterior epithelial and posterior fiber cells (5, 23). Primary fiber cell differentiation involves elongation of the posterior cells of the lens vesicle, while secondary fiber cell differentiation is a later event involving the migration of cuboidal epithelial cells around the lens equator to the lens posterior, where they terminally differentiate to form secondary fiber cells. Associated with this process is the differential synthesis of multiple crystallin polypeptides which comprise 80 to 90% of the soluble cellular protein (23, 54). The crystallins are encoded by several gene families whose exact composition and patterns of expression differ among species (53, 72). The abundantly expressed lens crystallins have been recruited from different non-lens proteins, including small heat shock proteins (acrystallins), Ca2+-binding bacterial spore coat proteins (13ycrystallins), and metabolic enzymes (e, T, 8, and other taxon-specific crystallins) (72). The a-, P-, and B-crystallins are the major crystallin families present in the chicken lens. During chicken lens development, b-crystallins are expressed first, P-crystallins next, and a-crystallins last (53). The P-crystallins constitute the major soluble protein of the mature lens (28). They are composed of at least seven different polypeptides which exhibit characteristic temporal and spatial patterns of expression during lens development. The ,B1-crystallin polypeptide (27 kDa) appears initially in the elongating equatorial cells and accumulates in the differentiating lens

MATERIALS AND METHODS

Oligodeoxynucleotides. Oligodeoxynucleotides were synthesized on an Applied Biosystems 380A DNA synthesizer. Those used to construct PBl-crystallin-chloramphenicol acetyltransferase (CAT) plasmids were purified by electrophoresis in 10% acrylamide-6 M urea sequencing gels and eluted by using Gel/X extractors (Genex Corp., Gaithersburg, Md.). Radiolabeled oligodeoxynucleotides were prepared by using [_y-32P]ATP (ICN, Irvine, Calif.) and polynucleotide kinase; unincorporated nucleotides were removed by passage through G-25 spin columns (Boehringer Mannheim, Indianapolis, Ind.). Double-stranded oligodeoxynucleotides were prepared by using previously described annealing conditions (63).

Corresponding author. t Present address: Department of Molecular Biology, University of Texas Health Center at Tyler, Tyler, TX 75703. *

1488

VOL . 1 l, 1991 VB1-CRYSTALLIN GENE EXPRESSION

Northern (RNA) blot analysis. Total RNA preparations were isolated from embryonic chicken tissues and cultured cells as described by Chirgwin et al. (10). The RNA was fractionated in formaldehyde-agarose gels (40) and transferred to nitrocellulose filters (BA85, 0.45-,um pore size; Schleicher & Schuell, Inc., Keene, N.H.) (64). The integrity of the RNA preparations was confirmed by ethidium bromide staining and visualization of rRNAs. A 7-kbp chicken genomic EcoRI-SphI restriction fragment containing the entire 3B1-crystallin structural gene labeled with [a-32P]dCTP (PB.10205; Amersham Corp., Arlington Heights, Ill.) by the random oligonucleotide priming method (RPN.1600Z; Amersham) was used as a hybridization probe. Prehybridization and hybridization conditions were as previously described (1). The blots were washed one time each for 20 min in the following solutions: 2x SSC-0.1% sodium dodecyl sulfate (SDS) at room temperature, lx SSC-0.1% SDS at room temperature, 0.2x SSC-0.1% SDS at room temperature, and 0.2x SSC-0.1% SDS at 520C. Construction of chicken ,3Bl-crystallin CAT plasmids. A PvuII-PvuII restriction fragment spanning positions -434 to +30 of the chicken ,BB1-crystallin gene was used as a source of PBl-crystallin promoter sequences. Plasmids p3BlP434, p,3BlP296, ppBlP152, ppBlP101, and ppBlP53 were constructed by blunt-end ligation of the PvuII-PvuII, BamHIPvuII, NciI-PvuII, XmaIII-PvuII, and FnuDII-PvuII chicken genomic fragments, respectively, into the HindIII site of the pSVOCAT expression vector (21). Plasmids pPBlP126 and ppBlPllO were constructed by ligating dou-

ble-stranded oligodeoxynucleotides containing ,B1-crystallin promoter sequences from positions -126 to -101 and -110 to -101, respectively, to the XmaIII end of the XmaIII-PvuII promoter fragment, followed by blunt-end ligation of the resulting fragments into the HindIII site of the

