Research Article Received: 17 November 2013,
Revised: 12 January 2014,
Accepted: 10 February 2014
Published online in Wiley Online Library
(wileyonlinelibrary.com) DOI 10.1002/jat.3007
Cardiotoxicity evaluation of anthracyclines in zebrafish (Danio rerio) Ying Hana, Jing-pu Zhanga*, Jian-qin Qianb and Chang-qin Hub* ABSTRACT: Drug-induced cardiotoxicity is a leading factor for drug withdrawals, and limits drug efficacy and clinical use. Therefore, new alternative animal models and methods for drug safety evaluation have been given great attention. Anthracyclines (ANTs) are widely prescribed anticancer agents that have a cumulative dose relationship with cardiotoxicity. We performed experiments to study the toxicity of ANTs in early developing zebrafish embryos, especially their effects on the heart. LC50 values for daunorubicin, pirarubicin, doxorubicin (DOX), epirubicin and DOX-liposome at 72 h post-fertilization were 122.7 μM, 111.9 μM, 31.2 μM, 108.3 μM and 55.8 μM, respectively. At the same time, zebrafish embryos were exposed to ANTs in three exposure stages and induced incomplete looping of the heart tube, pericardia edema and bradycardia in a dose-dependent manner, eventually leading to death. DOX caused the greatest heart defects in the treatment stages and its liposome reduced the effects on the heart, while daunorubicin produced the least toxicity. Genes and proteins related to heart development were also identified to be sensitive to ANT exposure and downregulated by ANTs. It revealed ANTs could disturb the heart formation and development. ANTs induced cardiotoxicity in zebrafish has similar effects in mammalian models, indicating that zebrafish may have a potential value for assessment of drug-induced developmental cardiotoxicity. Copyright © 2014 John Wiley & Sons, Ltd. Additional supporting information may be found in the online version of this article at the publisher’s web-site. Keywords: cardiotoxicity; anthracycline; zebrafish embryo; cardiac genes; alternative animal model
Introduction Drug-induced cardiotoxicity has been a leading reason for drug withdrawals, and limits drug efficacy and clinical use. For example, rofecoxib, terfenadine and cisapride have been withdrawn or restricted (Baud et al., 2007; Kannankeril et al., 2010). Druginduced cardiotoxicity is not restricted to a specific therapeutic area; almost every therapeutic class of drugs has produced unanticipated cardiotoxicities (e.g., torsade de pointe and progressive cardiomyopathy), including anthracyclines (ANTs) and other anticancer agents, antiretrovirals, antibacterials, antifungals, psychotropics and antihistamines (Killeen, 2009; Raschi et al., 2009; van Noord et al., 2010). Currently, the early prediction for cardiotoxicity has become stringent and an important issue in new drug research and development. Therefore, alternative animal models and methods for drug safety evaluation have been given great attention. Zebrafish has become an important in vivo model in biology, such as genetics, embryonic development, environmental science, preclinical medicine, toxicology and drug discovery. Similarities of drug metabolism systems, genetics and pharmacology between zebrafish and mammals have prompted using zebrafish to study drug metabolism, pharmacology and toxicology (Li et al., 2010; Scholz, 2012; Takaki et al., 2012). Recently, abundant chemical and drug toxicity screening have been conducted using zebrafish embryos (Chen et al., 2012; Mathias et al., 2012; Peterson and Fishman, 2011). Relevance and predictability of drug response between zebrafish and human have been studied, and it has been found that zebrafish show a high percentage of predictability (78% and 70%) of drug response (Hung et al., 2012; Sukardi et al., 2011). The zebrafish heart, which begins beating within 26 h postfertilization (hpf) and looping by 48 hpf, is encased by a
J. Appl. Toxicol. 2014
pericardial sac in the thoracic cavity below the pectoral bone and the atrium, which is medially dorsal and posterior to the ventricle (Bakkers, 2011), provides an easy-handling, low-cost and high-throughput system to observe heart rate and structure change and to perform gene alteration assays. ANT antineoplastic antibiotics have been one of the major successful medicines in the chemotherapy of malignant diseases. The two early ANTs, daunorubicin (DAU) and doxorubicin (DOX) despite a minor difference in structure (Fig. 1), have been shown to exhibit different spectra of anticancer activity. DAU activity is in acute lymphoblastic or myeloblastic leukemia, and DOX is a first-line choice for treating breast cancer, childhood solid tumors, soft tissue sarcomas, leukemia and aggressive lymphomas. Unfortunately, the therapeutic potential of ANTs is limited by their cumulative dose-dependent cardiotoxicity (i.e., cardiomyopathy and congestive heart failure). The delayed cardiotoxicity of ANTs most likely appears many years later and affects treatment efficacy (Valdivieso et al., 2012). New derivatives, such as epirubicin (EPI) and pirarubicin (PIRA) (Fig. 1),
*Correspondence to: Jing-pu Zhang, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China. E-mail: [email protected] Chang-qin Hu, National Institutes for Food and Drug Control, Beijing 100050, China. E-mail: [email protected] a Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China b
National Institutes for Food and Drug Control, Beijing 100050, China
Copyright © 2014 John Wiley & Sons, Ltd.
Y. Han et al.
Figure 1. Chemical structures of the four main anthracyclines (ANTs) in this study. ANTs are composed of a rigid planar tetracyclic structure with adjacent quinone and hydroquinone moieties, a short side chain with a carbonyl group at C-13, and an aminosugar daunosamine attached by a glycosidic bond to the C-7 of the tetracyclic ring. Doxorubicin (DOX) differs from daunorubicin only by the presence of a C-14 hydroxyl group. Epirubicin is an epimer of DOX differing only in the orientation of the hydroxyl group on daunosamine. Pirarubicin is a DOX analog with a C-4′ of tetrahydropyranyl group. In each ANT map, the left shows an ANT chemical structure, and the right is the ANT corresponding stable conformation structure by theoretical calculation.
have become valuable alternatives to DOX. However, none of the analogs has more potent antitumor efficacy than their forerunners, and none of them has substantially improved cardiac safety (Robert, 2007). The efforts to overcome this limitation of ANT therapy have led in recent years to the development of modified forms of DOX, such as the liposomal form (DOX-LS). Clinical studies have shown that the liposomal DOX results in a prolonged plasma half-life and an alteration in tissue distribution, with reduced cardiotoxicity in patients (Morotti et al., 2011). In this study, zebrafish embryos were used as a model to explore reliable detection parameters for ANT-induced cardiotoxicity evaluation. Effects analyzed were lethality, morphological change of the heart, heart rate, heart-specific gene and protein expression. This study may contribute to improving the understanding of drug-induced cardiotoxicity, and providing an easy in vivo model for screening drug candidates for cardiotoxicity in the early phase of drug development.
Materials and Methods Laboratory Animals Zebrafish (Danio rerio) of the AB wild-type strain were originally obtained from the College of Life Sciences, Beijing University,
wileyonlinelibrary.com/journal/jat
which were normally maintained under a 14 h light/10 h dark cycle in an automatic circulating tank system and fed live brine shrimp once daily. The water temperature was maintained at 28 ± 1 °C and pH 7.0 ± 0.5. The day before spawning, two pairs of adult zebrafish were placed in a breeding tank equipped with a spawning tray. Shortly after spawning, embryos were collected from the tank and placed in Petri dishes filled with embryo water (60 mg · l–1 Instant Ocean salts, pH 7.2) (Westerfield, 2007), and fertilized embryos were selected for all experiments. All experimental protocols were approved by and in accordance with the regulations of Good Laboratory Practice for non-clinical laboratory studies of drugs issued by the National Scientific and Technologic Committee of the People’s Republic of China.
Chemicals The reference substances, DOX hydrochloride (CAS no. 25316-40-9), DAU (CAS no. 20830-81-3) and DOX liposome were obtained from the National Institutes for Food and Drug Control (Beijing, China). The drugs, epirubicin hydrochloride (CAS no. 56390-09-1) was obtained from Zhejiang Hisun Pharmaceutical Co., Ltd. (Zhejiang, China) and PIRA (CAS no. 72496-41-4) was obtained from the Mercian Corporation (Tokyo, Japan). Dimethyl sulfoxide (DMSO,
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo tissue culture grade) was purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA). Final concentrations of DMSO or phosphatebuffered saline were 0.5% or lower in exposure medium. Groups and Experimental Protocol Drugs were dissolved in DMSO or phosphate-buffered saline as needed to prepare a stock solution. The working solutions were prepared by diluting the stock solution with embryo water. Embryos were exposed to the drug solutions at 1, 10, 20, 50, 100, 200 and 500 μM in 20 mm Petri dishes (with 20–30 embryos per dish) at 28 °C during the exposure stages, which were designed in three stages: 6–72, 24–72 and 48–72 hpf. The endpoints were observed at 72 hpf. The normal control group was wild-type embryos treated with embryo water. Zebrafish Development Observation and Recording Zebrafish embryos were exposed to DOX, DAU, DOX-LS, EPI and PIRA separately from 6 to 72 hpf as described above. The endpoints were observed at 72 hpf. The range of drug concentrations was adjusted according to data from a preliminary experiment (data not shown). Larva death was judged by heartbeat stoppage. During the experimental duration, the embryos were examined daily and dead embryos were removed from the exposure chambers to prevent contamination of the surviving embryos. The phenotypes were observed and recorded daily using a stereomicroscope SZX16 (Olympus, Tokyo, Japan) connected to a digital camera EOS 500D (Canon, Tokyo, Japan). This assay was repeated in triplicate with 30 embryos per group. Heart Rate, Pericardial Sac Areas and Heart Tube Looping At 72 hpf, embryos/larvae were observed using a stereomicroscope SZX16 with a camera DVC-340 M (Thorlabs Inc., Newton, New Jersey, USA). To measure heart rate, pericardial sac areas and the looping of the heart tube, zebrafish lateral images were collected by video recording for data derived from at least five embryos/larvae at the same magnification. The heart rate for each larva was recorded by counting beats per minute on the live video as previously described (Incardona et al., 2004). The pericardial areas were outlined and measured to quantify the severity of pericardial edema according to the literature (Carney et al., 2006; Chen et al., 2008). The looping of the heart tube was quantified by measuring the distance between the sinus venosus (SV) and bulbus arteriosus (BA) as previously described (Antkiewicz et al., 2005) with modifications. Image J software (http://imagej.nih.gov/ij/index.html) was used to determine the
heart rate. DVCView 3.5 application software (Thorlabs Inc.) was used to assess the pericardial sac area and the length of a straight line between SV and BA. The heart rate, area and length of the normal control groups were normalized to 100%, and results from the drug-treated groups were expressed as a percentage of the control group. RNA Isolation and Reverse Transcription–Polymerase Chain Reaction Transcription levels of marker genes related to heart development were detected, including atrial myosin heavy chain (amhc), cardiac myosin light chain (cmlc2), GATA-binding protein 5 (gata5), heart and neural crest derivatives expressed transcript 2 (hand2), hyaluronan synthase 2 (has2), NK2 transcription factor related 5 (nkx2.5) and ventricular myosin heavy chain (vmhc). Total RNA was isolated from 30 larvae per treatment group (6–72 hpf) and was performed with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. First-strand cDNA was synthesized by oligo-dT primer and M-MLV Reverse Transcriptase (RT) (Promega, Madison, Wisconsin USA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) primers specific for the desired genes and a housekeeping gene were designed with Primer Premier 5.0 (Premier Biosoft, Palo Alto CA, USA) and were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). The sequence-specific primers are listed in Table 1. β-actin was amplified as a PCR template loading control. The PCR conditions were as follows: 94 °C (30 s), 58 °C (for β-actin) or 56 °C (30 s) and 72 °C (30 s or 50 s based on the gene fragment length) with 26 (for β-actin) or 30 cycles (for the cardiac genes in Table 1). The PCR products were analyzed by 1% agarose gel electrophoresis. The band intensities were determined by Gel-Pro Analyzer 4.0 (Media Cybernetics Inc., Rockville, MD, USA) and normalized to the loading control β-actin levels. Western Blot Analysis For Western blot analysis, embryos were treated with DOX, EPI and DOX-LS, from 6 to 72 hpf. 100 μg of proteins, extracted from embryos of embryonic development stages, were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred on to the supporting nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). Protein blots were blocked with 5% milk in Tris-buffered saline (TBS) (10 mM Tris, pH 8.0; 150 mM NaCl) for 90 min at room temperature. Then, each blot was incubated with the anti-cardiac myosin heavy chain (antiCMHC) and HAND2 antibodies (Abcam, Cambridge, MA, USA) over night at 4 °C with gentle shaking. After washing with TBS
Table 1. Primers for reverse transcriptase–polymerase chain reaction of different cardiac gene markers Gene
Primer F sequence (5′–3′)
Primer R sequence (5′–3′)
nkx2.5 (NM_131421) cmlc2 (AF425743) amhc (AY138982) has2 (NM_153650) hand2 (NM_131626) vmhc (AF114427) gata5 (AJ242515) β-actin (AF057040)
AAAGACGCAAAGACAGAT GCTCAATGGCACAGACCC GATTTCCCAACTTACCCG AGAGGACCCGAAGAAACT ACTCCGTCTGTGGTTCGC ACCCAAGAGTCAAAGTAGGA GGGAAGGAGGTCCAGTAT AATCCCAAAGCCAACAGA
TACTAAACGCAGGGTAGG GGGCAGCAGTTACAGACAGA TCGCTTGCTCCATTTCTT ATTGGAATGAGTCCGATG TTGATGCTCTGGGTCCTG ACAGTCTGGAAGGAGGAG GGCAGTGAAGTGGGAGAC GATACCGCAAGATTCCATAC
J. Appl. Toxicol. 2014
Copyright © 2014 John Wiley & Sons, Ltd.
