REVIEW URRENT C OPINION
Beckwith–Wiedemann and Russell–Silver Syndromes: from new molecular insights to the comprehension of imprinting regulation Salah Azzi a,b,c, Walid Abi Habib a,b,c, and Irene Netchine a,b,c
Purpose of review The imprinted human 11p15.5 region encompasses two imprinted domains important for the control of fetal growth: the H19/IGF2 domain in the telomeric region and the KCNQ1OT1/CDKN1C domain in the centromeric region. These two domains are differentially methylated and each is regulated by its own imprinting control region (ICR): ICR1 in the telomeric region and ICR2 in the centromeric region. Aberrant methylation of the 11p15.5 imprinted region, through genetic or epigenetic mechanisms, leads to two clinical syndromes, with opposite growth phenotypes: Russell–Silver Syndrome (RSS; with severe fetal and postnatal growth retardation) and Beckwith–Wiedemann Syndrome (BWS; an overgrowth syndrome). Recent findings In this review, we discuss the recently identified molecular abnormalities at 11p15.5 involved in RSS and BWS, which have led to the identification of cis-acting elements and trans-acting regulatory factors involved in the regulation of imprinting in this region. We also discuss the multilocus imprinting disorders identified in various human syndromes, their clinical outcomes and their impact on commonly identified metabolism disorders. Summary These new findings and progress in this field will have direct consequence for diagnostic and predictive tools, risk assessment and genetic counseling for these syndromes. Keywords 11p15-related syndromes, Beckwith–Wiedemann syndrome, imprinting defects related metabolic disorders, multilocus imprinting disorders, Russell–Silver Syndrome
INTRODUCTION Fetal and postnatal growth is a complex, continuous process involving a large number of genetic, epigenetic and environmental factors. Fine-tuning of the regulation of these factors during critical windows of development is crucial for the health of the individual, and changes in these factors can permanently impair growth homeostasis. Fetal programming theory reflects the effects of fetal programming on the subsequent health of the individual. It suggests that an adverse effect during the fetal period may lead to disease later in life [1]. Epigenetic marks are modifications that operate on genomic DNA without altering its primary sequence. Epigenetic mechanisms play a key role in regulating chromatin architecture and/or gene expression. Genomic imprinting is an epigenetic phenomenon by which certain genes are expressed in a parent-of-origin-specific manner. This process www.co-endocrinology.com
involves allele-specific DNA methylation, which typically occurs in a CpG dinucleotide context, with the formation of CpG islands, directing monoallelic gene expression. More than 100 imprinted genes have been identified in humans, and most imprinted genes form clusters, or imprinting
a AP-HP, Hoˆpital Armand Trousseau, Explorations Fonctionnelles Endocriniennes, bUPMC Paris 6, UMR_S938, Centre de Recherche de Saint-Antoine and cINSERM, UMR_S938, Centre de Recherche de Saint-Antoine, Paris, France
Correspondence to Ire`ne Netchine, Explorations Fonctionnelles Endocriniennes, Hoˆpital Armand Trousseau, Pierre & Marie Curie School of Medicine, INSERM UMR-S938, 26 Av du Dr Arnold Netter, 75012, France. Tel.: +33 144736448;. fax: +33 144736621; e-mail: irene. [email protected] Curr Opin Endocrinol Diabetes Obes 2014, 21:30–38 DOI:10.1097/MED.0000000000000037 Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al.
KEY POINTS RSS and BWS are good models for the comprehension of imprinting regulation. The different molecular genetic alterations identified in RSS and BWS teach us how complex is the imprinting regulation. MID could be significantly involved in the broader clinical presentation of imprinting disorders. Although some transacting factors involved in the regulation of imprinting are identified in humans, a huge of others have to be searched. Clinical guidelines for tumor follow-up, growth puberty and metabolism are important to establish.
domains. The monoallelic expression of imprinted genes within these domains is regulated by imprinting control regions (ICRs) [2]. Genomic imprinting undergoes dynamic reprogramming during two critical windows of fetal development: gametogenesis and the preimplantation period. In primordial germ cells, imprinting marks are thoroughly erased and then re-established, as a function of the sex of the individual. Just after fertilization, imprinting marks are maintained, while the genome undergoes a wave of global demethylation (the preimplantation period) and de-novo remethylation (postimplantation period) [3–6]. These waves of epigenetic reprogramming allow germ cells to acquire pluripotency and erase epigenetic abnormalities, thereby preventing the transmission of epimutations to the next generation [3,7]. Imprinted genes play an important role in the growth and development of the embryo, placental function and metabolism. Thus, the aberrant expression of imprinted genes due to epigenetic or genetic abnormalities has frequently been implicated in the pathogenesis of human disorders, such as congenital abnormalities and tumors [8,9].
HUMAN IMPRINTED CHROMOSOME 11p15 AND ASSOCIATED SYNDROMES The human 11p15 chromosome encompasses two imprinted domains important for the control of fetal growth: the H19/IGF2 domain in the telomeric region and the KCNQ1OT1/ CDKN1C domain in the centromeric region. The two domains are differentially methylated and each is regulated by its own ICR: ICR1 in the telomeric region and ICR2 in the centromeric region. ICR1 is methylated on the paternal allele, to which the zinc finger protein CCCTC-binding factor
(CTCF), acting as an insulator, does not bind, thus allowing the shared enhancers downstream of H19 access to the promoters of IGF2 (encoding the main fetal growth factor) and stimulating their activation. The ICR1 on the maternal allele is unmethylated; CTCF can therefore bind to it and prevent the activation of IGF2 promoters by shared enhancers, while allowing activation of the H19 promoter (encoding a noncoding RNA). ICR2 meanwhile is methylated on the maternal allele from which CDKN1C and KCNQ1 are expressed. From the unmethylated paternal allele, KCNQ1OT1 (long noncoding RNA) is expressed and regulates the imprinting in cis of the domain (Fig. 1). The ICR1 domain is arranged into two blocks containing A-repeat and B-repeat elements. Six target sites for CTCF are present within the B-repeat elements and a seventh target site is positioned between the repeat blocks and the H19 transcription start site. In addition to CTCF-binding sites, there are zinc finger protein 57 (ZFP57) binding motifs that coincide with those targeted by CTCF. The ICR1 also contains one conserved Sox2-binding motif and three evolutionarily conserved octamer motif Oct4-binding sites. The second Oct4-binding site contains three octamer motifs (Fig. 2). Loss of imprinting, through loss (LOM) or gain (GOM) of methylation, in these two domains is involved in two, clinically opposite growth disorders: Beckwith–Wiedemann syndrome (BWS) and Russell–Silver Syndrome (RSS) [10].
BECKWITH–WIEDEMANN SYNDROME BWS is an overgrowth disorder involving developmental abnormalities and an increase in the risk of childhood tumors. Its phenotypic expression is variable and diagnosis is based on clinical signs, but there is no consensus clinical definition of the syndrome [11–15]. The major clinical criteria are macroglossia, macrosomia, abdominal wall defects (exomphalos, umbilical hernia) and selective visceromegaly (involving the kidneys, liver or spleen). Less frequent and minor clinical findings include neonatal hypoglycemia and body hemihyperplasia [16]. About 7.5–10% of BWS patients go on to develop a tumor before the age of 5 years. It is now clear that the risk of tumor occurrence differs considerably between the various underlying molecular defects [17–20].