pSVOCAT expression vector. Sequence mutations were introduced into the ,B1-crystallin promoter either by ligating double-stranded oligodeoxynucleotides spanning positions -152 to -101 to the XmaIII-PvuII fragment followed by blunt-end ligation into the HindlIl site of pSVOCAT (M2A, M3B, M6A, and M7C) or by using the oligodeoxynucleotide-directed mutagenesis method (M6, M7, M17, M18, and M19) (RPN.1523; Amersham). Oligodeoxynucleotide-directed mutagenesis was conducted as described by Amersham, using a BamHI-HindIII chicken genomic restriction fragment cloned into M13mpl9 as a source of single-stranded fiB1-crystallin promoter DNA. All constructs were confirmed by sequencing the ligation junctions and regions containing mutations (Promega K/RT Universal Sequences System; Promega Biotec, Madison, Wis.). Cell culture, CAT assays, and j8-galactosidase assays. Primary epithelial cells were cultured from 14-day-old embryonic chickens as patched lens epithelial cells (PLEs) as previously described (6). For CAT assays, PLEs cultured from eight lenses per 60-mm collagen-coated dish were cotransfected after 36 to 48 h of culture with 10 ,ug of the test

plasmid and 1 ,ug of the Rous sarcoma virus promoter-,galactosidase gene-containing plasmid (pTB.1) (6) by coprecipitation with calcium phosphate (8), harvested 36 h later, and assayed for CAT activity by using the biphasic method described by Neumann et al. (44). P-Galactosidase assays were conducted as previously described (6). Primary fibroblasts were cultured from 9- to 11-day-old chicken embryo skeletal muscle. For primer extension experiments, PLEs from 24 lenses per 100-mm collagen-coated dish were transfected with 30 jig of the test plasmid. Total RNA was

1489

prepared 24 h later by homogenizing the cells in guanidineisothiocyanate, followed by centrifugation through a cesium chloride cushion as described by Chirgwin et al. (10). Primer extension and Si nuclease analyses. Primer extension analysis of CAT RNA transcripts using a primer oligodeoxynucleotide complementary to CAT mRNA was conducted as described by Chepelinsky et al. (9). Primer extension analysis of f3B1-crystallin RNA transcripts was performed by using the oligodeoxynucleotide 5'-TTGTCCT CTGCAGCCTGGCC-3', which is complementary to nucleotides 88 to 107 of the ,B1-crystallin mRNA (29). MspIdigested pBR322 DNA (New England BioLabs, Inc., Beverly, Mass.) radiolabeled with [_y-32P]ATP (ICN) and T4 polynucleotide kinase was used as a size standard during electrophoresis. S1 nuclease analysis was performed as described by Das and Piatigorsky (14). In vitro transcription in a HeLa cell extract. Preparation of the whole HeLa cell extract, runoff transcription of the ,B1-crystallin gene, and competition experiments with the Cl fragment of simian virus 40 (SV40) DNA (13) have been described elsewhere (14). Nuclear extracts, gel mobility shift assays, and DNase I footprinting assays. Lens nuclear extracts were prepared (63) from 12- to 16-day-old embryonic chicken lenses and HeLa cells (MIT Cell Culture Facility, Cambridge, Mass.). Gel mobility shift assays (58) were conducted by using 1 ng of radiolabeled double-stranded oligodeoxynucleotides, 0.5 jig of poly(dI-dC) (Pharmacia LKB Biotechnology, Inc., Piscataway, N.J.) and 0.31 ,ug of M13mp9 sense DNA in buffer containing 15 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.9), 40 mM potassium chloride, 5.75 mM magnesium chloride, 1.5% glycerol, and 5% polyethylene glycol. Ten microliters (approximately 45 ,ug of protein) of lens nuclear extract was incubated in a total volume of 25 ,ul for 30 min at 25°C and analyzed by electrophoresis (150 V, 1.5 h) in 5% polyacrylamide gels (acrylamide/bisacrylamide weight ratio of 60:1), using 0.5x TBE electrophoresis buffer (45 mM Tris-borate [pH 7.8], 45 mM boric acid, 1 mM EDTA). The gels were dried under vacuum and autoradiographed. DNase I footprinting analysis (19) was performed by using an NdeI-BstNI restriction fragment spanning positions -152 to -43 of the ,B1-crystallin promoter. Its antisense strand was end labeled by digesting plasmid pPiB1P152 with NdeI and filling in the ends by using [a32P]dATP (Amersham) and Klenow DNA polymerase (40). The radiolabeled DNA was digested with BstNI, electrophoresed in 5% polyacrylamide gels (acrylamide/bisacrylamide weight ratio of 29:1) by using lx TBE electrophoresis buffer, eluted into lx TBE, extracted once with butanol and once with phenol-chloroform, ethanol precipitated, dissolved in TE buffer (10 mM TrisHCI [pH 7.5], 0.1 mM EDTA), and passed through a G-50 spin column (Boehringer Mannheim). DNase I footprinting assays were performed in a total volume of 50 ,ul, using 2,500 dpm of 32P-labeled DNA, either 25 ,u1 of lens nuclear extract (approximately 113 ,ug of protein) or 2 pLI of HeLa cell nuclear extract (approximately 12.5 p.g of protein), and 1 ,ug of poly(dI-dC) in buffer containing 15 mM HEPES (pH 7.9), 40 mM potassium chloride, 5.75 mM magnesium chloride, 1.5% glycerol, and 5% polyethylene glycol. The samples were incubated for 5 min at room temperature to allow the binding of nuclear factors; calcium chloride and magnesium chloride were then added to final concentrations of 2.5 and 5 mM, respectively, and the mixture was incubated with DNase I for 1 min at room temperature. DNase I digestions were stopped by the