Size (bp) 466 456 869 980 364 748 444 492
wileyonlinelibrary.com/journal/jat
Y. Han et al. with 0.05% Tween-20 (TBS-T) three times, 15 min each, the blot was incubated with a secondary antibody (antirabbit IgG from ZSGB-BIO, Beijing, China) for 90 min. After being washed twice with TBS-T, then once with TBS (15 min for each), the blot was detected with an immobilon Western chemiluminescent horseradish peroxidase substrate (Millipore, Billerica, MA, USA) according to the instruction manual. After stripping the previous antibody, the blot was rehybridized with the anti-β-actin primary antibody (ZSGB-BIO). Washing the blot three times with TBS-T, it was then incubated with antimouse IgG (secondary antibody from ZSGB-BIO.). After being washed twice with TBS-T and once with TBS, the β-actin expression was detected as described above. Theoretical Study on Molecular Conformational Analysis in Aqueous Environment Based on the pKa values of the above compounds that were predicted by the software ACDLab pKa predictive module, the dissociation status of the compounds were analyzed in neutral aqueous solutions. Among them, the pKa value of amino-group on the 7-side chain glycosyl was approximately 8.3, and according to the software ChemAxon Marvin module, the pKa is predicted as 9.25. Therefore, the amino-group should have a positive charge, and the total electrification of molecules should be in the positive charged state. Molecular mechanical computational analysis. The computational analysis followed our previously published method (Zhang et al., 2013). The initial 3D chemical structures were obtained from the PubMed online compound database. Structures were modified manually if necessary. Conformer generation and minimization were performed with Accerlys Discovery Studio 2.5.5, and the “best” algorithm was used to generate possible conformers. For each structure, the relative energy threshold between conformers was limited to 50 kcal mol–1, and a maximum of 1023 conformers were generated. Subsequently, conformer minimization was performed using the CHARMm force field with a Generalized Born with Molecular Volume implicit solvent model. The dielectric constant of water was fixed to 80.0. After conformation minimization, conformers with the lower energies and characteristic frameworks were selected as global minima candidates for further quantum chemical optimization. Quantum mechanical study. The study was performed following our previously published method (Zhang et al., 2013). Quantum mechanical geometry optimization and thermochemistry calculations were performed with the ORCA 2.9.1 program (Neese, 2012) (http://www.thch.uni-bonn.de/tc/orca; http://www.cec.mpg. de/forschung/molekulare-theorie-und-spektroskopie/orca. html). The density functional theory method BP86 with Grimme’s latest London-Dispersion correction (BP86-D3) (Goerigk and Grimme, 2011) and Ahlrich’s new triple-zeta valence (def2-TZV) plus polarization basis sets (Weigend and Ahlrichs, 2005) were used. All the conformers were first optimized at the def2-TZVP(-df) basis set level to locate the most stable conformers. Subsequently, these conformers were reoptimized at the def2-TZVP(-f) basis set level, and harmonic vibrational frequencies were used to verify that all of the structures were minima on the potential energy surface. These computations took advantage of resolution of the identity approximation with the auxiliary def2-TZVP/J Coulomb fitting basis set (Weigend, 2006) to accelerate the calculation process. The def2-TZVPP basis set was used for final single-point energy calculation for thermochemistry of the minima structures. A COSMO (conductor-like
wileyonlinelibrary.com/journal/jat
screening model) solvation model (Sinnecker et al., 2006) with a dielectric constant of 80.0 was used throughout the quantum mechanical study to represent an aqueous environment. The geometries were visualized using Avogadro software (Hanwell et al., 2012). Calculation of molecular polarity. The molecular polarity of the minima structures were computed using topological polar surface area (TPSA) methodology with Molden 5.0 (Schaftenaar and Noordik, 2000). Statistical Analysis All data and dose–response curves for drugs were plotted by GraphPad Prism 5.0 (GraphPad Software Inc., USA). Statistical analyses were performed using SPSS 13.0 (SPSS Inc., a Jolla, CA, USA SPSS Inc., Armonk, New York, USA). LC5, LC50 and LC95 were defined as the lethal concentration that resulted in 5%, 50% and 95% mortality, respectively, of zebrafish treated with drugs. Heart measures (structural and functional parameters) and RT-PCR semiquantitation of gene expression were compared using one-way ANOVA following Dunnett’s post hoc analysis. Results were presented as the mean ± SD, level of significance was P < 0.05, P < 0.01 or P < 0.001.
Results The Toxicity and Lethal Dosage of Zebrafish Embryos Treated With Anthracyclines Zebrafish embryos were exposed to different concentrations of ANTs at 6 hpf and were scored at 72 hpf. Figure 2 indicated embryo lethality with increasing ANTs concentration. Below 10 μM, the lethality of ANTs was less than 5%. There was a sharp increase in lethality from 20 μM DOX and lethality reached 100% at concentrations greater than 50 μM DOX. LC50 values for DAU, PIRA, DOX, EPI and DOX-LS were 122.7, 111.9, 31.2, 108.3 and 55.8 μM, respectively. LC50 of DOX-LS is higher than DOX, so that it is less toxic than DOX, which implies that liposome modification can reduce DOX lethality in zebrafish. Obviously, DAU, PIRA and EPI have better safety than DOX and DOX-LS for zebrafish embryonic development (Fig. 2; Supplementary Table 1). Zebrafish morphogenesis is also sensitive to ANTs besides lethality. Morphological abnormalities included malformed heart
Figure 2. Dose–response curve of anthracyclines. Zebrafish embryos lethality at 72 hpf. Zebrafish embryos were exposed to anthracyclines at concentrations between 1 μM and 500 μM. These values are presented as the mean ± SD. Three replicates of 30 embryos each were used for each concentration. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo structure, pericardial edema, weak pigmentation, hemorrhage, scoliosis and death as summarized in Fig. 3. At 10 μM, the embryos incubated with DAU, EPI and PIRA showed weak pigmentation and scoliosis (72 hpf). However, the DOX- and DOX-LS-treated groups developed pericardial edema, weak pigmentation and scoliosis, and the DOX-LS-treated group had delayed hatching. At 50 μM, the embryos treated with DAU, EPI and PIRA exhibited pericardial edema and tubular-shaped hearts, whereas at the same concentration, the DOX-treated
group were all dead, and the DOX-LS-treated group were partially dead and underwent delayed hatching. Anthracyclines Caused Heart Defects in Zebrafish Embryos To gain a better understanding of ANTs effects on heart development, the zebrafish embryonic pericardial sac area, cardiac tube looping and heart rate were evaluated as signs of heart development status measured at 72 hpf. The embryos were
Figure 3. Morphological abnormalities induced by anthracycline exposure from 6 to 72 hpf. Morphological abnormalities included pericardial edema, weak pigmentation, late hatching, hemorrhage, scoliosis and death are summarized. These values are presented as the mean ± SD. Three replicates of 30 embryos each were used for each concentration. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
Figure 4. Representative images of zebrafish in the embryonic cardiac assay (at 72 hpf). Zebrafish embryos were treated with anthracyclines during 6–72 hpf, and photographs were taken at 72 hpf. The severity of pericardial sac edema and cardiac abnormality showed anthracycline concentrationdependent response results. The control group is represented as “wt”. The images show the left lateral view of zebrafish embryos. The top scale bar indicates 100 μm, the low scale bar indicates 400 μm. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
J. Appl. Toxicol. 2014
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al. exposed to ANTs at 10, 20, 50 and 100 μM, separately, and at three different treatment stages. In the lateral view, pericardial sac edema is evident, along with an elongated atrium and a compacted ventricle. These defects, indicated in Figs. 4 and 5, were evident at 72 hpf after exposure and became progressively more severe with time. In addition, in Fig. 5, ANT treatment caused pericardial edema in a dose-dependent manner. Differences in exposure stage also affected the severity of pericardial edema. Not exceptionally, the gravest edema occurred in exposure stages of 6–72 hpf in each ANT group. Among the four ANTs, DOX caused the greatest edema, and its liposome reduced toxicity. DAU produced the lowest edema. The distance between the SV and BA provides a marker of the looping of the heart tube into two distinctive heart chambers. In the control embryos, the normal heart looping process places the ventricle and atrium side by side, whereby the two chambers largely overlap with each other in a lateral view. In contrast, the
hearts were stretched out in the ANT-treated embryos, whereby the ventricle was positioned anterior to the atrium. Therefore, in the ANT-exposed embryos, the chambers can be easily distinguished with little overlap. Moreover, in the ANT-treated groups, the atria were thin and elongated, and the ventricles appeared smaller and more compact than normal. To quantify the cardiac looping change of zebrafish hearts affected by ANT treatment, the distance between the SV (the junction where blood flows into the atrium) and BA (the junction where blood flows out from the ventricle) was used as an index of cardiac looping. These results demonstrate that ANT treatments caused a change in the SV-BA distance in a dose-dependent manner (Fig. 6). Like the pericardial sac area, the SV-BA distance was most changed in exposure stage 6–72 hpf in each of the ANT treatment groups. Among the four ANTs, the EPI-treated groups showed significantly elongated SV-BA distance in all three treatment stages. The elongation in the PIRA- and DOX-LS-treated groups occurred
Figure 5. Pericardial edema of zebrafish embryos after anthracycline exposure. Zebrafish embryos were treated with anthracyclines, and the pericardial sac area of the embryos was outlined and measured at the indicated exposure stage as described in the Materials and methods section. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration. *Significant difference between drug treatment and control for a given treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for a given treatment stage (#P < 0.05; ##P < 0.01; ###P < 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
wileyonlinelibrary.com/journal/jat
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo
Figure 6. Distance between the SV and BA in zebrafish embryos after anthracycline exposure. The distance of the control groups are normalized to 100%, and results are expressed as a percentage of the control. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration. *Significant difference between drugs (10, 20 and 50 μM) and control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P < 0.01; ###P < 0.001). BA, bulbus arteriosus; DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin; SV, sinus venosus.
at 24–72 hpf and 6–72 hpf. Unexpectedly, the DOX-treated group exhibited an SV-BA elongation only at 6–72 hpf stage, and the DOX-LS effect presented at 24–72 hpf and 6–72 hpf. There were no significant differences in the SV-BA length between the DAU-treated and control embryos (P > 0.05). Therefore, DAU did not affect the looping of the heart tube into a distinctive two-chambered structure. Heart rates were also assayed at 72 hpf (Fig. 7). DAU and DOX-LS caused no significant difference from the control group in heart rates. DOX inhibited heart rate in a dosedependent manner, excluding the 50 μM group, in which all of the embryos were died. Treatment of PIRA or EPI did not exhibit decreased heart rates except during 6–72 hpf. Overall, the embryonic heart rates were unchanged compared with the production of pericardial edema and SV-BA elongation. Only DOX caused heart rates to decrease significantly at the three administered stages.