RUSSELL–SILVER SYNDROME RSS is a clinically heterogeneous syndrome involving severe prenatal and postnatal growth retardation. The initial description was of short stature
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
www.co-endocrinology.com
31
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
IGF2
H19
IGF2
H19
EE
KCNQ1
H19 EE
KCNQ1OT1 IGF2 IGF2
H19
IGF2
H19
H19
KCNQ1OT1
Paternal 11p15 unidisomy : 20–25%
Paternal ICR1 duplication EE
KCNQ1 KCNQ1OT1 KCNQ1
IGF2
H19
IGF2
H19
IGF2
H19
CDKN1C
KCNQ1
CDKN1C
KCNQ1
KCNQ1OT1
Paternal 11p15 duplication
Maternal ICR1GOM : 10%
Maternal ICR2 LOM : 60%
«loss of function» mutation in CDKN1C of maternal origin: 5%
BWS molecular defects
H19
CTCF
CDKN1C
CH3
IGF2
KCNQ1
H19
IGF2
KCNQ1
CDKN1C
«Activating» mutation in CDKN1C of maternal origin: 1%
CH3
H19
KCNQ1OT1
H19 EE
H19
CTCF
H19 EE
IGF2
H19
H19 H19 KCNQ1OT1
Maternal ICR2 duplication: 1%
CTCF
IGF2
H19
KCNQ1OT1
Maternal 11p15 duplication : 2–3%
RSS molecular defects
E E
Loss of methylation of the paternal ICR1 : 50%
FIGURE 1. Molecular defects of the 11p15 region involved in Russell–Silver Syndrome (RSS) (lower panel) and Beckwith– Wiedemann Syndrome (BWS) (upper panel). The middle panel shows the normal situation.
without catch-up growth, conserved head circumference for age, a distinctive triangular face with a prominent forehead, low-set ears, clinodactyly of the fifth fingers and skeletal asymmetry. The clinical presentation of RSS is characterized by a spectrum of signs making recognition of this condition fairly easy in extreme cases, but more difficult in less severely affected individuals, particularly in the absence of body asymmetry. Several clinical scoring systems have been proposed to overcome these problems [21–24]. Our group has proposed a scoring system suggesting this diagnosis if patients are born small for gestational age (birth weight and/or length 2 SDS for gestational age) and present at least three of the following five criteria: postnatal growth retardation (at 2 years of age or at the nearest time point to that age for which measurements are available), relative macrocephaly (arbitrarily defined as a head circumference at birth at least 1.5 SDS above the birth weight and/or length SDS), body asymmetry, prominent forehead and feeding difficulties during early childhood and/or postnatal BMI below 2 SDS at 2 years of age or at 32
www.co-endocrinology.com
the nearest time point to that age for which measurements are available. During early childhood, these patients require multidisciplinary follow-up including nutritional support, endocrine care [for growth hormone (GH) therapy and monitoring of bone age and puberty], neurology, speech therapy, orthopedics and orthodontics. Young RSS patients are often undernourished, but they may later gain too much fat mass, resulting in a rapid increase in bone age during adrenarche and puberty. This group of patients born with severe in-utero growth retardation is subsequently exposed to a greater risk of metabolic syndrome than the general population [25,26].
MOLECULAR CLUES TO THE BECKWITH– WIEDEMANN AND RUSSELL–SILVER SYNDROMES Genetic and/or epigenetic abnormalities at chromosome 11p15.5, through copy-number variations, uniparental isodisomy of chromosome 11 (UPD11), the disruption of regulatory sequences, mutation of the active allele or ‘primary’ imprinting defects, such Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al.
†
*
CTCTTTAGCATCTCAAGCTCCTAAATTAGCATCTCAAACCTGCACTGAATGGGAATGTTAATGT
Enhancers
A1
E
B1
H19
B2
B3
A2
B5
B6
B7
S
M
B4
OCT4/SOX2 ZFP57 CTCF
IGF2
ICR1 (41)
(47) (45) (48) (44) (43) (41) (34)
FIGURE 2. Schematic diagram of the IGF2/H19 locus. The 2 kb region downstream from H19 contains the mesodermal enhancer (M), the skeletal muscle and mesodermal enhancers (S) and the endodermal enhancer (E). Localization of the various deletions (plain lines) described in Beckwith–Wiedemann and Russell–Silver Syndrome patients. Gray lines indicate maternal transmission; black lines indicate paternal transmission and bold black line indicate de-novo deletion. Round dot dashed lines refer to RSS, square dashed lines to BWS and solid lines to normal phenotype. Two point mutations affecting the Oct4-binding site within the A2 repeat have been described. y represents the first point mutation of OCT4-binding site published by [42] and represents the second one published by [49].
as a gain or loss of DNA methylation, account for the most cases of BWS and RSS [8]. These abnormalities lead to imprinting defects, which alter the expression of the maternally or paternally expressed genes. More than 50% of RSS patients display a LOM at ICR1 [22,27]. This abnormality leads to the downregulation of IGF2 (encoding a potent fetal growth factor) and the biallelic expression of H19. Conversely, 10% of patients with BWS have a GOM at ICR1, leading to IGF2 overexpression and the downregulation of H19. LOM at ICR2 also accounts for 60% of BWS cases; this abnormality leads to a loss of CDKN1C (a cell cycle inhibitor) expression [28] (Fig. 1). As mentioned above, imprinting abnormalities may result from cytogenetic or genetic defects. Various molecular and chromosomal alterations can lead to BWS, and about 25% of cases are caused by genetic defects. Uniparental disomy of paternal origin (patUPD11, 20% of cases) is segmental and always includes the 11p15 region, but the proximal breakpoints are variable [29,30]. matUPD11 has been reported in only one RSS patient [31], but matUPD7 has been detected in 5–10% of RSS patients [22]. Furthermore, genetic mutations of the maternal allele of CDKN1C account for only 5% of BWS cases overall, but are found in more than
70% of familial cases of BWS. Maternally transmitted activating mutations of CDKN1C have been described in cases of IMAGe syndrome, which has several phenotypes in common with RSS, such as fetal growth retardation and facial dysmorphia [32 ]. In addition, an activating mutation of CDKN1C has also recently been identified in a familial case of RSS [33 ]. Duplications of the whole 11p15 domain (including both ICR1 and ICR2), resulting from unbalanced translocations, cause RSS or BWS, depending on the pattern of parental transmission: the RSS phenotype occurs in cases of maternal transmission and BWS occurs in cases of paternal transmission [34–36]. Furthermore, cis-duplications involving only one ICR are rare and induce discordant phenotypes. Indeed, cis-duplications involving the whole ICR1 IGF2/H19 domain always result in BWS if the paternal chromosome is involved, but have no phenotype if the maternal chromosome is involved [34,35,37,38]. Indeed, the duplicated ICR1 IGF2/H19 domain is reprogrammed in the paternal gametes, with the acquisition of ICR1 methylation. Upon fertilization, the duplicated allele gives rise to two expressed copies of IGF2, mimicking biallelic IGF2 expression, as shown in cases of GOM at ICR1. By contrast, in maternal gametes, the duplicated