1490

ROTH ET AL.

MOL. CELL. BIOL.

Q;i

Tn1 -j

i

c^ m ~m

ftj

t: )

L;.

*-

28S

18S 0.

FIG. 1. Northern blot analysis of chicken 1B1-crystallin mRNA. Total RNA preparations isolated from various tissues of 13-day-old chicken embryos (lens, liver, brain, heart, and skeletal muscle), fibroblasts cultured from 9-day-old chicken embryos, and PLEs from 14-day-old chicken embryos were fractionated by electrophoresis in formaldehyde-agarose gels, blotted onto nitrocellulose filters, and probed with a 32P-labeled 7-kbp chicken genomic fragment containing the entire ,B1-crystallin structural gene. The migration positions of 18S and 28S rRNAs are included as molecular size standards.

addition of equal volumes of buffer containing 0.2 M sodium chloride, 20 mM EDTA, 1% SDS, and 250 ,ug of yeast tRNA. The DNA was extracted one time with phenol and one time with chloroform, precipitated with ethanol, fractionated in 8% polyacrylamide-6 M urea sequencing gels, and autoradiographed at -70°C with intensifying screens. 32P-labeled MspI digests of pBR322 DNA (New England BioLabs) were used as size standards. RESULTS

Tissue distribution of chicken IBl-crystaliin mRNA. To examine the pattern of expression of the chicken 1B1crystallin gene in the chicken embryo, total RNA prepared from several different tissues and cultured cells was subjected to Northern blot analysis. ,BB1-crystallin mRNA was detected only in the lens and cultured PLEs (Fig. 1). Expression of the ,BB1-crystallin gene was not detected in any non-lens tissue examined, even upon prolonged exposure of the Northern blot to X-ray film (data not shown). The inability to detect ,3B1-crystallin mRNA in non-lens tissues was not due to RNA degradation, since ethidium bromide