J. Appl. Toxicol. 2014
Effects of the Anthracyclines on Cardiac Development and Function-Associated Genes To understand the mechanisms of toxicity of ANTs and explore their effects on cardiac development gene expression, embryos were exposed to ANTs at 1, 10 and 20 μM, corresponding to low, mid and high toxicity, and at 6–72 hpf treatment stages. Wellstudied genes that related to heart development and function were detected using semiquantitative RT-PCR. Seven of these genes, namely amhc (heart atrium-specific expressing gene), cmlc2 (precursor marker of atrium precursor cells and ventricle precursor cells), gata5 (transcription factor expressed in the endodermal progenitors during the late blastula stages, which necessary for the development of the endoderm and heart), hand2 (basic helix– loop–helix transcription factor, expressed in the cardiogenic region of the lateral plate mesoderm and later in the myocardium, as well as in branchial arches), has2 (endocardial valve-specific
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al.
Figure 7. Effect of anthracycline exposure on heart rates of zebrafish embryos. The heart rates of the control groups are normalized to 100%, and results are expressed as a percentage of the control group. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration.*Significant difference between drugs (10, 20 and 50 μM) and its respective control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P 0.01; ###P < 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
marker, restricted to the valve-forming region from approximately 48 hpf), nkx2.5 (marker for cardiac field, involved in ring of cardiac tube, differentiation and proliferation of myocardial cell, and heart morphogenesis) and vmhc (a sign of ventricle precursor cells) were significantly decreased in a concentration-dependent manner (Fig. 8). These results further confirm cardiotoxicity by ANT induction at the gene expression level. These seven genes examined were downregulated by exposure to ANTs. cmlc2 and vmhc mRNA expressions were reduced significantly compared with the control levels at three concentrations (P < 0.01 or P < 0.001) by exposure to DOX, PIRA and DOX-LS. DAU exposure did not significantly alter cmlc2 and gata5 expression levels compared with the control levels (P 0.05). EPI exposure did not significantly alter cmlc2 and hand2 expression compared with control levels (P > 0.05). gata5, has2 and hand2 mRNA expression was reduced significantly from control levels at high concentrations (P < 0.01 or P < 0.001) by exposure to the ANTs. Protein levels of two genes that related to heart development and function were detected using Western blotting. Embryos
wileyonlinelibrary.com/journal/jat
were exposed to ANTs at 1 and 10 μM, and at 6–72 hpf treatment stages. In Fig. 9, expression of HAND2 was generally unchanged by DOX, DOX-LS and EPI. In most mammals and vertebrates, the major contractile protein by mass of skeletal and cardiac muscle is the MHC. Expression of CMHC was not changed by DOX and EPI, but was downregulated significantly by DOX-LS (P < 0.01). Results of Molecular Polarity by Theoretical Calculation Molecular polar surface area (PSA) has proven to be a good descriptor of molecular polarity that is associated with passive transport through cellular membranes, including intestinal absorption and blood–brain barrier permeation (Clark, 2011). The TPSAs of ANT antibiotics are similar based on calculations, indicating that they have a similar capability of passive transfer across cell membranes (Table 2). These results suggest that the toxicity of ANTs may not associate with their different rates of passive diffusion across cellular membranes. The ANTs were analyzed comprehensively on their stable conformation by
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo theoretical calculation and showed high similarity in their structures (Fig. 1). All of the ANTs were determined to form three intramolecular hydrogen bonds that are between the 9-side chain hydroxyl group and the 7-side chain oxygen group, the 5-side carbonyl and 6-side hydroxyl group, as well as between 12-side chain carbonyl and 11-side chain hydroxyl group. The stable structure of DAU in solution is concordant with its crystal structure (Neidle and Taylor, 1977). Our zebrafish experimental results demonstrate that the lethality of DOX and DOX-LS were more potent than the other three ANTs, which had the similar toxicity. DOX showed the highest cardiotoxicity among the ANTs, although they had produced a similar cardiotoxic phenotype.
Discussion
Figure 8. Expression variation of genes related to heart development and functions in zebrafish after anthracycline exposure. Embryos were dosed at 6 hpf and collected at 72 hpf for analysis of gene expression by reverse transcription–polymerase chain reaction. The target gene bands were evaluated by semiquantitative density scanning. (A) Representative result of agarose gel electrophoresis. (B–H) Histograms for relative variation of mRNA levels of amhc (B), clmc2 (C), gata5 (D), hand2 (E), has2 (F), nkx2.5 (G) and vmhc (H). Expression is shown as fold change compared with β-actin controls. These values are presented as the mean ± SD. Three or four replicates of 30 embryos each were used for each concentration. *Significant difference between drugs (1, 10 and 20 μM) and their respective control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P < 0.01; ###P 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
J. Appl. Toxicol. 2014
In this study, we used zebrafish embryos as a model to evaluate ANTs cardiotoxicity. Toxic effects of ANTs on zebrafish embryonic development were analyzed. These results suggest high toxicity of ANTs on embryonic development, including cardiogenesis, heart formation, survival, hatching and some gene expression alterations. The ANT treatment caused zebrafish pericardia edema followed by cardiac distortion and bradycardia in some different levels among these ANTs (Figs. 4–7). At the tested stage and within the tested concentration range, groups of DAU, EPI and PIRA showed similar rates of abnormality and lethality that were lower than the DOX group, indicating the three drugs have lower toxicity than DOX (Figs. 2–7). It is worth a mention that differential abnormal characteristics between DOX and DOX-LS were exhibited, such as lower embryonic lethality and less incidence of pericardial edema in the DOX-LS group than the DOX group (Fig. 3; Supplementary Table 2), suggesting that DOX-LS reduced cardiac toxicity, which is similar to previous reports (Menna et al., 2012; Smith et al., 2010). However, the total teratogenic ratio in DOX-LS was higher than in DOX (Fig. 3) including delayed hatching. The toxicity difference may have resulted from a change of the DOX-LS distribution in vivo and decrease of its accumulation in heart tissue. A previous report presented that direct perfusion of DaunoXome, a liposomal DAU in isolated hearts of animals resulted in a 12-fold reduction of the accumulation of DAU in heart tissue as compared to the perfusion of free DAU (Pouna et al., 1996). Others reported that the liposomal formulation of ANTs reduced cardiotoxicity and did not affect delivery of ANTs to tumors (Rahman et al., 2007; Working et al., 1999). In zebrafish, a liposomal formulated anticancer compound SANT75 not only improved solubility and bioavailability but also efficiently improved the survival time without obvious systemic toxicity (Yuan et al., 2013). These results demonstrate that ANTs induce similar cardiac defects in zebrafish as in mammals (Robert, 2007). How did the ANTs disturb embryonic heart cardiogenesis and development? To address the issue, some key genes involved in cardiac development were detected and downregulated in the ANT-treated embryos. Zebrafish vmhc and amhc are markers of ventricular myocardium and atrium myocardium, respectively, in cardiogenesis (Yelon et al., 1999) and are important for cardiac morphogenesis (Berdougo et al., 2003). Gene cmlc2 is an essential component of the thick myofilament assembly and contractility of the heart (Rottbauer et al., 2006). CMHC exists as two isoforms in mammals, alpha-CMHC and beta-CMHC. These two isoforms are expressed in different amounts in the mammal heart (Ng et al., 1991). DOX-LS-treated embryos showed developmental delay and the expression of CMHC was
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al.
Figure 9. Expression variation of proteins related to heart development and functions in zebrafish after anthracycline exposure. Embryos were dosed at 6 hpf and collected at 72 hpf for analysis of protein expression by Western blotting. Histograms for relative variation of protein levels of CMHC and HAND2. Expression is shown as fold change compared with β-actin controls. These values are presented as the mean ± SD. Three or four replicates of 30 embryos each were used for each concentration. *Significant difference between drugs (1 and 10 μM) and their respective control for each treatment stage (**P < 0.01). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
Table 2. TPSA values of ANT antibiotics ANTs
TPSA
Daunorubicin Doxorubicin Epirubicin Pirarubicin
166.354 188.102 189.679 177.588
ANTs, anthracylenes; TPSA, topological polar surface area.
downregulated. Zebrafish gata5 plays a role in the migration of cardiac progenitors from the anterior lateral plate mesoderm towards the midline of the embryo and regulates the expression of the early myocardial gene nkx2.5 (Peterkin et al., 2007). hand2 is involved in the development of the heart and vasculature, which can promote ventricular cardiomyocyte expansion (Zhao et al., 2005). In zebrafish, hand2 plays pivotal roles in cardiac morphogenesis and cardiac-specific transcription (Yelon, 2001). has2, a major hyaluronan synthase, is expressed during embryogenesis and is responsible for the production of hyaluronic acid, one of the ECM components of cardiac jelly, which is also required for cardiac looping in zebrafish embryos (Smith et al., 2008). nkx2.5 is a key transcription factor expressed first in early cardiac progenitors at late gastrulation and later in the myogenic layer of the heart and is necessary for regulating differentiation, maturation and maintenance of cardiomyocytes throughout life (Sultana et al., 2008). Knockdown of nkx2.5 has been shown to cause a variety of cardiac defects in heart chamber formation, as well as pericardial edema (Targoff et al., 2008), similar to the phenotype observed in our ANT-treated embryos. The downregulation of this gene expression provides a potential mechanism for ANT-induced cardiotoxicity. Thus, these genes and proteins may be used as biomarkers for ANT antibiotics cardiotoxicity in vertebrate embryonic development. The TPSA is a fast and reliable parameter of calculating molecular PSA. It produces nearly equivalent results as the conventionally more sophisticated PSA algorithm (Ertl et al., 2000). In this
wileyonlinelibrary.com/journal/jat
study, the ANTs showed similar TPSAs and the conformations in water solution by theoretical calculation, indicated that they have a similar capability of passive transfer across cell membranes. However, they produced different level of effects on zebrafish embryos. These results suggest that they transfer equally across cell membranes by passive diffusion, and might bind to a cellular receptor with varied binding capacity, leading to the differential toxicity observed. Presently, the cardiotoxicity of ANTs are likely caused by an oxidative stress reaction as follows: a homologue semiquinone free radical can be produced by the ANT anthraquinone structure that is catalyzed by reductases or NADH dehydrogenase. The semiquinone free radical can react with oxygen to form superoxide anion and then the latter reacts with superoxide dismutase to form hydrogen peroxide and oxygen. Moreover, hydrogen peroxide further produces hydroxyl free radical (OH–), which leads to oxidation reactions. The absence of hydrogen peroxidase in myocardial cells is a presumed reason for ANT-induced cardiotoxicity because myocardial cells are easily damaged by free radicals. Further, superoxide anion and hydroxyl free radicals cause peroxidation of lipids, proteins and nucleic acids, leading to cell damage. Moreover, DOX has been found to be specifically accumulated in heart mitochondria and to produce active oxygen species, which impair mitochondria proteins and nucleic acids. Additionally, DOX can react with Fe3+ by the Haber–Weiss reaction to form free radicals that injure DNA. ANT metabolites of their hydroxyl derivatives, such as doxorubicinol and daunorubicinol from their 12-side carbonyl reductive form, exhibit higher toxicity than the parent drugs themselves, indicated another reason for cardiotoxicity (Robert and Gianni, 1993). Moreover, several studies have demonstrated that EPI produced fewer hydroxyl metabolites than DOX, which may explain the lower cardiotoxicity of EPI compared with DOX (Berthiaume and Wallace, 2007). Dosage forms can improve the safety of ANTs. For example, encapsulated ANTs in liposomes reduced myocardial uptake and reduced myocardial damage (Sawyer et al., 2010). These results suggest that the cardiotoxicity might be dependent on the drug concentration within myocardial cells. In summary, zebrafish embryos may be a promising model for evaluating drug-induced cardiotoxicity.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo
Funding This study was supported by the National Natural Science Foundation of China (no. 81173043 and 30772681), and National S&T Major Special Project on Major New Drug Innovation (Item Number: 2012ZX09301002-001-021) grants.