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
&
&&
www.co-endocrinology.com
33
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
allele acquires the maternal imprinting status (non-methylation) and, upon fertilization, IGF2 is expressed exclusively from the paternal allele, accounting for the lack of phenotype. cis-Duplications involving the whole ICR2 KCNQ1/CDKN1C domain result in RSS if the maternal chromosome is involved, but in no phenotype if the paternal chromosome is involved [39,40]. Again, this is because of reprogramming of the imprinting status of the duplicated allele in the maternal and paternal gametes. cis-Duplications involving only part of one of the two imprinted domains have recently been described in cases of RSS and BWS. The phenotypic outcomes of these partial cis-duplications are different from those of a complete domain. Indeed, a maternally inherited cis-duplication involving only part of the ICR1 IGF2/H19 domain (ICR1 and the H19 gene) results in an RSS phenotype, whereas there is no phenotypic expression upon paternal transmission [35]. Two copies of H19 are expressed when two cis-duplications occur (whole or partial ICR1 IGF2/H19 domain cis-duplication) and are maternally inherited, but, in the partial cis-duplication, one maternal H19 gene is not engaged in a cis-effect [35]. Similarly, partial cis-duplications involving part of the ICR2 KCNQ1/CDKN1C result in BWS when maternally inherited but give rise to no phenotype when paternally inherited [35,41 ]. These abnormalities provide interesting insight into the normal working of imprinting control mechanisms and their alteration in human imprinting disorders. New insight into the mechanisms regulating the establishment of imprinting in the 11p15 region has emerged from the identification of several microdeletions or point mutations affecting binding sites for trans-acting factors in BWS or RSS patients. Indeed, a number of microdeletions affecting 11p15 ICR1 have been reported to date [42,43 ,44–46] in BWS patients inheriting the deletion from their mothers. These deletions remove a subset of CTCF-binding sites, thus preventing the binding of CTCF to the maternal allele, where it maintains the unmethylated state (Fig. 2) [47,48,49]. The loss of CTCF-binding sites thus impairs CTCF protection and results in gains of methylation on the maternal allele and a BWS phenotype. These data highlight the crucial role of CTCF in regulating imprinting in the ICR1 11p15 region. However, recent studies have shown that CTCF function is modulated by neighboring DNAbinding factors, such as the cohesin and pluripotency factors OCT4/SOX2 [50]. Mutations and small deletions of OCT4-binding and SOX2-binding sites have been described within ICR1 in BWS patients, &&
&&
34
www.co-endocrinology.com
and are associated with a gain of ICR1 methylation [42,43 ,49]. These results suggest that OCT4 and SOX2 protect the maternal allele from methylation during the early stages of fetal development and that mutations/small deletions affecting their binding sites prevent binding, thus leading to hypermethylation (Fig. 2) [51,52 ,47]. Paternal deletions affecting the enhancer region of the IGF2/H19 domain have recently been reported in RSS patients displaying IGF2P0 hypomethylation [48,53 ]. This last finding suggests that there may be cis-elements regulating imprinting apposition specifically at IGF2P0. Overall, these data highlight the complexity of imprinting regulation in the 11p15 region and suggest that other trans-acting factors may also be involved in this process. &&
&&
&&
MULTILOCUS IMPRINTING DISORDERS As the demonstration that imprinting defects can cause human disorders, genomic imprinting and the mechanisms underlying its regulation have become the focus of interest of several research teams. Several imprinted regions have been associated with different human syndromes and cancer [8]. It has been shown that imprinting defects are not restricted to a given locus in a particular syndrome, instead affecting multiple loci, in some patients with imprinting syndrome [10]. This observation defines a new group of imprinting disorders, now known as multilocus imprinting disorder (MID). MID is not restricted to multilocus hypomethylation, and indeed, both hypomethylation and hypermethylation may occur, at many different imprinted loci, in a given patient with RSS [54 ] or pseudohypoparathyroidism type 1b symptoms (PHP-1b) [55 ]. This observation reveals an additional layer of complexity to the issue of imprinting regulation and the occurrence of MID. MID displays mosaicism and involves both maternally and paternally imprinted ICRs, except in transient neonatal diabetes mellitus (TNDM), in which only maternal loci are affected (Table 1) [56 ,57– 65,66 ]. MID is relatively frequent, but very few mutation analyses have been carried out on recently identified trans-acting regulatory factors. ZFP57 mutations (a maternal-effect gene involved in both the establishment and maintenance of imprints) have been identified only in cases of TNDM with MID [56 ,64], and a NLRP2 (encoding a member of the NLRP family of CATERPILLER proteins) mutation has been identified in one case of BWS with MID [61] (Table 1). Several others factors have also been implicated in imprinting establishment/ maintenance in animal models [6]. Attempts have been made to identify mutations of these &
&&
&
&
&
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al. Table 1. Multilocus imprinting defects in human imprinting disorders MID frequencya
Disorder ICR2 LOM BWS
11–33%
ICR1 GOM BWS
Parental loci affected
References
Mutation of trans-regulatory factors
mat and pat
[56 ,57,58–60]
One case with NLRP2 mutation [61]
mat and pat
[56 ,57,62 ,63]
No
mat
[56 ,64,65]
ZFP57 mutations [56 ,64]
mat and pat
[55 ,56 ,66 ]
&
0%
ICR1 LOM SRS
[57,58]
8.7–17%
TNDM
50–75%
PHP1B
9–50%
&
b
&
&
&&
PWS
0%
[56 ]
AS
0%
[56 ]
&
&
&
No
&
&
AS, Angelman syndrome; ICR2 LOM BWS, Beckwith–Wiedemann patients with ICR2 loss of DNA methylation; ICR1 GOM BWS, Beckwith–Wiedemann patients with ICR1 gain of DNA methylation; ICR1 LOM SRS, Silver–Russell patients with ICR1 loss of DNA methylation; mat, maternal; MID, multilocus imprinting disorder; TNDM1: transient neonatal diabetes mellitus type 1; PHPIB: pseudohypoparathyroidism type 1B; pat, paternal; PWS: Prader–Willi syndrome; MHD, multilocus hypomethylation disorder. & a The highest frequency was reported by Court et al. [56 ], who investigated all imprinted loci. b Only maternally methylated DMRs are affected.