staining revealed similar amounts of intact rRNAs in all of the RNA preparations (data not shown). These data suggest that 3B1-crystallin gene expression is lens specific in the embryonic chicken. Identification of (Bl-crystallin 5'-flanking sequences required to direct transcription in lens cells. To begin to identify the cis-acting regulatory sequences required for lens expression of the chicken PB1-crystallin gene, 5'-flanking gene sequences were fused to the CAT gene in the pSVOCAT expression vector (21) and tested for the ability to direct CAT gene expression when transfected into PLEs, fibroblasts, and HeLa cells. Initially, a PvuII restriction fragment containing 434 bp of 5'-flanking plus 30 bp of noncoding exon 1 sequences was tested (p,BBlP434). p,BlP434 directed CAT gene expression at approximately 8.5 times higher levels than did the promoterless pSVOCAT vector (Fig. 2), indicating that the PvuII restriction fragment contained cis-acting regulatory elements required for proper PBlcrystallin gene transcription. To further localize these gene regulatory sequences, 5' deletion analysis was performed. All of the resulting test plasmids that directed CAT gene expression directed significantly higher levels in PLEs than in either fibroblasts or HeLa cells. In PLEs, the largest effect was a greater than fourfold reduction in promoter activity that resulted when the sequence between positions -126 to -110 was eliminated (Fig. 2; compare pPBlP126 with ppBlP110). In addition, an approximately twofold increase in promoter activity resulted upon deletion of the sequence between positions -434 and -296 (Fig. 2; compare p,BlP434 with p,BBlP296), suggesting the presence of a negative regulatory element. This possibility was investigated further by cloning either the -434 to -296 fragment or several similarly sized pBR322 plasmid DNA fragments into the NdeI restriction site located 47 bp upstream of the PBl-crystallin promoter in the pPB1P152 plasmid and assaying their effects on pPB1P152directed CAT expression in transfected PLEs. Both the PBl-crystallin -434 to -296 fragment and the pBR322 fragments reduced CAT expression to the same extent, indicating that the negative effect is not sequence specific (data not shown). Thus, the results of the 5' deletion experiments indicate that PBl-crystallin gene sequence between positions -126 and +30 is sufficient to direct transcription and contains at least one cis-acting regulatory element between positions -126 and -110. Primer extension analysis of RNA isolated from PLEs transfected with p3BlP434 indicated that transcription was initiated in two separate regions (Fig. 3, lane 6). One corresponds to the authentic f3Bl-crystallin gene CAP site (29) (Fig. 3B, arrows), and the second corresponds to the -157 region (Fig. 3B, triangle). To determine whether the -157 region contains a previously undetected in vivo transcription start site, primer extension analysis of endogenous PB1-crystallin mRNA transcripts isolated from both embryonic chicken lenses (Fig. 3A, lane 1) and PLEs (Fig. 3A, lane 2) was conducted. Transcription initiation was detected only in the + 1 region, indicating that the -157 region is not used as an initiation site in the normal gene. Primer extension analysis of RNA preparations isolated from skeletal muscle (Fig. 3A, lane 3) or primary cultures of embryonic chicken fibroblasts (Fig. 3A, lane 4) failed to detect PB1-crystallin RNA transcripts, consistent with the Northern blot analyses described above. Additional experiments revealed that while p,BBlP296 also initiated transcription in both the -157 and +1 regions, all of the other transcriptionally active ,Bl-

PBl-CRYSTALLIN GENE EXPRESSION

VOL. 11, 1991

1491

AMpR SV40 Splice and Polyadenylation Signals pBR322 ( ori

PBl-Crystallin 5'-Flanking Sequences

-434

pfBl P434 1-

*30

PLEs 8.5 ± 1.2

Relative CAT Activity Fibroblasts 0.85 ± 0.18

HeLa 0.41

-296

ppBl P296

_

19.5 ± 2.5

3.22 ± 0.77

3.79

_

14.2 ± 2.6

3.02 ± 0.48

3.72

-152

pBlB P152 i -126 p(IB1 P126

10.2 ± 3.0

1.93

N.D.

2.4 ± 12

0.53

N.D.

_

2.6 ± 1.0

1.73 ± 0.30

1.69

_

2.1 ± 0.1

1.79 ± 0.08

1.97

-110

pflBlPllOI -101

ppBl P101 pBlPlo P-53 P53 ppBl

TATAAA

Exon I

(Bl-Crystallin Gene 5'-Flanking Region

Pvull

BamHI

FIG. 2. Transient expression

assays

Ncil

Xma III FnuD II

PvulII

of pBl-crystallin-CAT plasmids transfected into PLEs, fibroblasts, and HeLa cells. The indicated

13B1-crystallin gene promoter fragments were cloned into the HindlIl site of the pSVOCAT expression vector and assayed for the ability to

direct CAT gene expression when transfected into cultured cells. pTB.1 was cotransfected, and CAT activities were normalized with respect to 3-galactosidase activities to correct for differences in transfection efficiencies. Relative CAT activity is expressed as CAT activity directed by the test plasmid relative to that directed by the promoterless plasmid pSVOCAT. The standard errors were determined from at least three separate experiments. The HeLa cell and portions of the fibroblast data (pPB1P126 and pI3B1P11O) were determined from a single experiment. N.D., Not determined.