Acknowledgments We thank Miss Jie Meng’ endeavor in fish administration, and thank Professor Anming Meng (Tsinghua University, Beijing, China) supplying the zebrafish AB stain seedling.
Conflict of Interest The Authors did not report any conflict of interest.
References Antkiewicz DS, Burns CG, Carney SA, Peterson RE, Heideman W. 2005. Heart malformation is an early response to TCDD in embryonic zebrafish. Toxicol. Sci. 84: 368–377. Bakkers J. 2011. Zebrafish as a model to study cardiac development and human cardiac disease. Cardiovasc. Res. 91: 279–288. Baud FJ, Megarbane B, Deye N, Leprince P. 2007. Clinical review: aggressive management and extracorporeal support for drug-induced cardiotoxicity. Crit. Care 11: 207. Berdougo E, Coleman H, Lee DH, Stainier DY, Yelon D. 2003. Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish. Development 130: 6121–6129. Berthiaume JM, Wallace KB. 2007. Adriamycin-induced oxidative mitochondrial cardiotoxicity. Cell Biol. Toxicol. 23: 15–25. Carney SA, Chen J, Burns CG, Xiong KM, Peterson RE, Heideman W. 2006. Aryl hydrocarbon receptor activation produces heart-specific transcriptional and toxic responses in developing zebrafish. Mol. Pharmacol. 70: 549–561. Chen J, Carney SA, Peterson RE, Heideman W. 2008. Comparative genomics identifies genes mediating cardiotoxicity in the embryonic zebrafish heart. Physiol. Genomics 33: 148–158. Chen YH, Lee HC, Hsu RJ, Chen TY, Huang YK, Lo HC, Hu SC, Harn HJ, Jeng JR, Sun CK, Lin SZ, Tsai HJ. 2012. The toxic effect of Amiodarone on valve formation in the developing heart of zebrafish embryos. Reprod. Toxicol. 33: 233–244. Clark DE. 2011. What has polar surface area ever done for drug discovery? Future Med. Chem. 3: 469–484. Ertl P, Rohde B, Selzer P. 2000. Fast calculation of molecular polar surface area as a sum of fragment-based contributions and its application to the prediction of drug transport properties. J. Med. Chem. 43: 3714–3717. Goerigk L, Grimme S. 2011. A thorough benchmark of density functional methods for general main group thermochemistry, kinetics, and noncovalent interactions. Phys. Chem. Chem. Phys. 13: 6670–6688. Hanwell MD, Curtis DE, Lonie DC, Vandermeersch T, Zurek E, Hutchison GR. 2012. Avogadro: an advanced semantic chemical editor, visualization, and analysis platform. J. Cheminform. 4: 17. Hung MW, Zhang ZJ, Li S, Lei B, Yuan S, Cui GZ, Man Hoi P, Chan K, Lee SM. 2012. From omics to drug metabolism and high content screen of natural product in zebrafish: a new model for discovery of neuroactive compound. Evid. Based Complement. Alternat. Med. 2012: 605303. Incardona JP, Collier TK, Scholz NL. 2004. Defects in cardiac function precede morphological abnormalities in fish embryos exposed to polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 196: 191–205. Kannankeril P, Roden DM, Darbar D. 2010. Drug-induced long QT syndrome. Pharmacol. Rev. 62: 760–781. Killeen MJ. 2009. Drug-induced arrhythmias and sudden cardiac death: implications for the pharmaceutical industry. Drug Discov. Today 14: 589–597.
J. Appl. Toxicol. 2014
Li S, Pozhitkov A, Ryan RA, Manning CS, Brown-Peterson N, Brouwer M. 2010. Constructing a fish metabolic network model. Genome Biol. 11: R115. Mathias JR, Saxena MT, Mumm JS. 2012. Advances in zebrafish chemical screening technologies. Future Med. Chem. 4: 1811–1822. Menna P, Paz OG, Chello M, Covino E, Salvatorelli E, Minotti G. 2012. Anthracycline cardiotoxicity. Expert Opin. Drug Saf. 11(Suppl. 1): S21–36. Morotti M, Valenzano Menada M, Venturini PL, Ferrero S. 2011. Pharmacokinetic and toxicity considerations for the use of anthracyclines in ovarian cancer treatment. Expert Opin. Drug Metab. Toxicol. 7: 707–720. Neese F. 2012. The ORCA program system. Wiley Interdiscip. Rev. Comput. Mol. Sci. 2: 73–78. Neidle S, Taylor G. 1977. Nucleic acid binding drugs. Part IV. The crystal structure of the anti-cancer agent daunomycin. Biochim. Biophys. Acta 479: 450–459. Ng WA, Grupp IL, Subramaniam A, Robbins J. 1991. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ. Res. 68: 1742–1750. Peterkin T, Gibson A, Patient R. 2007. Redundancy and evolution of GATA factor requirements in development of the myocardium. Dev. Biol. 311: 623–635. Peterson RT, Fishman MC. 2011. Designing zebrafish chemical screens. Methods Cell Biol. 105: 525–541. Pouna P, Bonoron-Adele S, Gouverneur G, Tariosse L, Besse P, Robert J. 1996. Development of the model of rat isolated perfused heart for the evaluation of anthracycline cardiotoxicity and its circumvention. Br. J. Pharmacol. 117: 1593–1599. Rahman AM, Yusuf SW, Ewer MS. 2007. Anthracycline-induced cardiotoxicity and the cardiac-sparing effect of liposomal formulation. Int. J. Nanomed. 2: 567–583. Raschi E, Vasina V, Ursino MG, Boriani G, Martoni A, De Ponti F. 2009. Anticancer drugs and cardiotoxicity: Insights and perspectives in the era of targeted therapy. Pharmacol. Ther. 125: 196–218. Robert J. 2007. Preclinical assessment of anthracycline cardiotoxicity in laboratory animals: predictiveness and pitfalls. Cell Biol. Toxicol. 23: 27–37. Robert J, Gianni L. 1993. Pharmacokinetics and metabolism of anthracyclines. Cancer Surv. 17: 219–252. Rottbauer W, Wessels G, Dahme T, Just S, Trano N, Hassel D, Burns CG, Katus HA, Fishman MC. 2006. Cardiac myosin light chain-2: a novel essential component of thick-myofilament assembly and contractility of the heart. Circ. Res. 99: 323–331. Sawyer DB, Peng X, Chen B, Pentassuglia L, Lim CC. 2010. Mechanisms of anthracycline cardiac injury: can we identify strategies for cardioprotection? Prog. Cardiovasc. Dis. 53: 105–113. Schaftenaar G, Noordik JH. 2000. Molden: a pre- and post-processing program for molecular and electronic structures. J. Comput. Aided Mol. Des. 14: 123–134. Scholz S. 2012. The zebrafish has become an attractive model organism in many areas of research ranging from basic developmental biology to applied toxicology. Reprod. Toxicol. 33: 127. Sinnecker S, Rajendran A, Klamt A, Diedenhofen M, Neese F. 2006. Calculation of solvent shifts on electronic g-tensors with the conductor-like screening model (COSMO) and its self-consistent generalization to real solvents (direct COSMO-RS). J. Phys. Chem. A 110: 2235–2245. Smith KA, Chocron S, von der Hardt S, de Pater E, Soufan A, Bussmann J, Schulte-Merker S, Hammerschmidt M, Bakkers J. 2008. Rotation and asymmetric development of the zebrafish heart requires directed migration of cardiac progenitor cells. Dev. Cell 14: 287–297. Smith LA, Cornelius VR, Plummer CJ, Levitt G, Verrill M, Canney P, Jones A. 2010. Cardiotoxicity of anthracycline agents for the treatment of cancer: systematic review and meta-analysis of randomised controlled trials. BMC Cancer 10: 337. Sukardi H, Chng HT, Chan EC, Gong Z, Lam SH. 2011. Zebrafish for drug toxicity screening: bridging the in vitro cell-based models and in vivo mammalian models. Expert Opin. Drug Metab. Toxicol. 7: 579–589. Sultana N, Nag K, Hoshijima K, Laird DW, Kawakami A, Hirose S. 2008. Zebrafish early cardiac connexin, Cx36.7/Ecx, regulates myofibril orientation and heart morphogenesis by establishing Nkx2.5 expression. Proc. Natl. Acad. Sci. U.S.A. 105: 4763–4768. Takaki K, Cosma CL, Troll MA, Ramakrishnan L. 2012. An in vivo platform for rapid high-throughput antitubercular drug discovery. Cell Rep. 2: 175–184.
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al. Targoff KL, Schell T, Yelon D. 2008. Nkx genes regulate heart tube extension and exert differential effects on ventricular and atrial cell number. Dev. Biol. 322: 314–321. Valdivieso M, Kujawa AM, Jones T, Baker LH. 2012. Cancer survivors in the United States: a review of the literature and a call to action. Int. J. Med. Sci. 9: 163–173. van Noord C, Eijgelsheim M, Stricker BH. 2010. Drug- and non-drugassociated QT interval prolongation. Br. J. Clin. Pharmacol. 70: 16–23. Weigend F. 2006. Accurate Coulomb-fitting basis sets for H to Rn. Phys. Chem. Chem. Phys. 8: 1057–1065. Weigend F, Ahlrichs R. 2005. Balanced basis sets of split valence, triple zeta valence and quadruple zeta valence quality for H to Rn: Design and assessment of accuracy. Phys. Chem. Chem. Phys. 7: 3297–3305. Westerfield M. 2007. The Zebrafish Book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press: Eugene. OR; 1 v. (various pagings). Working PK, Newman MS, Sullivan T, Yarrington J. 1999. Reduction of the cardiotoxicity of doxorubicin in rabbits and dogs by encapsulation in long-circulating, pegylated liposomes. J. Pharmacol. Exp. Ther. 289: 1128–1133.