trans-acting factors in various MID syndromes, but with no great success to date [56 ,67,66 ]. The factors identified to date do not fully explain the cause of monolocus defects or MID and suggest the involvement of a multitude of other, as yet unidentified factors. &
&
CLINICAL OUTCOMES One of the most challenging aspects of imprinting diseases for both physicians and researchers is their intrinsic and extrinsic clinical heterogeneity and the overlap between the features of different syndromes. Indeed, not only is there a spectrum of clinical signs within a given syndrome, but some syndromes have several clinical features in common. It is usually straightforward to establish a diagnosis in extreme cases, but it can be much more difficult in mildly affected individuals. This clinical complexity makes it difficult to infer a given clinical feature to a given locus, particularly in patients with MID [8,10]. With the exception of one RSS patient [57] and a patient with TNDM [56 ] displaying MID and atypical clinical features, none of the clinical reports in this field have described additional clinical features in MID patients. One recent report showed that BWS patients with MID displayed significant developmental delay and abnormal glycemia control. Additional congenital abnormalities have also been detected in RSS patients with MID [62 ]. However, although these data suggest that MID may modify the clinical signs, which seems likely, the statistical analysis in this study included only a small number of patients and requires confirmation in a larger cohort. &
&
METABOLIC IMPRINTING OF FETAL DEVELOPMENT Over the last few years, a new concept of fetal programming has emerged from various genetic
and epigenetic studies; the concept that diseases of adulthood may have a fetal origin [1]. According to this theory, an adverse event during a critical period of fetal development can activate a series of adaptive mechanisms to ensure survival, but at the expense of an increase in the risk of metabolic diseases in later life if there is a mismatch between the fetal and postnatal environments. Convincing data have been obtained in favor of an association between birth weight and the risk of presenting metabolic syndrome and type 2 diabetes in adulthood [25,68,69]. Disorders associated with suboptimal fetal growth are caused by changes in the development of key endocrine axes, with postnatal consequences for these axes, including the somatotrophic and hypothalamo–pituitary–adrenal axes and the endocrine pancreas [26,70,71]. These mechanisms presumably operate though epigenetic changes to the genome. Considerable support for this hypothesis has been provided by experimental data for rodents and observational studies in humans [1]. Metabolic disorder is one of the principal clinical features observed in many human imprinting disorders. Indeed, TNDM patients present diabetes within the first few months of postnatal life. This condition generally resoles by the age of 3 months, on average, but type 2 diabetes later in life, during adulthood, is more frequent in these patients than in the general population [72], because of a lack of normal insulin secretion. Indeed, it has been shown that Zac1 (a gene involved in TNDM) plays a key role in pancreatic development and insulin secretion [73 ]. Obesity is commonly observed in patients with Prader–Willi syndrome (a syndrome associated with chromosome 15q13.3) [74] and Temple syndrome (associated with mUPD14 or hypomethylation of the 14q32 region) [75]. These two chromosomal regions harbor a cluster of noncoding RNAs, including
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
&
www.co-endocrinology.com
35
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
several from which microRNAs playing different biological roles are synthesized [76]. Changes to the expression of these regions may provide a molecular cause for the metabolic disorders observed in these two syndromes. RSS patients are of clinical interest in terms of metabolic disorders. They tend to be very lean and present nutritional problems during early childhood, but may become obese or develop excess fat mass if overnourished by enteral nutrition. Furthermore, some patients spontaneously develop obesity later in life. In addition, RSS patients are treated with GH to counter their growth retardation, but some patients have elevated serum insulin-like growth factor I (IGF-I; GH effector) concentrations even without GH treatment, and such high concentrations tend to be associated with early adrenarche and puberty. All these metabolic disorders probably result from inappropriate changes in the expression of imprinted genes. Again, it should be noted that these features are also common to several imprinting syndromes, potentially reflecting a tissue-specific MID.
CONCLUSION Abnormalities affecting epigenetic mechanisms, including imprinting in particular, can lead to abnormal gene expression, resulting in various developmental diseases and tumors. BWS and RSS are among the most characteristic pediatric diseases involving imprinting abnormalities, affecting the 11p15 region in both these syndromes. Studies of these human imprinting disorders have led to the identification of key cis-regulatory elements in imprinting centers and various trans-acting regulatory factors. Most of the work on these 11p15-related imprinting disorders has focused on DNA methylation. However, other epigenetic marks and factors, such as histone acetylation and methylation, long noncoding RNAs, small RNAs and miRNAs, together with genetic variation (single nucleotide polymorphisms, copy number variation) involved in chromatin organization, should be explored to determine their involvement in the pathogenesis of 11p15-related imprinting disorders. Furthermore, intensive studies of multilocus imprinting in various human imprinting disorders has led to the identification of the first trans-acting factors involved in the establishment/maintenance of imprinting in humans. However, this work constitutes no more than the top of the iceberg and many other factors and mechanisms remain to be identified. The clinical diagnosis and follow-up of patients is challenging for physicians. Both clinical heterogeneity and the clinical overlap between syndromes 36
www.co-endocrinology.com
make it difficult to develop clinical guidelines and to orient the molecular diagnosis. Metabolic disorder is part of the phenotype of various imprinting disorders, including RSS. This aspect is important for improving patient follow-up, but published data useful for the establishment of clinical guidelines remain scarce and there are data for adult cohorts and the risk of transmission and fertility. Progress in these fields should provide new diagnostic and predictive tools. However, the molecular diagnosis of these epigenetic abnormalities, which display mosaicism, remains challenging. Progress in our understanding of these conditions should also make it possible to improve genetic counseling for families. Acknowledgements None. Conflicts of interest This work was supported by INSERM, UPMC-Paris6 funding, ANR EPIFEGRO 2010, Pfizer grant, Agence de Biome´decine 2010 grant. W.A.H. was supported from the People Programme (Marie Curie Actions) of the European Union’s Seventh Framework Programme FP7/2007-2013/ under REA grant agreement no. 290123. S.A. was supported by Novonordisk and the INSERM-ANR EPIFEGRO 2010. I.N. is a member of the COST Action BM1208.
REFERENCES AND RECOMMENDED READING Papers of particular interest, published within the annual period of review, have been highlighted as: & of special interest && of outstanding interest 1. Gicquel C, El-Osta A, Le Bouc Y. Epigenetic regulation and fetal programming. Best Pract Res 2008; 22:1–16. 2. Abramowitz LK, Bartolomei MS. Genomic imprinting: recognition and marking of imprinted loci. Curr Opin Genet Dev 2012; 22:72–78. 3. Hajkova P, Erhardt S, Lane N, et al. Epigenetic reprogramming in mouse primordial germ cells. Mech Dev 2002; 117:15–23. 4. Oswald J, Engemann S, Lane N, et al. Active demethylation of the paternal genome in the mouse zygote. Curr Biol 2000; 10:475–478. 5. Santos F, Hendrich B, Reik W, Dean W. Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol 2002; 241:172–182. 6. Kelsey G, Feil R. New insights into establishment and maintenance of DNA methylation imprints in mammals. Philos Trans R Soc Lond B Biol Sci 2013; 368:20110336. 7. Seki Y, Hayashi K, Itoh K, et al. Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Dev Biol 2005; 278:440–458. 8. Azzi S, Brioude F, Le Bouc Y, Netchine I. Human imprinting anomalies in Fetal and Childhood Growth Disorders: clinical implications and molecular mechanisms. Curr Pharm Des 2013. [Epub ahead of print] 9. Tomizawa S, Sasaki H. Genomic imprinting and its relevance to congenital disease, infertility, molar pregnancy and induced pluripotent stem cell. J Hum Genet 2012; 57:84–91. 10. Azzi S, Rossignol S, Le Bouc Y, Netchine I. Lessons from imprinted multilocus loss of methylation in human syndromes: a step toward understanding the mechanisms underlying these complex diseases. Epigenetics 2010; 5:373– 377. 11. Wiedemann HR. The EMG-syndrome: exomphalos, macroglossia, gigantism and disturbed carbohydrate metabolism. Z Kinderheilkd 1969; 106:171– 185.