crystallin-CAT recombinant plasmids utilized only the + 1 region start sites (data not shown). Footprint analysis of the jB1-crystallin gene promoter. DNase I footprinting was used to identify putative cis-acting regulatory elements of the PBl-crystallin promoter. Figure 4 shows DNase I footprints produced by unfractionated nuclear extracts derived from embryonic chicken lenses and HeLa cells. Both extracts protected two distinct regions of the PBl-crystallin promoter, -122 to -96 and -85 to -60, from DNase I digestion (Fig. 4, hatched bars). Although the lens nuclear extract produced a weaker footprint than the HeLa cell nuclear extract, these results suggest that both contain factors that specifically recognize the same PBlcrystallin promoter sequences. Nucleotide sequence and site-specific mutational analysis of

the ,Bl-crystallin gene promoter. The nucleotide sequence of the PBl-crystallin promoter was determined and analyzed for the presence of cis-acting regulatory sequences identified in other genes (Fig. 5) (71). The promoter contains a TATA box located about 30 bp upstream of the transcription start site and two consensus Spl binding sites (17) at positions -105 to -100 and -60 to -55. Several other putative regulatory elements are also apparent (Fig. 5, boxed sequences). Two sequences, OL-1 (-125 to -118) and OL-2 (-75 to -68), are identical at six of eight nucleotides to the octamer binding sequence (OBS; ATTTGCAT), which functions as the recognition sequence for a number of different tissue-specific and general transcription factors (31). In

addition, PL-1 (-113 to -104) and PL-2 (-86 to -76) constitute a nearly perfect 11-bp direct repeat that is similar to the PEA 1 and PEA 2 binding sites of the polyomavirus enhancer. Although closely related in sequence, the PEA 1 and PEA 2 sites bind different transcription factors (57). Mutations were introduced into these putative regulatory elements, and their functional significance tested in transfection experiments (Fig. 6). As previously, the results are expressed as CAT activity in PLEs transfected with the test plasmids relative to that obtained in PLEs transfected with the promoterless vector (pSVOCAT). Thus, wild-type promoter constructs (containing ,Bl1-crystallin gene sequences spanning positions -152 to +30) directed 6.3 times more CAT activity than did plasmids lacking a promoter (Fig. 6, wt). The largest decrease in promoter activity resulted upon mutation of the PL-1 element (M6A). In addition, mutations of PL-2 (M17 and M7) resulted in decreased CAT expression, indicating that both PL-1 and PL-2 contribute to

,BB1-crystallin gene transcription.

Mutations of OL-2 (M19) and the upstream Spl consensus binding site (M7C) also decreased promoter activity. By contrast, mutations of OL-1 (M2A and M3B) and the downstream Spl consensus binding site (M18) did not significantly affect CAT gene expression. These results are consistent with PL-1, PL-2, and OL-2 being three distinct cis-acting regulatory elements. The roles, if any, of OL-1 and Spl in PBl-crystallin gene transcription remain unclear. In vitro transcription of the ,Bl-crystallin gene in

a

HeLa

1492

MOL. CELL. BIOL. ,7-:,

A

-.6

.z 4-

242 21 7 201 190 180

- . 242

x

217 ---201 *--- 190 180

2

x

L..-

AJ

,.Li

7:, Y.-

.7.