wileyonlinelibrary.com/journal/jat
Yelon D. 2001. Cardiac patterning and morphogenesis in zebrafish. Dev. Dyn. 222: 552–563. Yelon D, Horne SA, Stainier DY. 1999. Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev. Biol. 214: 23–37. Yuan Y, Zhao Y, Xin S, Wu N, Wen J, Li S, Chen L, Wei Y, Yang H, Lin S. 2013. A novel PEGylated liposome-encapsulated SANT75 suppresses tumor growth through inhibiting hedgehog signaling pathway. PLoS One 8: e60266. Zhang J, Qian J, Tong J, Zhang D, Hu C. 2013. Toxic effects of cephalosporins with specific functional groups as indicated by zebrafish embryo toxicity testing. Chem. Res. Toxicol. 26: 1168–1181. Zhao Y, Samal E, Srivastava D. 2005. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature 436: 214–220.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Revised: 12 January 2014,
Accepted: 10 February 2014
Published online in Wiley Online Library
(wileyonlinelibrary.com) DOI 10.1002/jat.3007
Cardiotoxicity evaluation of anthracyclines in zebrafish (Danio rerio) Ying Hana, Jing-pu Zhanga*, Jian-qin Qianb and Chang-qin Hub* ABSTRACT: Drug-induced cardiotoxicity is a leading factor for drug withdrawals, and limits drug efficacy and clinical use. Therefore, new alternative animal models and methods for drug safety evaluation have been given great attention. Anthracyclines (ANTs) are widely prescribed anticancer agents that have a cumulative dose relationship with cardiotoxicity. We performed experiments to study the toxicity of ANTs in early developing zebrafish embryos, especially their effects on the heart. LC50 values for daunorubicin, pirarubicin, doxorubicin (DOX), epirubicin and DOX-liposome at 72 h post-fertilization were 122.7 μM, 111.9 μM, 31.2 μM, 108.3 μM and 55.8 μM, respectively. At the same time, zebrafish embryos were exposed to ANTs in three exposure stages and induced incomplete looping of the heart tube, pericardia edema and bradycardia in a dose-dependent manner, eventually leading to death. DOX caused the greatest heart defects in the treatment stages and its liposome reduced the effects on the heart, while daunorubicin produced the least toxicity. Genes and proteins related to heart development were also identified to be sensitive to ANT exposure and downregulated by ANTs. It revealed ANTs could disturb the heart formation and development. ANTs induced cardiotoxicity in zebrafish has similar effects in mammalian models, indicating that zebrafish may have a potential value for assessment of drug-induced developmental cardiotoxicity. Copyright © 2014 John Wiley & Sons, Ltd. Additional supporting information may be found in the online version of this article at the publisher’s web-site. Keywords: cardiotoxicity; anthracycline; zebrafish embryo; cardiac genes; alternative animal model
Introduction Drug-induced cardiotoxicity has been a leading reason for drug withdrawals, and limits drug efficacy and clinical use. For example, rofecoxib, terfenadine and cisapride have been withdrawn or restricted (Baud et al., 2007; Kannankeril et al., 2010). Druginduced cardiotoxicity is not restricted to a specific therapeutic area; almost every therapeutic class of drugs has produced unanticipated cardiotoxicities (e.g., torsade de pointe and progressive cardiomyopathy), including anthracyclines (ANTs) and other anticancer agents, antiretrovirals, antibacterials, antifungals, psychotropics and antihistamines (Killeen, 2009; Raschi et al., 2009; van Noord et al., 2010). Currently, the early prediction for cardiotoxicity has become stringent and an important issue in new drug research and development. Therefore, alternative animal models and methods for drug safety evaluation have been given great attention. Zebrafish has become an important in vivo model in biology, such as genetics, embryonic development, environmental science, preclinical medicine, toxicology and drug discovery. Similarities of drug metabolism systems, genetics and pharmacology between zebrafish and mammals have prompted using zebrafish to study drug metabolism, pharmacology and toxicology (Li et al., 2010; Scholz, 2012; Takaki et al., 2012). Recently, abundant chemical and drug toxicity screening have been conducted using zebrafish embryos (Chen et al., 2012; Mathias et al., 2012; Peterson and Fishman, 2011). Relevance and predictability of drug response between zebrafish and human have been studied, and it has been found that zebrafish show a high percentage of predictability (78% and 70%) of drug response (Hung et al., 2012; Sukardi et al., 2011). The zebrafish heart, which begins beating within 26 h postfertilization (hpf) and looping by 48 hpf, is encased by a
J. Appl. Toxicol. 2014
pericardial sac in the thoracic cavity below the pectoral bone and the atrium, which is medially dorsal and posterior to the ventricle (Bakkers, 2011), provides an easy-handling, low-cost and high-throughput system to observe heart rate and structure change and to perform gene alteration assays. ANT antineoplastic antibiotics have been one of the major successful medicines in the chemotherapy of malignant diseases. The two early ANTs, daunorubicin (DAU) and doxorubicin (DOX) despite a minor difference in structure (Fig. 1), have been shown to exhibit different spectra of anticancer activity. DAU activity is in acute lymphoblastic or myeloblastic leukemia, and DOX is a first-line choice for treating breast cancer, childhood solid tumors, soft tissue sarcomas, leukemia and aggressive lymphomas. Unfortunately, the therapeutic potential of ANTs is limited by their cumulative dose-dependent cardiotoxicity (i.e., cardiomyopathy and congestive heart failure). The delayed cardiotoxicity of ANTs most likely appears many years later and affects treatment efficacy (Valdivieso et al., 2012). New derivatives, such as epirubicin (EPI) and pirarubicin (PIRA) (Fig. 1),
*Correspondence to: Jing-pu Zhang, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China. E-mail: [email protected] Chang-qin Hu, National Institutes for Food and Drug Control, Beijing 100050, China. E-mail: [email protected] a Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China b
National Institutes for Food and Drug Control, Beijing 100050, China
Copyright © 2014 John Wiley & Sons, Ltd.
Y. Han et al.
Figure 1. Chemical structures of the four main anthracyclines (ANTs) in this study. ANTs are composed of a rigid planar tetracyclic structure with adjacent quinone and hydroquinone moieties, a short side chain with a carbonyl group at C-13, and an aminosugar daunosamine attached by a glycosidic bond to the C-7 of the tetracyclic ring. Doxorubicin (DOX) differs from daunorubicin only by the presence of a C-14 hydroxyl group. Epirubicin is an epimer of DOX differing only in the orientation of the hydroxyl group on daunosamine. Pirarubicin is a DOX analog with a C-4′ of tetrahydropyranyl group. In each ANT map, the left shows an ANT chemical structure, and the right is the ANT corresponding stable conformation structure by theoretical calculation.
have become valuable alternatives to DOX. However, none of the analogs has more potent antitumor efficacy than their forerunners, and none of them has substantially improved cardiac safety (Robert, 2007). The efforts to overcome this limitation of ANT therapy have led in recent years to the development of modified forms of DOX, such as the liposomal form (DOX-LS). Clinical studies have shown that the liposomal DOX results in a prolonged plasma half-life and an alteration in tissue distribution, with reduced cardiotoxicity in patients (Morotti et al., 2011). In this study, zebrafish embryos were used as a model to explore reliable detection parameters for ANT-induced cardiotoxicity evaluation. Effects analyzed were lethality, morphological change of the heart, heart rate, heart-specific gene and protein expression. This study may contribute to improving the understanding of drug-induced cardiotoxicity, and providing an easy in vivo model for screening drug candidates for cardiotoxicity in the early phase of drug development.
Materials and Methods Laboratory Animals Zebrafish (Danio rerio) of the AB wild-type strain were originally obtained from the College of Life Sciences, Beijing University,
wileyonlinelibrary.com/journal/jat
which were normally maintained under a 14 h light/10 h dark cycle in an automatic circulating tank system and fed live brine shrimp once daily. The water temperature was maintained at 28 ± 1 °C and pH 7.0 ± 0.5. The day before spawning, two pairs of adult zebrafish were placed in a breeding tank equipped with a spawning tray. Shortly after spawning, embryos were collected from the tank and placed in Petri dishes filled with embryo water (60 mg · l–1 Instant Ocean salts, pH 7.2) (Westerfield, 2007), and fertilized embryos were selected for all experiments. All experimental protocols were approved by and in accordance with the regulations of Good Laboratory Practice for non-clinical laboratory studies of drugs issued by the National Scientific and Technologic Committee of the People’s Republic of China.
Chemicals The reference substances, DOX hydrochloride (CAS no. 25316-40-9), DAU (CAS no. 20830-81-3) and DOX liposome were obtained from the National Institutes for Food and Drug Control (Beijing, China). The drugs, epirubicin hydrochloride (CAS no. 56390-09-1) was obtained from Zhejiang Hisun Pharmaceutical Co., Ltd. (Zhejiang, China) and PIRA (CAS no. 72496-41-4) was obtained from the Mercian Corporation (Tokyo, Japan). Dimethyl sulfoxide (DMSO,
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo tissue culture grade) was purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA). Final concentrations of DMSO or phosphatebuffered saline were 0.5% or lower in exposure medium. Groups and Experimental Protocol Drugs were dissolved in DMSO or phosphate-buffered saline as needed to prepare a stock solution. The working solutions were prepared by diluting the stock solution with embryo water. Embryos were exposed to the drug solutions at 1, 10, 20, 50, 100, 200 and 500 μM in 20 mm Petri dishes (with 20–30 embryos per dish) at 28 °C during the exposure stages, which were designed in three stages: 6–72, 24–72 and 48–72 hpf. The endpoints were observed at 72 hpf. The normal control group was wild-type embryos treated with embryo water. Zebrafish Development Observation and Recording Zebrafish embryos were exposed to DOX, DAU, DOX-LS, EPI and PIRA separately from 6 to 72 hpf as described above. The endpoints were observed at 72 hpf. The range of drug concentrations was adjusted according to data from a preliminary experiment (data not shown). Larva death was judged by heartbeat stoppage. During the experimental duration, the embryos were examined daily and dead embryos were removed from the exposure chambers to prevent contamination of the surviving embryos. The phenotypes were observed and recorded daily using a stereomicroscope SZX16 (Olympus, Tokyo, Japan) connected to a digital camera EOS 500D (Canon, Tokyo, Japan). This assay was repeated in triplicate with 30 embryos per group. Heart Rate, Pericardial Sac Areas and Heart Tube Looping At 72 hpf, embryos/larvae were observed using a stereomicroscope SZX16 with a camera DVC-340 M (Thorlabs Inc., Newton, New Jersey, USA). To measure heart rate, pericardial sac areas and the looping of the heart tube, zebrafish lateral images were collected by video recording for data derived from at least five embryos/larvae at the same magnification. The heart rate for each larva was recorded by counting beats per minute on the live video as previously described (Incardona et al., 2004). The pericardial areas were outlined and measured to quantify the severity of pericardial edema according to the literature (Carney et al., 2006; Chen et al., 2008). The looping of the heart tube was quantified by measuring the distance between the sinus venosus (SV) and bulbus arteriosus (BA) as previously described (Antkiewicz et al., 2005) with modifications. Image J software (http://imagej.nih.gov/ij/index.html) was used to determine the
heart rate. DVCView 3.5 application software (Thorlabs Inc.) was used to assess the pericardial sac area and the length of a straight line between SV and BA. The heart rate, area and length of the normal control groups were normalized to 100%, and results from the drug-treated groups were expressed as a percentage of the control group. RNA Isolation and Reverse Transcription–Polymerase Chain Reaction Transcription levels of marker genes related to heart development were detected, including atrial myosin heavy chain (amhc), cardiac myosin light chain (cmlc2), GATA-binding protein 5 (gata5), heart and neural crest derivatives expressed transcript 2 (hand2), hyaluronan synthase 2 (has2), NK2 transcription factor related 5 (nkx2.5) and ventricular myosin heavy chain (vmhc). Total RNA was isolated from 30 larvae per treatment group (6–72 hpf) and was performed with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. First-strand cDNA was synthesized by oligo-dT primer and M-MLV Reverse Transcriptase (RT) (Promega, Madison, Wisconsin USA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) primers specific for the desired genes and a housekeeping gene were designed with Primer Premier 5.0 (Premier Biosoft, Palo Alto CA, USA) and were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). The sequence-specific primers are listed in Table 1. β-actin was amplified as a PCR template loading control. The PCR conditions were as follows: 94 °C (30 s), 58 °C (for β-actin) or 56 °C (30 s) and 72 °C (30 s or 50 s based on the gene fragment length) with 26 (for β-actin) or 30 cycles (for the cardiac genes in Table 1). The PCR products were analyzed by 1% agarose gel electrophoresis. The band intensities were determined by Gel-Pro Analyzer 4.0 (Media Cybernetics Inc., Rockville, MD, USA) and normalized to the loading control β-actin levels. Western Blot Analysis For Western blot analysis, embryos were treated with DOX, EPI and DOX-LS, from 6 to 72 hpf. 100 μg of proteins, extracted from embryos of embryonic development stages, were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred on to the supporting nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). Protein blots were blocked with 5% milk in Tris-buffered saline (TBS) (10 mM Tris, pH 8.0; 150 mM NaCl) for 90 min at room temperature. Then, each blot was incubated with the anti-cardiac myosin heavy chain (antiCMHC) and HAND2 antibodies (Abcam, Cambridge, MA, USA) over night at 4 °C with gentle shaking. After washing with TBS
Table 1. Primers for reverse transcriptase–polymerase chain reaction of different cardiac gene markers Gene
Primer F sequence (5′–3′)
Primer R sequence (5′–3′)
nkx2.5 (NM_131421) cmlc2 (AF425743) amhc (AY138982) has2 (NM_153650) hand2 (NM_131626) vmhc (AF114427) gata5 (AJ242515) β-actin (AF057040)
AAAGACGCAAAGACAGAT GCTCAATGGCACAGACCC GATTTCCCAACTTACCCG AGAGGACCCGAAGAAACT ACTCCGTCTGTGGTTCGC ACCCAAGAGTCAAAGTAGGA GGGAAGGAGGTCCAGTAT AATCCCAAAGCCAACAGA
TACTAAACGCAGGGTAGG GGGCAGCAGTTACAGACAGA TCGCTTGCTCCATTTCTT ATTGGAATGAGTCCGATG TTGATGCTCTGGGTCCTG ACAGTCTGGAAGGAGGAG GGCAGTGAAGTGGGAGAC GATACCGCAAGATTCCATAC
J. Appl. Toxicol. 2014
Copyright © 2014 John Wiley & Sons, Ltd.