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al. 12. Pettenati MJ, Haines JL, Higgins RR, et al. Wiedemann–Beckwith syndrome: presentation of clinical and cytogenetic data on 22 new cases and review of the literature. Hum Genet 1986; 74:143–154. 13. Elliott M, Bayly R, Cole T, et al. Clinical features and natural history of Beckwith-Wiedemann syndrome: presentation of 74 new cases. Clin Genet 1994; 46:168–174. 14. DeBaun MR, Tucker MA. Risk of cancer during the first four years of life in children from The Beckwith–Wiedemann Syndrome Registry. J Pediatr 1998; 132 (3 Pt 1):398–400. 15. Weksberg R, Nishikawa J, Caluseriu O, et al. Tumor development in the Beckwith–Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 2001; 10:2989–3000. 16. Engstrom W, Lindham S, Schofield P. Wiedemann–Beckwith syndrome. Eur J Pediatr 1988; 147:450–457. 17. Bliek J, Gicquel C, Maas S, et al. Epigenotyping as a tool for the prediction of tumor risk and tumor type in patients with Beckwith–Wiedemann syndrome (BWS). J Pediatr 2004; 145:796–799. 18. Cooper WN, Luharia A, Evans GA, et al. Molecular subtypes and phenotypic expression of Beckwith–Wiedemann syndrome. Eur J Hum Genet 2005; 13:1025–1032. 19. Eggermann T, Algar E, Lapunzina P, et al. Clinical utility gene card for: Beckwith–Wiedemann syndrome. Eur J Hum Genet 2013. [Epub ahead of print] 20. Rump P, Zeegers MP, van Essen AJ. Tumor risk in Beckwith–Wiedemann syndrome: a review and meta-analysis. Am J Med Genet A 2005; 136:95– 104. 21. Abu-Amero S, Wakeling EL, Preece M, et al. Epigenetic signatures of Silver– Russell syndrome. J Med Genet 2010; 47:150–154. 22. Netchine I, Rossignol S, Dufourg MN, et al. 11p15 imprinting center region 1 loss of methylation is a common and specific cause of typical Russell–Silver syndrome: clinical scoring system and epigenetic-phenotypic correlations. J Clin Endocrinol Metab 2007; 92:3148–3154. 23. Price SM, Stanhope R, Garrett C, et al. The spectrum of Silver–Russell syndrome: a clinical and molecular genetic study and new diagnostic criteria. J Med Genet 1999; 36:837–842. 24. Wakeling EL, Amero SA, Alders M, et al. Epigenotype–phenotype correlations in Silver–Russell syndrome. J Med Genet 2010; 47:760–768. 25. Barker DJ. Fetal origins of coronary heart disease. BMJ 1995; 311:171– 174. 26. McMillen IC, Robinson JS. Developmental origins of the metabolic syndrome: prediction, plasticity, and programming. Physiol Rev 2005; 85:571–633. 27. Gicquel C, Rossignol S, Cabrol S, et al. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver–Russell syndrome. Nat Genet 2005; 37:1003–1007. 28. Gaston V, Le Bouc Y, Soupre V, et al. Analysis of the methylation status of the KCNQ1OT and H19 genes in leukocyte DNA for the diagnosis and prognosis of Beckwith–Wiedemann syndrome. Eur J Hum Genet 2001; 9:409–418. 29. Cooper WN, Curley R, Macdonald F, Maher ER. Mitotic recombination and uniparental disomy in Beckwith–Wiedemann syndrome. Genomics 2007; 89:613–617. 30. Romanelli V, Meneses HN, Fernandez L, et al. Beckwith–Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques. Eur J Hum Genet 2011; 19:416–421. 31. Bullman H, Lever M, Robinson DO, et al. Mosaic maternal uniparental disomy of chromosome 11 in a patient with Silver–Russell syndrome. J Med Genet 2008; 45:396–399. 32. Arboleda VA, Lee H, Parnaik R, et al. Mutations in the PCNA-binding domain & of CDKN1C cause IMAGe syndrome. Nature genetics 2012; 44:788– 792. This are the first mutations of CDKN1C identified in IMAGe patients whom share clinical features with RSS patients. 33. Brioude F, Oliver-Petit I, Blaise A, et al. CDKN1C mutation affecting the && PCNA-binding domain as a cause of familial Russell Silver syndrome. J Med Genet 2013; 50:823–830. 11p15 ICR2 domain is involved in RSS through maternal duplication mechanism. This is the first report of CDKN1C missense point mutation in RSS patient without IMAGe phenotype. This constitutes a new molecular cause of RSS and CDKN1C mutations should be searched in some RSS patients without identified molecular abnormality. 34. Bliek J, Snijder S, Maas SM, et al. Phenotypic discordance upon paternal or maternal transmission of duplications of the 11p15 imprinted regions. Eur J Med Genet 2009; 52:404–408. 35. Demars J, Rossignol S, Netchine I, et al. New insights into the pathogenesis of beckwith-wiedemann and silver-russell syndromes: contribution of small copy number variations to 11p15 imprinting defects. Hum Mutat 2011; 32:1171– 1182. 36. Soejima H, Higashimoto K. Epigenetic and genetic alterations of the imprinting disorder Beckwith–Wiedemann syndrome and related disorders. J Hum Genet 2013; 58:402–409. 37. Algar EM, St Heaps L, Darmanian A, et al. Paternally inherited submicroscopic duplication at 11p15.5 implicates insulin-like growth factor II in overgrowth and Wilms’ tumorigenesis. Cancer Res 2007; 67:2360–2365.