---

--

160-

.7-

-j f-

.A

-n

A

B 43 bp

160 [1 OLL

--- 147

147 --

122

122

Ihw

1 10 *--

110-

-4-O

--

12

34

5

90

6

FIG. 3. Primer extension analysis showing that jBl-crystallinCAT recombinant plasmids initiated transcription at the correct start site. (A) Primer extension of ,B1-crystallin RNA transcribed from the endogenous ,B1-crystallin gene. Total RNA isolated from the following sources was analyzed by using a primer complementary to the ,BBl-crystallin mRNA: lane 1, whole lenses of 15-day-old chicken embryos (3 jig of RNA); lane 2, mock-transfected PLEs (30 jig of RNA); lane 3, mock-transfected fibroblasts cultured from 11-day-old chicken embryos (30 jig of RNA); lane 4, leg muscle from 11-day-old chicken embryos (30 jig of RNA). (B) Primer extension of CAT RNA transcribed from PBl-crystallin-CAT plasmids in transfected PLEs. Total RNA (30 jig) isolated from PLEs mock transfected (lane 5) or transfected with plasmid ppBlP434 (lane 6) was analyzed by using a primer complementary to CAT mRNA. Arrows indicate the expected sizes of extended cDNA products corresponding to transcription initiation at the authentic PB1-crystallin gene CAP site. The cryptic transcription initiation site utilized by plasmid ppBlP434 is also indicated (triangle).

cell extract. Since the chicken lens and HeLa cell nuclear extracts gave similar protection against DNase I digestion on the ,BBl-crystallin promoter, we performed a runoff transcription experiment in a whole HeLa cell extract. A chicken genomic BamHI restriction fragment containing the entire ,3B1-crystallin structural gene plus 296 bp of 5'-flanking sequences was used as a template for RNA synthesis (Fig. 7A). This fragment directed the in vitro transcription of an RNA species approximately 3 kb in length (Fig. 7B, lane 1). In vitro transcription of gene fragments containing progressive 3' deletions of the structural gene resulted in progressively shortened RNA products of the expected sizes, indicating that the HeLa cell system initiated transcription at the correct start site (Fig. 7B, lanes 2 and 3). This result was confirmed by Si nuclease analysis, in which a BamHI-SstI hybridization probe protected from Si nuclease digestion transcripts corresponding exactly in size to runoff transcripts from a BamHI-SstI-digested template (Fig. 7C).

c

152bp

FIG. 4. Identification of regulatory regions in the chicken ,B1crystallin promoter by DNase I footprint analysis. The antisense strand of an NdeI-BstNI restriction fragment spanning positions -152 to -43 of the PB1-crystallin promoter was end labeled with 32P and footprinted. Following incubation with unfractionated HeLa cell or chicken lens nuclear extracts to allow the binding of putative transcription factors, the samples were digested with either 1 ,ug (lanes A) or 10 ,ug (lanes B) of DNase I (Boehringer Mannheim) and subjected to electrophoresis in 8% polyacrylamide-6 M urea sequencing gels. Regions of the promoter similar in sequence to previously identified cis-acting regulatory elements are indicated as follows: OL-1 and OL-2, sequences similar to the OBS; PL-1 and PL-2, sequences similar to the PEA 1 and PEA 2 binding sites in the a domain of the polyomavirus enhancer; Spl, regions containing the GGGCGG sequence. The hatched boxes indicate regions protected from DNase I digestion and correspond to the -122 to -96 and -85 to -60 regions of the PBl-crystallin promoter.

Finally, since the PB1 promoter contains two Spl binding sites, we carried out a transcriptional analysis of this promoter with a competitor DNA fragment containing the GC-box region (Spl binding sites) of the SV40 viral promoter. This fragment did not significantly reduce the in vitro transcription of the ,Bl-crystallin gene (Fig. 7D), whereas under identical assay conditions it abolished transcription from the 81-crystallin promoter (data not shown). This observation agrees with the weak involvement of the Spl sites in the ,B1 promoter as observed in the site-specific mutagenesis experiments. Thus, the transcription of the ,B1 gene differs from that of the 81-crystallin gene in a HeLa extract, in which the same competitor essentially eliminated transcription (13), consistent with the involvement of Spl in expression of the 81-crystallin gene (26). Sequence-specific binding of lens nuclear factors to jIBicrystallin cis-acting regulatory elements. Gel mobility shift