Size (bp) 466 456 869 980 364 748 444 492
wileyonlinelibrary.com/journal/jat
Y. Han et al. with 0.05% Tween-20 (TBS-T) three times, 15 min each, the blot was incubated with a secondary antibody (antirabbit IgG from ZSGB-BIO, Beijing, China) for 90 min. After being washed twice with TBS-T, then once with TBS (15 min for each), the blot was detected with an immobilon Western chemiluminescent horseradish peroxidase substrate (Millipore, Billerica, MA, USA) according to the instruction manual. After stripping the previous antibody, the blot was rehybridized with the anti-β-actin primary antibody (ZSGB-BIO). Washing the blot three times with TBS-T, it was then incubated with antimouse IgG (secondary antibody from ZSGB-BIO.). After being washed twice with TBS-T and once with TBS, the β-actin expression was detected as described above. Theoretical Study on Molecular Conformational Analysis in Aqueous Environment Based on the pKa values of the above compounds that were predicted by the software ACDLab pKa predictive module, the dissociation status of the compounds were analyzed in neutral aqueous solutions. Among them, the pKa value of amino-group on the 7-side chain glycosyl was approximately 8.3, and according to the software ChemAxon Marvin module, the pKa is predicted as 9.25. Therefore, the amino-group should have a positive charge, and the total electrification of molecules should be in the positive charged state. Molecular mechanical computational analysis. The computational analysis followed our previously published method (Zhang et al., 2013). The initial 3D chemical structures were obtained from the PubMed online compound database. Structures were modified manually if necessary. Conformer generation and minimization were performed with Accerlys Discovery Studio 2.5.5, and the “best” algorithm was used to generate possible conformers. For each structure, the relative energy threshold between conformers was limited to 50 kcal mol–1, and a maximum of 1023 conformers were generated. Subsequently, conformer minimization was performed using the CHARMm force field with a Generalized Born with Molecular Volume implicit solvent model. The dielectric constant of water was fixed to 80.0. After conformation minimization, conformers with the lower energies and characteristic frameworks were selected as global minima candidates for further quantum chemical optimization. Quantum mechanical study. The study was performed following our previously published method (Zhang et al., 2013). Quantum mechanical geometry optimization and thermochemistry calculations were performed with the ORCA 2.9.1 program (Neese, 2012) (http://www.thch.uni-bonn.de/tc/orca; http://www.cec.mpg. de/forschung/molekulare-theorie-und-spektroskopie/orca. html). The density functional theory method BP86 with Grimme’s latest London-Dispersion correction (BP86-D3) (Goerigk and Grimme, 2011) and Ahlrich’s new triple-zeta valence (def2-TZV) plus polarization basis sets (Weigend and Ahlrichs, 2005) were used. All the conformers were first optimized at the def2-TZVP(-df) basis set level to locate the most stable conformers. Subsequently, these conformers were reoptimized at the def2-TZVP(-f) basis set level, and harmonic vibrational frequencies were used to verify that all of the structures were minima on the potential energy surface. These computations took advantage of resolution of the identity approximation with the auxiliary def2-TZVP/J Coulomb fitting basis set (Weigend, 2006) to accelerate the calculation process. The def2-TZVPP basis set was used for final single-point energy calculation for thermochemistry of the minima structures. A COSMO (conductor-like
wileyonlinelibrary.com/journal/jat
screening model) solvation model (Sinnecker et al., 2006) with a dielectric constant of 80.0 was used throughout the quantum mechanical study to represent an aqueous environment. The geometries were visualized using Avogadro software (Hanwell et al., 2012). Calculation of molecular polarity. The molecular polarity of the minima structures were computed using topological polar surface area (TPSA) methodology with Molden 5.0 (Schaftenaar and Noordik, 2000). Statistical Analysis All data and dose–response curves for drugs were plotted by GraphPad Prism 5.0 (GraphPad Software Inc., USA). Statistical analyses were performed using SPSS 13.0 (SPSS Inc., a Jolla, CA, USA SPSS Inc., Armonk, New York, USA). LC5, LC50 and LC95 were defined as the lethal concentration that resulted in 5%, 50% and 95% mortality, respectively, of zebrafish treated with drugs. Heart measures (structural and functional parameters) and RT-PCR semiquantitation of gene expression were compared using one-way ANOVA following Dunnett’s post hoc analysis. Results were presented as the mean ± SD, level of significance was P < 0.05, P < 0.01 or P < 0.001.
Results The Toxicity and Lethal Dosage of Zebrafish Embryos Treated With Anthracyclines Zebrafish embryos were exposed to different concentrations of ANTs at 6 hpf and were scored at 72 hpf. Figure 2 indicated embryo lethality with increasing ANTs concentration. Below 10 μM, the lethality of ANTs was less than 5%. There was a sharp increase in lethality from 20 μM DOX and lethality reached 100% at concentrations greater than 50 μM DOX. LC50 values for DAU, PIRA, DOX, EPI and DOX-LS were 122.7, 111.9, 31.2, 108.3 and 55.8 μM, respectively. LC50 of DOX-LS is higher than DOX, so that it is less toxic than DOX, which implies that liposome modification can reduce DOX lethality in zebrafish. Obviously, DAU, PIRA and EPI have better safety than DOX and DOX-LS for zebrafish embryonic development (Fig. 2; Supplementary Table 1). Zebrafish morphogenesis is also sensitive to ANTs besides lethality. Morphological abnormalities included malformed heart
Figure 2. Dose–response curve of anthracyclines. Zebrafish embryos lethality at 72 hpf. Zebrafish embryos were exposed to anthracyclines at concentrations between 1 μM and 500 μM. These values are presented as the mean ± SD. Three replicates of 30 embryos each were used for each concentration. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo structure, pericardial edema, weak pigmentation, hemorrhage, scoliosis and death as summarized in Fig. 3. At 10 μM, the embryos incubated with DAU, EPI and PIRA showed weak pigmentation and scoliosis (72 hpf). However, the DOX- and DOX-LS-treated groups developed pericardial edema, weak pigmentation and scoliosis, and the DOX-LS-treated group had delayed hatching. At 50 μM, the embryos treated with DAU, EPI and PIRA exhibited pericardial edema and tubular-shaped hearts, whereas at the same concentration, the DOX-treated
group were all dead, and the DOX-LS-treated group were partially dead and underwent delayed hatching. Anthracyclines Caused Heart Defects in Zebrafish Embryos To gain a better understanding of ANTs effects on heart development, the zebrafish embryonic pericardial sac area, cardiac tube looping and heart rate were evaluated as signs of heart development status measured at 72 hpf. The embryos were
Figure 3. Morphological abnormalities induced by anthracycline exposure from 6 to 72 hpf. Morphological abnormalities included pericardial edema, weak pigmentation, late hatching, hemorrhage, scoliosis and death are summarized. These values are presented as the mean ± SD. Three replicates of 30 embryos each were used for each concentration. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
Figure 4. Representative images of zebrafish in the embryonic cardiac assay (at 72 hpf). Zebrafish embryos were treated with anthracyclines during 6–72 hpf, and photographs were taken at 72 hpf. The severity of pericardial sac edema and cardiac abnormality showed anthracycline concentrationdependent response results. The control group is represented as “wt”. The images show the left lateral view of zebrafish embryos. The top scale bar indicates 100 μm, the low scale bar indicates 400 μm. DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; PIRA, pirarubicin.
J. Appl. Toxicol. 2014
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al. exposed to ANTs at 10, 20, 50 and 100 μM, separately, and at three different treatment stages. In the lateral view, pericardial sac edema is evident, along with an elongated atrium and a compacted ventricle. These defects, indicated in Figs. 4 and 5, were evident at 72 hpf after exposure and became progressively more severe with time. In addition, in Fig. 5, ANT treatment caused pericardial edema in a dose-dependent manner. Differences in exposure stage also affected the severity of pericardial edema. Not exceptionally, the gravest edema occurred in exposure stages of 6–72 hpf in each ANT group. Among the four ANTs, DOX caused the greatest edema, and its liposome reduced toxicity. DAU produced the lowest edema. The distance between the SV and BA provides a marker of the looping of the heart tube into two distinctive heart chambers. In the control embryos, the normal heart looping process places the ventricle and atrium side by side, whereby the two chambers largely overlap with each other in a lateral view. In contrast, the
hearts were stretched out in the ANT-treated embryos, whereby the ventricle was positioned anterior to the atrium. Therefore, in the ANT-exposed embryos, the chambers can be easily distinguished with little overlap. Moreover, in the ANT-treated groups, the atria were thin and elongated, and the ventricles appeared smaller and more compact than normal. To quantify the cardiac looping change of zebrafish hearts affected by ANT treatment, the distance between the SV (the junction where blood flows into the atrium) and BA (the junction where blood flows out from the ventricle) was used as an index of cardiac looping. These results demonstrate that ANT treatments caused a change in the SV-BA distance in a dose-dependent manner (Fig. 6). Like the pericardial sac area, the SV-BA distance was most changed in exposure stage 6–72 hpf in each of the ANT treatment groups. Among the four ANTs, the EPI-treated groups showed significantly elongated SV-BA distance in all three treatment stages. The elongation in the PIRA- and DOX-LS-treated groups occurred
Figure 5. Pericardial edema of zebrafish embryos after anthracycline exposure. Zebrafish embryos were treated with anthracyclines, and the pericardial sac area of the embryos was outlined and measured at the indicated exposure stage as described in the Materials and methods section. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration. *Significant difference between drug treatment and control for a given treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for a given treatment stage (#P < 0.05; ##P < 0.01; ###P < 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
wileyonlinelibrary.com/journal/jat
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo
Figure 6. Distance between the SV and BA in zebrafish embryos after anthracycline exposure. The distance of the control groups are normalized to 100%, and results are expressed as a percentage of the control. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration. *Significant difference between drugs (10, 20 and 50 μM) and control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P < 0.01; ###P < 0.001). BA, bulbus arteriosus; DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin; SV, sinus venosus.
at 24–72 hpf and 6–72 hpf. Unexpectedly, the DOX-treated group exhibited an SV-BA elongation only at 6–72 hpf stage, and the DOX-LS effect presented at 24–72 hpf and 6–72 hpf. There were no significant differences in the SV-BA length between the DAU-treated and control embryos (P > 0.05). Therefore, DAU did not affect the looping of the heart tube into a distinctive two-chambered structure. Heart rates were also assayed at 72 hpf (Fig. 7). DAU and DOX-LS caused no significant difference from the control group in heart rates. DOX inhibited heart rate in a dosedependent manner, excluding the 50 μM group, in which all of the embryos were died. Treatment of PIRA or EPI did not exhibit decreased heart rates except during 6–72 hpf. Overall, the embryonic heart rates were unchanged compared with the production of pericardial edema and SV-BA elongation. Only DOX caused heart rates to decrease significantly at the three administered stages.