38. Russo S, Finelli P, Recalcati MP, et al. Molecular and genomic characterisation of cryptic chromosomal alterations leading to paternal duplication of the 11p15.5 Beckwith–Wiedemann region. J Med Genet 2006; 43:e39. 39. Bonaldi A, Mazzeu JF, Costa SS, et al. Microduplication of the ICR2 domain at chromosome 11p15 and familial Silver–Russell syndrome. Am J Med Genet A 2011; 155A:2479–2483. 40. Schonherr N, Meyer E, Roos A, et al. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 2007; 44:59–63. 41. Chiesa N, De Crescenzo A, Mishra K, et al. The KCNQ1OT1 imprinting && control region and noncoding RNA: new properties derived from the study of Beckwith-Wiedemann syndrome and Silver-Russell syndrome cases. Hum Mol Genet 2012; 21:10–25. This study provides a mechanism through which KCNQ1OT1 likely mediates the silencing of the paternal allele of the 11p15 ICR2. 42. Demars J, Shmela ME, Rossignol S, et al. Analysis of the IGF2/H19 imprinting control region uncovers new genetic defects, including mutations of OCTbinding sequences, in patients with 11p15 fetal growth disorders. Hum Mol Genet 2010; 19:803–814. 43. Beygo J, Citro V, Sparago A, et al. The molecular function and clinical && phenotype of partial deletions of the IGF2/H19 imprinting control region depends on the spatial arrangement of the remaining CTCF-binding sites. Hum Mol Genet 2013; 22:544–557. This study explored the relationship between 11p15 ICR1 microdeletions and phenotype. It demonstrates the crucial role of CTCF binding-sites spacing in the regulation of activity of ICR1. Thus, the extent of ICR1 inactivation and the clinical phenotype are influenced by the arrangement of the residual CTCF binding sites. 44. Prawitt D, Enklaar T, Gartner-Rupprecht B, et al. Microdeletion of target sites for insulator protein CTCF in a chromosome 11p15 imprinting center in Beckwith–Wiedemann syndrome and Wilms’ tumor. Proc Natl Acad Sci U S A 2005; 102:4085–4090. 45. Sparago A, Cerrato F, Vernucci M, et al. Microdeletions in the human H19 DMR result in loss of IGF2 imprinting and Beckwith–Wiedemann syndrome. Nature genetics 2004; 36:958–960. 46. Sparago A, Russo S, Cerrato F, et al. Mechanisms causing imprinting defects in familial Beckwith–Wiedemann syndrome with Wilms’ tumour. Hum Mol Genet 2007; 16:254–264. 47. Sakaguchi R, Okamura E, Matsuzaki H, et al. Sox-Oct motifs contribute to maintenance of the unmethylated H19 ICR in YAC transgenic mice. Hum Mol Genet 2013; 22:4627–4637. 48. Gronskov K, Poole RL, Hahnemann JM, et al. Deletions and rearrangements of the H19/IGF2 enhancer region in patients with Silver–Russell syndrome and growth retardation. J Med Genet 2011; 48:308–311. 49. Poole RL, Leith DJ, Docherty LE, et al. Beckwith–Wiedemann syndrome caused by maternally inherited mutation of an OCT-binding motif in the IGF2/ H19-imprinting control region, ICR1. Eur J Hum Genet 2011; 20:240–243. 50. Weth O, Renkawitz R. CTCF function is modulated by neighboring DNA binding factors. Biochem Cell Biol 2011; 89:459–468. 51. Hori N, Nakano H, Takeuchi T, et al. A dyad oct-binding sequence functions as a maintenance sequence for the unmethylated state within the H19/Igf2imprinted control region. J Biol Chem 2002; 277:27960–27967. 52. Hori N, Yamane M, Kouno K, Sato K. Induction of DNA demethylation && depending on two sets of Sox2 and adjacent Oct3/4 binding sites (SoxOct motifs) within the mouse H19/insulin-like growth factor 2 (Igf2) imprinted control region. J Biol Chem 2012; 287:44006–44016. This study highlighted the crucial role of Sox2/Oct4 factors in the regulation of imprinting at the H19/Igf2 domain. 53. Begemann M, Spengler S, Gogiel M, et al. Clinical significance of copy && number variations in the 11p15.5 imprinting control regions: new cases and review of the literature. J Med Genet 2012; 49:547–553. The authors give an overview on the genotype–phenotype correlation in chromosomal rearrangements in 11p15 as the basis for a directed genetic counseling. 54. Kannenberg K, Urban C, Binder G. Increased incidence of aberrant DNA & methylation within diverse imprinted gene loci outside of IGF2/H19 in SilverRussell syndrome. Clin Genet 2012; 81:366–377. In this report, the authors used genome wide methylation microarray to study the whole genome methylation in RSS patient with 11p15 ICR1 loss of methylation. They showed that methylation abnormalities are not restricted only to imprinted genes. 55. Maupetit-Mehouas S, Azzi S, Steunou V, et al. Simultaneous hyper- and && hypomethylation at imprinted loci in a subset of patients with GNAS epimutations underlies a complex and different mechanism of multilocus methylation defect in pseudohypoparathyroidism type 1b. Human mutation 2013; 34:1172–1180. In this study, the authors provide the first evidence that both loss and gain of methylation at different imprinted genes could occur in the same PHP-1b patient. This new insight highlights the complexity of imprinting regulation. 56. Court F, Martin-Trujillo A, Romanelli V, et al. Genome-wide allelic methylation & analysis reveals disease-specific susceptibility to multiple methylation defects in imprinting syndromes. Hum Mutat 2013; 34:595–602. The authors used a custom Illumina GoldenGate array targeting 27 imprinted DMRs to screen for imprinting anomalies and MID 65 patients affected by various imprinting related syndromes.
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
www.co-endocrinology.com
37
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development 57. Azzi S, Rossignol S, Steunou V, et al. Multilocus methylation analysis in a large cohort of 11p15-related foetal growth disorders (Russell Silver and Beckwith Wiedemann syndromes) reveals simultaneous loss of methylation at paternal and maternal imprinted loci. Hum Mol Genet 2009; 18:4724–4733. 58. Bliek J, Verde G, Callaway J, et al. Hypomethylation at multiple maternally methylated imprinted regions including PLAGL1 and GNAS loci in Beckwith– Wiedemann syndrome. Eur J Hum Genet 2009; 17:611–619. 59. Lim D, Bowdin SC, Tee L, et al. Clinical and molecular genetic features of Beckwith–Wiedemann syndrome associated with assisted reproductive technologies. Hum Reprod 2009; 24:741–747. 60. Rossignol S, Steunou V, Chalas C, et al. The epigenetic imprinting defect of patients with Beckwith-Wiedemann syndrome born after assisted reproductive technology is not restricted to the 11p15 region. J Med Genet 2006; 43:902–907. 61. Meyer E, Lim D, Pasha S, et al. Germline mutation in NLRP2 (NALP2) in a familial imprinting disorder (Beckwith–Wiedemann Syndrome). PLoS Genet 2009; 5:e1000423. 62. Poole RL, Docherty LE, Al Sayegh A, et al. Targeted methylation testing of a & patient cohort broadens the epigenetic and clinical description of imprinting disorders. Am J Med Genet 2013; 161:2174–2182. This study showed that patients affected with MID could have additional clinical features compared with monolocus patients. 63. Turner CL, Mackay DM, Callaway JL, et al. Methylation analysis of 79 patients with growth restriction reveals novel patterns of methylation change at imprinted loci. Eur J Hum Genet 2010; 18:648–655. 64. Mackay DJ, Callaway JL, Marks SM, et al. Hypomethylation of multiple imprinted loci in individuals with transient neonatal diabetes is associated with mutations in ZFP57. Nat Genet 2008; 40:949–951. 65. Mackay DJ, Boonen SE, Clayton-Smith J, et al. A maternal hypomethylation syndrome presenting as transient neonatal diabetes mellitus. Hum Genet 2006; 120:262–269.