V 1B1-CRYSTALLIN GENE EXPRESSION VOL. 11, 1991

1493

-434

CTGGGTATGCCCAAGGTGCGGGACAGAAACCTGCAGGGCCAGAGAGATGGGGCTGGGAGCCCTGCCTGGT -296

CCCATGGGGCTGGGTTTGGGGCAGCCACGGGGCTGGTCGTACCATGCCCAGCAGCAGCAGGAGTGCTGGA

TCCAGGTGCTGGTGGGCTCTGGGGGTATATATGCCCTGTGCGGGGCCGCGGTGTCGCGGTGCGGCAAAGT GGCGCGGTCAGGTCTTCTGTTGGTGCCGCTGGATAAAGGAAATGTCTGGGTTCAGCGGCTGGGCACAGGG Spj-1I01 PL-2 -126 OL-1 -152 PL-1 TGTGATGACTGGG GCCGCACAGACACTGA CCGGGGAGAGGCTTCCAGCTCGCCCAGA TTTGCA -53 TATA Box Spl OL-2 PL-2 TGAGCTGG CTTCCA TGTGTGCCCGCCCGCGCTCTGCCCTTGCCAGGCTATAAAGTGGGGGCCCCGCT +30 CAP Site

GCACCCCGAAACACAAGCCTGCTCCCTCCAACAAGAAGCAGCAG sequence of the -434 to +30 region of the chicken PBl-crystallin gene and identification of regions similar to cis-acting 5. Nucleotide FIG. regulatory sequences present in other genes (boxed). Indicated are octamerlike sequences (OL-1 and OL-2) and polyomavirus enhancerlike sequences (PL-1 and PL-2). Numbering is relative to the +1 position at the transcriptional initiation site (CAP site).

tional activity is consistent with these lens nuclear factors being transcription factors. We next conducted competition assays to determine whether the same lens transcription factors recognize both PL-1 and PL-2 (Fig. 8). Complex formation with PL-1 was inhibited by the wild-type PL-2 sequence (PL-1 with PL-2 competitor) and to a lesser extent a mutated PL-2 sequence (PL-1 with M7 competitor). Furthermore, a competitor oligodeoxynucleotide containing the PEA 1 and PEA 2 binding sites of the polyomavirus enhancer (57) competed with both the PL-1 and PL-2 oligodeoxynucleotides for complex formation (PL-1 and PL-2 with PEA competitor). These data indicate that PL-1 and PL-2 are recognized by the same or similar lens transcription factors. Assays monitoring the binding of lens nuclear factors to OL-1 and OL-2 revealed both similarities and differences between the resulting gel-retarded complexes. Both OL-1 and OL-2 produced a relatively slowly moving band (Fig. 8, band B-1) as well as one migrating slightly faster than B-1 (OL-1 and OL-2 with no competitor). Only B-1 complex

assays (58) were conducted to test the ability of putative ,Bl-crystallin gene cis-acting regulatory elements to bind lens nuclear factors (Fig. 8). Double-stranded oligodeoxynucleotides containing either PL-1 or PL-2 sequences both produced a broad band containing multiple gel-retarded complexes when incubated in embryonic chicken lens nuclear extracts (PL-1 and PL-2, no competitor). Complex formation by both PL-1 and PL-2 was inhibited in the presence of competitor oligodeoxynucleotides containing their corresponding wild-type sequences (Fig. 8; PL-1 with PL-1 competitor and PL-2 with PL-2 competitor) but not by unrelated sequences (PL-1 and PL-2 with OL-1 and OL-2 competitors), indicating the sequence-specific binding of lens nuclear factors. Mutated PL-1 and PL-2 sequences that decreased PBl-crystallin promoter activity in transfection experiments failed to compete for complex formation (PL-1 with M6A competitor and PL-2 with M7 competitor), while the PL-2 mutant sequence that did not alter promoter activity competed efficiently (PL-2 with M6 competitor). This correlation between complex formation and transcrip-

Relative

spi SP' 53 OL-2 PL-1 rPL-2 GICCGICT ATGTGATGACTGGGC GGCCGCACAGA4 ACTGATGAGCTGGCIACTTCCATITGTGTGCCCGCCCGC

-126

OL-1

wtT

M2A GC M3B ACGCGT

M6A

CAC M7C AA

M17 AT M7

AGGCCT M6 AT M19 GCGA

CAT Activity

6.3 ± 0.3 7.8 ± 0.8 6.8 ± 0.8 0.7 ± 0.1 32 ± 0.1 3.1 ±0.3 3.0 ± 0.3 8.8 ± 2.3 3.1 ±0.4 7.1 ± 1.1

M18 GCA FIG. 6. Identification of 3B1-crystallin gene promoter cis-acting regulatory elements by site-directed mutagenesis. A series of PBlcrystallin-CAT plasmids containing mutations distributed throughout the PBl-crystallin gene promoter was constructed as described in Materials and Methods, and each was assayed for its effect on CAT gene expression when transfected into PLEs. Relative CAT activities + standard errors were calculated as described in the legend to Fig. 2 and were averaged from at least three separate experiments.