J. Appl. Toxicol. 2014
Effects of the Anthracyclines on Cardiac Development and Function-Associated Genes To understand the mechanisms of toxicity of ANTs and explore their effects on cardiac development gene expression, embryos were exposed to ANTs at 1, 10 and 20 μM, corresponding to low, mid and high toxicity, and at 6–72 hpf treatment stages. Wellstudied genes that related to heart development and function were detected using semiquantitative RT-PCR. Seven of these genes, namely amhc (heart atrium-specific expressing gene), cmlc2 (precursor marker of atrium precursor cells and ventricle precursor cells), gata5 (transcription factor expressed in the endodermal progenitors during the late blastula stages, which necessary for the development of the endoderm and heart), hand2 (basic helix– loop–helix transcription factor, expressed in the cardiogenic region of the lateral plate mesoderm and later in the myocardium, as well as in branchial arches), has2 (endocardial valve-specific
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al.
Figure 7. Effect of anthracycline exposure on heart rates of zebrafish embryos. The heart rates of the control groups are normalized to 100%, and results are expressed as a percentage of the control group. Error bars indicate SD. Three replicates of 10 embryos each were used for each concentration.*Significant difference between drugs (10, 20 and 50 μM) and its respective control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P 0.01; ###P < 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
marker, restricted to the valve-forming region from approximately 48 hpf), nkx2.5 (marker for cardiac field, involved in ring of cardiac tube, differentiation and proliferation of myocardial cell, and heart morphogenesis) and vmhc (a sign of ventricle precursor cells) were significantly decreased in a concentration-dependent manner (Fig. 8). These results further confirm cardiotoxicity by ANT induction at the gene expression level. These seven genes examined were downregulated by exposure to ANTs. cmlc2 and vmhc mRNA expressions were reduced significantly compared with the control levels at three concentrations (P < 0.01 or P < 0.001) by exposure to DOX, PIRA and DOX-LS. DAU exposure did not significantly alter cmlc2 and gata5 expression levels compared with the control levels (P 0.05). EPI exposure did not significantly alter cmlc2 and hand2 expression compared with control levels (P > 0.05). gata5, has2 and hand2 mRNA expression was reduced significantly from control levels at high concentrations (P < 0.01 or P < 0.001) by exposure to the ANTs. Protein levels of two genes that related to heart development and function were detected using Western blotting. Embryos
wileyonlinelibrary.com/journal/jat
were exposed to ANTs at 1 and 10 μM, and at 6–72 hpf treatment stages. In Fig. 9, expression of HAND2 was generally unchanged by DOX, DOX-LS and EPI. In most mammals and vertebrates, the major contractile protein by mass of skeletal and cardiac muscle is the MHC. Expression of CMHC was not changed by DOX and EPI, but was downregulated significantly by DOX-LS (P < 0.01). Results of Molecular Polarity by Theoretical Calculation Molecular polar surface area (PSA) has proven to be a good descriptor of molecular polarity that is associated with passive transport through cellular membranes, including intestinal absorption and blood–brain barrier permeation (Clark, 2011). The TPSAs of ANT antibiotics are similar based on calculations, indicating that they have a similar capability of passive transfer across cell membranes (Table 2). These results suggest that the toxicity of ANTs may not associate with their different rates of passive diffusion across cellular membranes. The ANTs were analyzed comprehensively on their stable conformation by
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo theoretical calculation and showed high similarity in their structures (Fig. 1). All of the ANTs were determined to form three intramolecular hydrogen bonds that are between the 9-side chain hydroxyl group and the 7-side chain oxygen group, the 5-side carbonyl and 6-side hydroxyl group, as well as between 12-side chain carbonyl and 11-side chain hydroxyl group. The stable structure of DAU in solution is concordant with its crystal structure (Neidle and Taylor, 1977). Our zebrafish experimental results demonstrate that the lethality of DOX and DOX-LS were more potent than the other three ANTs, which had the similar toxicity. DOX showed the highest cardiotoxicity among the ANTs, although they had produced a similar cardiotoxic phenotype.
Discussion
Figure 8. Expression variation of genes related to heart development and functions in zebrafish after anthracycline exposure. Embryos were dosed at 6 hpf and collected at 72 hpf for analysis of gene expression by reverse transcription–polymerase chain reaction. The target gene bands were evaluated by semiquantitative density scanning. (A) Representative result of agarose gel electrophoresis. (B–H) Histograms for relative variation of mRNA levels of amhc (B), clmc2 (C), gata5 (D), hand2 (E), has2 (F), nkx2.5 (G) and vmhc (H). Expression is shown as fold change compared with β-actin controls. These values are presented as the mean ± SD. Three or four replicates of 30 embryos each were used for each concentration. *Significant difference between drugs (1, 10 and 20 μM) and their respective control for each treatment stage (*P < 0.05; **P < 0.01; ***P < 0.001). #Significant difference among the same drug treatments for each treatment stage (#P < 0.05; ##P < 0.01; ###P 0.001). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
J. Appl. Toxicol. 2014
In this study, we used zebrafish embryos as a model to evaluate ANTs cardiotoxicity. Toxic effects of ANTs on zebrafish embryonic development were analyzed. These results suggest high toxicity of ANTs on embryonic development, including cardiogenesis, heart formation, survival, hatching and some gene expression alterations. The ANT treatment caused zebrafish pericardia edema followed by cardiac distortion and bradycardia in some different levels among these ANTs (Figs. 4–7). At the tested stage and within the tested concentration range, groups of DAU, EPI and PIRA showed similar rates of abnormality and lethality that were lower than the DOX group, indicating the three drugs have lower toxicity than DOX (Figs. 2–7). It is worth a mention that differential abnormal characteristics between DOX and DOX-LS were exhibited, such as lower embryonic lethality and less incidence of pericardial edema in the DOX-LS group than the DOX group (Fig. 3; Supplementary Table 2), suggesting that DOX-LS reduced cardiac toxicity, which is similar to previous reports (Menna et al., 2012; Smith et al., 2010). However, the total teratogenic ratio in DOX-LS was higher than in DOX (Fig. 3) including delayed hatching. The toxicity difference may have resulted from a change of the DOX-LS distribution in vivo and decrease of its accumulation in heart tissue. A previous report presented that direct perfusion of DaunoXome, a liposomal DAU in isolated hearts of animals resulted in a 12-fold reduction of the accumulation of DAU in heart tissue as compared to the perfusion of free DAU (Pouna et al., 1996). Others reported that the liposomal formulation of ANTs reduced cardiotoxicity and did not affect delivery of ANTs to tumors (Rahman et al., 2007; Working et al., 1999). In zebrafish, a liposomal formulated anticancer compound SANT75 not only improved solubility and bioavailability but also efficiently improved the survival time without obvious systemic toxicity (Yuan et al., 2013). These results demonstrate that ANTs induce similar cardiac defects in zebrafish as in mammals (Robert, 2007). How did the ANTs disturb embryonic heart cardiogenesis and development? To address the issue, some key genes involved in cardiac development were detected and downregulated in the ANT-treated embryos. Zebrafish vmhc and amhc are markers of ventricular myocardium and atrium myocardium, respectively, in cardiogenesis (Yelon et al., 1999) and are important for cardiac morphogenesis (Berdougo et al., 2003). Gene cmlc2 is an essential component of the thick myofilament assembly and contractility of the heart (Rottbauer et al., 2006). CMHC exists as two isoforms in mammals, alpha-CMHC and beta-CMHC. These two isoforms are expressed in different amounts in the mammal heart (Ng et al., 1991). DOX-LS-treated embryos showed developmental delay and the expression of CMHC was
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al.
Figure 9. Expression variation of proteins related to heart development and functions in zebrafish after anthracycline exposure. Embryos were dosed at 6 hpf and collected at 72 hpf for analysis of protein expression by Western blotting. Histograms for relative variation of protein levels of CMHC and HAND2. Expression is shown as fold change compared with β-actin controls. These values are presented as the mean ± SD. Three or four replicates of 30 embryos each were used for each concentration. *Significant difference between drugs (1 and 10 μM) and their respective control for each treatment stage (**P < 0.01). DAU, daunorubicin; DOX, doxorubicin; DOX-LS, doxorubicin-liposome; EPI, epirubicin; hpf, hours post-fertilization; PIRA, pirarubicin.
Table 2. TPSA values of ANT antibiotics ANTs
TPSA
Daunorubicin Doxorubicin Epirubicin Pirarubicin
166.354 188.102 189.679 177.588
ANTs, anthracylenes; TPSA, topological polar surface area.
downregulated. Zebrafish gata5 plays a role in the migration of cardiac progenitors from the anterior lateral plate mesoderm towards the midline of the embryo and regulates the expression of the early myocardial gene nkx2.5 (Peterkin et al., 2007). hand2 is involved in the development of the heart and vasculature, which can promote ventricular cardiomyocyte expansion (Zhao et al., 2005). In zebrafish, hand2 plays pivotal roles in cardiac morphogenesis and cardiac-specific transcription (Yelon, 2001). has2, a major hyaluronan synthase, is expressed during embryogenesis and is responsible for the production of hyaluronic acid, one of the ECM components of cardiac jelly, which is also required for cardiac looping in zebrafish embryos (Smith et al., 2008). nkx2.5 is a key transcription factor expressed first in early cardiac progenitors at late gastrulation and later in the myogenic layer of the heart and is necessary for regulating differentiation, maturation and maintenance of cardiomyocytes throughout life (Sultana et al., 2008). Knockdown of nkx2.5 has been shown to cause a variety of cardiac defects in heart chamber formation, as well as pericardial edema (Targoff et al., 2008), similar to the phenotype observed in our ANT-treated embryos. The downregulation of this gene expression provides a potential mechanism for ANT-induced cardiotoxicity. Thus, these genes and proteins may be used as biomarkers for ANT antibiotics cardiotoxicity in vertebrate embryonic development. The TPSA is a fast and reliable parameter of calculating molecular PSA. It produces nearly equivalent results as the conventionally more sophisticated PSA algorithm (Ertl et al., 2000). In this
wileyonlinelibrary.com/journal/jat
study, the ANTs showed similar TPSAs and the conformations in water solution by theoretical calculation, indicated that they have a similar capability of passive transfer across cell membranes. However, they produced different level of effects on zebrafish embryos. These results suggest that they transfer equally across cell membranes by passive diffusion, and might bind to a cellular receptor with varied binding capacity, leading to the differential toxicity observed. Presently, the cardiotoxicity of ANTs are likely caused by an oxidative stress reaction as follows: a homologue semiquinone free radical can be produced by the ANT anthraquinone structure that is catalyzed by reductases or NADH dehydrogenase. The semiquinone free radical can react with oxygen to form superoxide anion and then the latter reacts with superoxide dismutase to form hydrogen peroxide and oxygen. Moreover, hydrogen peroxide further produces hydroxyl free radical (OH–), which leads to oxidation reactions. The absence of hydrogen peroxidase in myocardial cells is a presumed reason for ANT-induced cardiotoxicity because myocardial cells are easily damaged by free radicals. Further, superoxide anion and hydroxyl free radicals cause peroxidation of lipids, proteins and nucleic acids, leading to cell damage. Moreover, DOX has been found to be specifically accumulated in heart mitochondria and to produce active oxygen species, which impair mitochondria proteins and nucleic acids. Additionally, DOX can react with Fe3+ by the Haber–Weiss reaction to form free radicals that injure DNA. ANT metabolites of their hydroxyl derivatives, such as doxorubicinol and daunorubicinol from their 12-side carbonyl reductive form, exhibit higher toxicity than the parent drugs themselves, indicated another reason for cardiotoxicity (Robert and Gianni, 1993). Moreover, several studies have demonstrated that EPI produced fewer hydroxyl metabolites than DOX, which may explain the lower cardiotoxicity of EPI compared with DOX (Berthiaume and Wallace, 2007). Dosage forms can improve the safety of ANTs. For example, encapsulated ANTs in liposomes reduced myocardial uptake and reduced myocardial damage (Sawyer et al., 2010). These results suggest that the cardiotoxicity might be dependent on the drug concentration within myocardial cells. In summary, zebrafish embryos may be a promising model for evaluating drug-induced cardiotoxicity.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
Anthracycline heart toxic in zebrafish embryo
Funding This study was supported by the National Natural Science Foundation of China (no. 81173043 and 30772681), and National S&T Major Special Project on Major New Drug Innovation (Item Number: 2012ZX09301002-001-021) grants.