38
www.co-endocrinology.com
66. Perez-Nanclares G, Romanelli V, Mayo S, et al. Detection of hypomethylation syndrome among patients with epigenetic alterations at the GNAS locus. J Clin Endocrinol Metabol 2012; 97:E1060–E1067. This is the first report of MID in PHP-1b patients. 67. Begemann M, Spengler S, Kanber D, et al. Silver–Russell patients showing a broad range of ICR1 and ICR2 hypomethylation in different tissues. Clin Genet 2011; 80:83–88. 68. Dyck RF, Klomp H, Tan L. From thrifty genotype’ to ‘hefty fetal phenotype’: the relationship between high birth weight and diabetes in Saskatchewan Registered Indians. Can J Public Health 2001; 92:340–344. 69. Harder T, Rodekamp E, Schellong K, et al. Birth weight and subsequent risk of type 2 diabetes: a meta-analysis. Am J Epidemiol 2007; 165:849–857. 70. Gluckman PD, Hanson MA, Beedle AS. Early life events and their consequences for later disease: a life history and evolutionary perspective. Am J Hum Biol 2007; 19:1–19. 71. Fowden AL, Giussani DA, Forhead AJ. Endocrine and metabolic programming during intrauterine development. Early Hum Dev 2005; 81:723–734. 72. Temple IK, Shield JP. Transient neonatal diabetes, a disorder of imprinting. J Med Genet 2002; 39:872–875. 73. Hoffmann A, Spengler D. Transient neonatal diabetes mellitus gene Zac1 & impairs insulin secretion in mice through Rasgrf1. Mol Cell Biol 2012; 32:2549–2560. ZAC1 is involved in pancreatic development and insulin secretion. This study provides additional molecular mechanism through with Zac1 acts to regulate insulin secretion in b-cell. 74. Emerick JE, Vogt KS. Endocrine manifestations and management of Prader– Willi syndrome. Int J Pediatr Endocrinol 2013; 2013:14. 75. Hoffmann K, Heller R. Uniparental disomies 7 and 14. Best Pract Res 2011; 25:77–100. 76. Royo H, Cavaille J. Noncoding RNAs in imprinted gene clusters. Biol Cell 2008; 100:149–166. &
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Beckwith–Wiedemann and Russell–Silver Syndromes: from new molecular insights to the comprehension of imprinting regulation Salah Azzi a,b,c, Walid Abi Habib a,b,c, and Irene Netchine a,b,c
Purpose of review The imprinted human 11p15.5 region encompasses two imprinted domains important for the control of fetal growth: the H19/IGF2 domain in the telomeric region and the KCNQ1OT1/CDKN1C domain in the centromeric region. These two domains are differentially methylated and each is regulated by its own imprinting control region (ICR): ICR1 in the telomeric region and ICR2 in the centromeric region. Aberrant methylation of the 11p15.5 imprinted region, through genetic or epigenetic mechanisms, leads to two clinical syndromes, with opposite growth phenotypes: Russell–Silver Syndrome (RSS; with severe fetal and postnatal growth retardation) and Beckwith–Wiedemann Syndrome (BWS; an overgrowth syndrome). Recent findings In this review, we discuss the recently identified molecular abnormalities at 11p15.5 involved in RSS and BWS, which have led to the identification of cis-acting elements and trans-acting regulatory factors involved in the regulation of imprinting in this region. We also discuss the multilocus imprinting disorders identified in various human syndromes, their clinical outcomes and their impact on commonly identified metabolism disorders. Summary These new findings and progress in this field will have direct consequence for diagnostic and predictive tools, risk assessment and genetic counseling for these syndromes. Keywords 11p15-related syndromes, Beckwith–Wiedemann syndrome, imprinting defects related metabolic disorders, multilocus imprinting disorders, Russell–Silver Syndrome
INTRODUCTION Fetal and postnatal growth is a complex, continuous process involving a large number of genetic, epigenetic and environmental factors. Fine-tuning of the regulation of these factors during critical windows of development is crucial for the health of the individual, and changes in these factors can permanently impair growth homeostasis. Fetal programming theory reflects the effects of fetal programming on the subsequent health of the individual. It suggests that an adverse effect during the fetal period may lead to disease later in life [1]. Epigenetic marks are modifications that operate on genomic DNA without altering its primary sequence. Epigenetic mechanisms play a key role in regulating chromatin architecture and/or gene expression. Genomic imprinting is an epigenetic phenomenon by which certain genes are expressed in a parent-of-origin-specific manner. This process www.co-endocrinology.com
involves allele-specific DNA methylation, which typically occurs in a CpG dinucleotide context, with the formation of CpG islands, directing monoallelic gene expression. More than 100 imprinted genes have been identified in humans, and most imprinted genes form clusters, or imprinting
a AP-HP, Hoˆpital Armand Trousseau, Explorations Fonctionnelles Endocriniennes, bUPMC Paris 6, UMR_S938, Centre de Recherche de Saint-Antoine and cINSERM, UMR_S938, Centre de Recherche de Saint-Antoine, Paris, France
Correspondence to Ire`ne Netchine, Explorations Fonctionnelles Endocriniennes, Hoˆpital Armand Trousseau, Pierre & Marie Curie School of Medicine, INSERM UMR-S938, 26 Av du Dr Arnold Netter, 75012, France. Tel.: +33 144736448;. fax: +33 144736621; e-mail: irene. [email protected] Curr Opin Endocrinol Diabetes Obes 2014, 21:30–38 DOI:10.1097/MED.0000000000000037 Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al.
KEY POINTS RSS and BWS are good models for the comprehension of imprinting regulation. The different molecular genetic alterations identified in RSS and BWS teach us how complex is the imprinting regulation. MID could be significantly involved in the broader clinical presentation of imprinting disorders. Although some transacting factors involved in the regulation of imprinting are identified in humans, a huge of others have to be searched. Clinical guidelines for tumor follow-up, growth puberty and metabolism are important to establish.
domains. The monoallelic expression of imprinted genes within these domains is regulated by imprinting control regions (ICRs) [2]. Genomic imprinting undergoes dynamic reprogramming during two critical windows of fetal development: gametogenesis and the preimplantation period. In primordial germ cells, imprinting marks are thoroughly erased and then re-established, as a function of the sex of the individual. Just after fertilization, imprinting marks are maintained, while the genome undergoes a wave of global demethylation (the preimplantation period) and de-novo remethylation (postimplantation period) [3–6]. These waves of epigenetic reprogramming allow germ cells to acquire pluripotency and erase epigenetic abnormalities, thereby preventing the transmission of epimutations to the next generation [3,7]. Imprinted genes play an important role in the growth and development of the embryo, placental function and metabolism. Thus, the aberrant expression of imprinted genes due to epigenetic or genetic abnormalities has frequently been implicated in the pathogenesis of human disorders, such as congenital abnormalities and tumors [8,9].