1494

ROTH ET AL.

MOL. CELL. BIOL.

B 296f

A

3amHI 381 -Crystaill'

43 71

G,enornli4< 16

DNA 250 2028

:,BR32'.1 353 1078 972 603

j!'Kpr.

..~~~~~~~~~Br .,

4

3.310i

D.

C

A37 9a1:

2250 2028

35--

U'

1076

353 078 --

I:.

603 -

FIG. 7. In vitro transcription of the 1B1-crystallin gene in a HeLa cell extract. (A) Recombinant plasmid (p3Bl-162) containing the promoter of the fBl-crystallin gene. A 3.3-kb BamHI fragment containing the entire ,BB1 structural gene plus 2% bp of 5'-flanking sequences was cloned into the BamHI site of pBR322. To generate runoff transcripts of different sizes, supercoiled plasmid DNA was digested with BamHI, BamHI plus KpnI, and BamHI plus SstI, respectively; the resulting transcripts are shown in panel B. (B) Autoradiograms of the products of in vitro transcription with different digests of the plasmid pI3Bl-162. Lanes M, DNA size markers (indicated in bases on the left); 1, BamHI; 2, BamHI plus KpnI; 3, BamHI plus SstI. (C) Si nuclease mapping of the 5' ends of the in vitro-synthesized RNA. RNA synthesized from the supercoiled plasmid template was hybridized with a purified BamHI-SstI probe labeled at the SstI site. The DNA-RNA hybrid was digested with S1 nuclease, glyoxylated, and analyzed by electrophoresis in a 1.4% agarose gel. (D) In vitro competition analysis of ,B1 promoter against SV40 promoter. Each assay mixture contained 1.0 ,ug of the BamHI digest of p,BBl-162 and 1.0 ,g of SV40 promoter fragment (NcoI-SphI fragment containing six GC boxes). Lanes M, DNA size markers; 1, 3B1 promoter alone; 2, 3B1 promoter plus SV40 GC boxes.

formation appeared to be sequence-specific, since its formation was inhibited by the corresponding wild-type sequences (OL-1 with OL-1 competitor and OL-2 with OL-2 competitor) but not by unrelated sequences (OL-1 and OL-2 with PL-2 competitor). Formation of the band migrating just ahead of B-1 was inhibited by all competitor oligodeoxynucleotides, indicating nonspecific binding. Interestingly, lens nuclear factors produced an additional complex only with OL-2 (Fig. 8, lane B-2). Whereas both OL-1 and OL-2 competed for B-1 complex formation (OL-2 with OL-1 and OL-2 competitor), only OL-2 competed for B-2 complex formation (OL-2 with OL-2 competitor). Furthermore, B-2 complex formation correlated with transcriptional activity, since mutated OL-2 sequences that reduced promoter activity in transfection experiments (M19) failed to compete for B-2 complex formation (OL-2 with M19 competitor), consistent with the nuclear factor(s) contained in the B-2 complex being a lens transcription factor(s). By

contrast, B-1 complex formation did not correlate with transcriptional activation; i.e., M3B, which did not reduce promoter activity, failed to compete with wild-type OL-1 sequences for B-1 complex formation (OL-1 with M3B

competitor). Finally, an oligodeoxynucleotide containing the OBS region of the sea urchin histone H2B promoter (62) did not compete with OL-1 for B-1 complex formation (Fig. 8; OL-1 with H2B Oct. competitor). It did, however, compete with OL-2 for formation of both the B-1 and B-2 complexes (OL-2 with H2B Oct. competitor), suggesting structural similarities between octamer binding transcription factors and lens transcription factors that recognize OL-2. DISCUSSION Previous studies have begun to reveal the mechanisms responsible for the transcriptional regulation of the aA-

PL-2

PL-1

Competitor

Competitor < j O D Z-EL E

CN cl

c

r , Co20 0

Competitor

I~~~~~~~~~~~~~~~~~~~~ (1) C' c cs -co.- CN 0 -jN tD Jfl z L 2 o 0 O

w -

..aa.a

-7 a)

c