Acknowledgments We thank Miss Jie Meng’ endeavor in fish administration, and thank Professor Anming Meng (Tsinghua University, Beijing, China) supplying the zebrafish AB stain seedling.
Conflict of Interest The Authors did not report any conflict of interest.
References Antkiewicz DS, Burns CG, Carney SA, Peterson RE, Heideman W. 2005. Heart malformation is an early response to TCDD in embryonic zebrafish. Toxicol. Sci. 84: 368–377. Bakkers J. 2011. Zebrafish as a model to study cardiac development and human cardiac disease. Cardiovasc. Res. 91: 279–288. Baud FJ, Megarbane B, Deye N, Leprince P. 2007. Clinical review: aggressive management and extracorporeal support for drug-induced cardiotoxicity. Crit. Care 11: 207. Berdougo E, Coleman H, Lee DH, Stainier DY, Yelon D. 2003. Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish. Development 130: 6121–6129. Berthiaume JM, Wallace KB. 2007. Adriamycin-induced oxidative mitochondrial cardiotoxicity. Cell Biol. Toxicol. 23: 15–25. Carney SA, Chen J, Burns CG, Xiong KM, Peterson RE, Heideman W. 2006. Aryl hydrocarbon receptor activation produces heart-specific transcriptional and toxic responses in developing zebrafish. Mol. Pharmacol. 70: 549–561. Chen J, Carney SA, Peterson RE, Heideman W. 2008. Comparative genomics identifies genes mediating cardiotoxicity in the embryonic zebrafish heart. Physiol. Genomics 33: 148–158. Chen YH, Lee HC, Hsu RJ, Chen TY, Huang YK, Lo HC, Hu SC, Harn HJ, Jeng JR, Sun CK, Lin SZ, Tsai HJ. 2012. The toxic effect of Amiodarone on valve formation in the developing heart of zebrafish embryos. Reprod. Toxicol. 33: 233–244. Clark DE. 2011. What has polar surface area ever done for drug discovery? Future Med. Chem. 3: 469–484. Ertl P, Rohde B, Selzer P. 2000. Fast calculation of molecular polar surface area as a sum of fragment-based contributions and its application to the prediction of drug transport properties. J. Med. Chem. 43: 3714–3717. Goerigk L, Grimme S. 2011. A thorough benchmark of density functional methods for general main group thermochemistry, kinetics, and noncovalent interactions. Phys. Chem. Chem. Phys. 13: 6670–6688. Hanwell MD, Curtis DE, Lonie DC, Vandermeersch T, Zurek E, Hutchison GR. 2012. Avogadro: an advanced semantic chemical editor, visualization, and analysis platform. J. Cheminform. 4: 17. Hung MW, Zhang ZJ, Li S, Lei B, Yuan S, Cui GZ, Man Hoi P, Chan K, Lee SM. 2012. From omics to drug metabolism and high content screen of natural product in zebrafish: a new model for discovery of neuroactive compound. Evid. Based Complement. Alternat. Med. 2012: 605303. Incardona JP, Collier TK, Scholz NL. 2004. Defects in cardiac function precede morphological abnormalities in fish embryos exposed to polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 196: 191–205. Kannankeril P, Roden DM, Darbar D. 2010. Drug-induced long QT syndrome. Pharmacol. Rev. 62: 760–781. Killeen MJ. 2009. Drug-induced arrhythmias and sudden cardiac death: implications for the pharmaceutical industry. Drug Discov. Today 14: 589–597.
J. Appl. Toxicol. 2014
Li S, Pozhitkov A, Ryan RA, Manning CS, Brown-Peterson N, Brouwer M. 2010. Constructing a fish metabolic network model. Genome Biol. 11: R115. Mathias JR, Saxena MT, Mumm JS. 2012. Advances in zebrafish chemical screening technologies. Future Med. Chem. 4: 1811–1822. Menna P, Paz OG, Chello M, Covino E, Salvatorelli E, Minotti G. 2012. Anthracycline cardiotoxicity. Expert Opin. Drug Saf. 11(Suppl. 1): S21–36. Morotti M, Valenzano Menada M, Venturini PL, Ferrero S. 2011. Pharmacokinetic and toxicity considerations for the use of anthracyclines in ovarian cancer treatment. Expert Opin. Drug Metab. Toxicol. 7: 707–720. Neese F. 2012. The ORCA program system. Wiley Interdiscip. Rev. Comput. Mol. Sci. 2: 73–78. Neidle S, Taylor G. 1977. Nucleic acid binding drugs. Part IV. The crystal structure of the anti-cancer agent daunomycin. Biochim. Biophys. Acta 479: 450–459. Ng WA, Grupp IL, Subramaniam A, Robbins J. 1991. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ. Res. 68: 1742–1750. Peterkin T, Gibson A, Patient R. 2007. Redundancy and evolution of GATA factor requirements in development of the myocardium. Dev. Biol. 311: 623–635. Peterson RT, Fishman MC. 2011. Designing zebrafish chemical screens. Methods Cell Biol. 105: 525–541. Pouna P, Bonoron-Adele S, Gouverneur G, Tariosse L, Besse P, Robert J. 1996. Development of the model of rat isolated perfused heart for the evaluation of anthracycline cardiotoxicity and its circumvention. Br. J. Pharmacol. 117: 1593–1599. Rahman AM, Yusuf SW, Ewer MS. 2007. Anthracycline-induced cardiotoxicity and the cardiac-sparing effect of liposomal formulation. Int. J. Nanomed. 2: 567–583. Raschi E, Vasina V, Ursino MG, Boriani G, Martoni A, De Ponti F. 2009. Anticancer drugs and cardiotoxicity: Insights and perspectives in the era of targeted therapy. Pharmacol. Ther. 125: 196–218. Robert J. 2007. Preclinical assessment of anthracycline cardiotoxicity in laboratory animals: predictiveness and pitfalls. Cell Biol. Toxicol. 23: 27–37. Robert J, Gianni L. 1993. Pharmacokinetics and metabolism of anthracyclines. Cancer Surv. 17: 219–252. Rottbauer W, Wessels G, Dahme T, Just S, Trano N, Hassel D, Burns CG, Katus HA, Fishman MC. 2006. Cardiac myosin light chain-2: a novel essential component of thick-myofilament assembly and contractility of the heart. Circ. Res. 99: 323–331. Sawyer DB, Peng X, Chen B, Pentassuglia L, Lim CC. 2010. Mechanisms of anthracycline cardiac injury: can we identify strategies for cardioprotection? Prog. Cardiovasc. Dis. 53: 105–113. Schaftenaar G, Noordik JH. 2000. Molden: a pre- and post-processing program for molecular and electronic structures. J. Comput. Aided Mol. Des. 14: 123–134. Scholz S. 2012. The zebrafish has become an attractive model organism in many areas of research ranging from basic developmental biology to applied toxicology. Reprod. Toxicol. 33: 127. Sinnecker S, Rajendran A, Klamt A, Diedenhofen M, Neese F. 2006. Calculation of solvent shifts on electronic g-tensors with the conductor-like screening model (COSMO) and its self-consistent generalization to real solvents (direct COSMO-RS). J. Phys. Chem. A 110: 2235–2245. Smith KA, Chocron S, von der Hardt S, de Pater E, Soufan A, Bussmann J, Schulte-Merker S, Hammerschmidt M, Bakkers J. 2008. Rotation and asymmetric development of the zebrafish heart requires directed migration of cardiac progenitor cells. Dev. Cell 14: 287–297. Smith LA, Cornelius VR, Plummer CJ, Levitt G, Verrill M, Canney P, Jones A. 2010. Cardiotoxicity of anthracycline agents for the treatment of cancer: systematic review and meta-analysis of randomised controlled trials. BMC Cancer 10: 337. Sukardi H, Chng HT, Chan EC, Gong Z, Lam SH. 2011. Zebrafish for drug toxicity screening: bridging the in vitro cell-based models and in vivo mammalian models. Expert Opin. Drug Metab. Toxicol. 7: 579–589. Sultana N, Nag K, Hoshijima K, Laird DW, Kawakami A, Hirose S. 2008. Zebrafish early cardiac connexin, Cx36.7/Ecx, regulates myofibril orientation and heart morphogenesis by establishing Nkx2.5 expression. Proc. Natl. Acad. Sci. U.S.A. 105: 4763–4768. Takaki K, Cosma CL, Troll MA, Ramakrishnan L. 2012. An in vivo platform for rapid high-throughput antitubercular drug discovery. Cell Rep. 2: 175–184.
Copyright © 2014 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Y. Han et al. Targoff KL, Schell T, Yelon D. 2008. Nkx genes regulate heart tube extension and exert differential effects on ventricular and atrial cell number. Dev. Biol. 322: 314–321. Valdivieso M, Kujawa AM, Jones T, Baker LH. 2012. Cancer survivors in the United States: a review of the literature and a call to action. Int. J. Med. Sci. 9: 163–173. van Noord C, Eijgelsheim M, Stricker BH. 2010. Drug- and non-drugassociated QT interval prolongation. Br. J. Clin. Pharmacol. 70: 16–23. Weigend F. 2006. Accurate Coulomb-fitting basis sets for H to Rn. Phys. Chem. Chem. Phys. 8: 1057–1065. Weigend F, Ahlrichs R. 2005. Balanced basis sets of split valence, triple zeta valence and quadruple zeta valence quality for H to Rn: Design and assessment of accuracy. Phys. Chem. Chem. Phys. 7: 3297–3305. Westerfield M. 2007. The Zebrafish Book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press: Eugene. OR; 1 v. (various pagings). Working PK, Newman MS, Sullivan T, Yarrington J. 1999. Reduction of the cardiotoxicity of doxorubicin in rabbits and dogs by encapsulation in long-circulating, pegylated liposomes. J. Pharmacol. Exp. Ther. 289: 1128–1133.
wileyonlinelibrary.com/journal/jat
Yelon D. 2001. Cardiac patterning and morphogenesis in zebrafish. Dev. Dyn. 222: 552–563. Yelon D, Horne SA, Stainier DY. 1999. Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev. Biol. 214: 23–37. Yuan Y, Zhao Y, Xin S, Wu N, Wen J, Li S, Chen L, Wei Y, Yang H, Lin S. 2013. A novel PEGylated liposome-encapsulated SANT75 suppresses tumor growth through inhibiting hedgehog signaling pathway. PLoS One 8: e60266. Zhang J, Qian J, Tong J, Zhang D, Hu C. 2013. Toxic effects of cephalosporins with specific functional groups as indicated by zebrafish embryo toxicity testing. Chem. Res. Toxicol. 26: 1168–1181. Zhao Y, Samal E, Srivastava D. 2005. Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature 436: 214–220.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site.
Copyright © 2014 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2014