HUMAN IMPRINTED CHROMOSOME 11p15 AND ASSOCIATED SYNDROMES The human 11p15 chromosome encompasses two imprinted domains important for the control of fetal growth: the H19/IGF2 domain in the telomeric region and the KCNQ1OT1/ CDKN1C domain in the centromeric region. The two domains are differentially methylated and each is regulated by its own ICR: ICR1 in the telomeric region and ICR2 in the centromeric region. ICR1 is methylated on the paternal allele, to which the zinc finger protein CCCTC-binding factor
(CTCF), acting as an insulator, does not bind, thus allowing the shared enhancers downstream of H19 access to the promoters of IGF2 (encoding the main fetal growth factor) and stimulating their activation. The ICR1 on the maternal allele is unmethylated; CTCF can therefore bind to it and prevent the activation of IGF2 promoters by shared enhancers, while allowing activation of the H19 promoter (encoding a noncoding RNA). ICR2 meanwhile is methylated on the maternal allele from which CDKN1C and KCNQ1 are expressed. From the unmethylated paternal allele, KCNQ1OT1 (long noncoding RNA) is expressed and regulates the imprinting in cis of the domain (Fig. 1). The ICR1 domain is arranged into two blocks containing A-repeat and B-repeat elements. Six target sites for CTCF are present within the B-repeat elements and a seventh target site is positioned between the repeat blocks and the H19 transcription start site. In addition to CTCF-binding sites, there are zinc finger protein 57 (ZFP57) binding motifs that coincide with those targeted by CTCF. The ICR1 also contains one conserved Sox2-binding motif and three evolutionarily conserved octamer motif Oct4-binding sites. The second Oct4-binding site contains three octamer motifs (Fig. 2). Loss of imprinting, through loss (LOM) or gain (GOM) of methylation, in these two domains is involved in two, clinically opposite growth disorders: Beckwith–Wiedemann syndrome (BWS) and Russell–Silver Syndrome (RSS) [10].
BECKWITH–WIEDEMANN SYNDROME BWS is an overgrowth disorder involving developmental abnormalities and an increase in the risk of childhood tumors. Its phenotypic expression is variable and diagnosis is based on clinical signs, but there is no consensus clinical definition of the syndrome [11–15]. The major clinical criteria are macroglossia, macrosomia, abdominal wall defects (exomphalos, umbilical hernia) and selective visceromegaly (involving the kidneys, liver or spleen). Less frequent and minor clinical findings include neonatal hypoglycemia and body hemihyperplasia [16]. About 7.5–10% of BWS patients go on to develop a tumor before the age of 5 years. It is now clear that the risk of tumor occurrence differs considerably between the various underlying molecular defects [17–20].
RUSSELL–SILVER SYNDROME RSS is a clinically heterogeneous syndrome involving severe prenatal and postnatal growth retardation. The initial description was of short stature
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
www.co-endocrinology.com
31
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
IGF2
H19
IGF2
H19
EE
KCNQ1
H19 EE
KCNQ1OT1 IGF2 IGF2
H19
IGF2
H19
H19
KCNQ1OT1
Paternal 11p15 unidisomy : 20–25%
Paternal ICR1 duplication EE
KCNQ1 KCNQ1OT1 KCNQ1
IGF2
H19
IGF2
H19
IGF2
H19
CDKN1C
KCNQ1
CDKN1C
KCNQ1
KCNQ1OT1
Paternal 11p15 duplication
Maternal ICR1GOM : 10%
Maternal ICR2 LOM : 60%
«loss of function» mutation in CDKN1C of maternal origin: 5%
BWS molecular defects
H19
CTCF
CDKN1C
CH3
IGF2
KCNQ1
H19
IGF2
KCNQ1
CDKN1C
«Activating» mutation in CDKN1C of maternal origin: 1%
CH3
H19
KCNQ1OT1
H19 EE
H19
CTCF
H19 EE
IGF2
H19
H19 H19 KCNQ1OT1
Maternal ICR2 duplication: 1%
CTCF
IGF2
H19
KCNQ1OT1
Maternal 11p15 duplication : 2–3%
RSS molecular defects
E E
Loss of methylation of the paternal ICR1 : 50%
FIGURE 1. Molecular defects of the 11p15 region involved in Russell–Silver Syndrome (RSS) (lower panel) and Beckwith– Wiedemann Syndrome (BWS) (upper panel). The middle panel shows the normal situation.
without catch-up growth, conserved head circumference for age, a distinctive triangular face with a prominent forehead, low-set ears, clinodactyly of the fifth fingers and skeletal asymmetry. The clinical presentation of RSS is characterized by a spectrum of signs making recognition of this condition fairly easy in extreme cases, but more difficult in less severely affected individuals, particularly in the absence of body asymmetry. Several clinical scoring systems have been proposed to overcome these problems [21–24]. Our group has proposed a scoring system suggesting this diagnosis if patients are born small for gestational age (birth weight and/or length 2 SDS for gestational age) and present at least three of the following five criteria: postnatal growth retardation (at 2 years of age or at the nearest time point to that age for which measurements are available), relative macrocephaly (arbitrarily defined as a head circumference at birth at least 1.5 SDS above the birth weight and/or length SDS), body asymmetry, prominent forehead and feeding difficulties during early childhood and/or postnatal BMI below 2 SDS at 2 years of age or at 32
www.co-endocrinology.com
the nearest time point to that age for which measurements are available. During early childhood, these patients require multidisciplinary follow-up including nutritional support, endocrine care [for growth hormone (GH) therapy and monitoring of bone age and puberty], neurology, speech therapy, orthopedics and orthodontics. Young RSS patients are often undernourished, but they may later gain too much fat mass, resulting in a rapid increase in bone age during adrenarche and puberty. This group of patients born with severe in-utero growth retardation is subsequently exposed to a greater risk of metabolic syndrome than the general population [25,26].
MOLECULAR CLUES TO THE BECKWITH– WIEDEMANN AND RUSSELL–SILVER SYNDROMES Genetic and/or epigenetic abnormalities at chromosome 11p15.5, through copy-number variations, uniparental isodisomy of chromosome 11 (UPD11), the disruption of regulatory sequences, mutation of the active allele or ‘primary’ imprinting defects, such Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al.
†
*
CTCTTTAGCATCTCAAGCTCCTAAATTAGCATCTCAAACCTGCACTGAATGGGAATGTTAATGT
Enhancers
A1
E
B1
H19
B2
B3
A2
B5
B6
B7
S
M
B4
OCT4/SOX2 ZFP57 CTCF
IGF2
ICR1 (41)
(47) (45) (48) (44) (43) (41) (34)
FIGURE 2. Schematic diagram of the IGF2/H19 locus. The 2 kb region downstream from H19 contains the mesodermal enhancer (M), the skeletal muscle and mesodermal enhancers (S) and the endodermal enhancer (E). Localization of the various deletions (plain lines) described in Beckwith–Wiedemann and Russell–Silver Syndrome patients. Gray lines indicate maternal transmission; black lines indicate paternal transmission and bold black line indicate de-novo deletion. Round dot dashed lines refer to RSS, square dashed lines to BWS and solid lines to normal phenotype. Two point mutations affecting the Oct4-binding site within the A2 repeat have been described. y represents the first point mutation of OCT4-binding site published by [42] and represents the second one published by [49].
as a gain or loss of DNA methylation, account for the most cases of BWS and RSS [8]. These abnormalities lead to imprinting defects, which alter the expression of the maternally or paternally expressed genes. More than 50% of RSS patients display a LOM at ICR1 [22,27]. This abnormality leads to the downregulation of IGF2 (encoding a potent fetal growth factor) and the biallelic expression of H19. Conversely, 10% of patients with BWS have a GOM at ICR1, leading to IGF2 overexpression and the downregulation of H19. LOM at ICR2 also accounts for 60% of BWS cases; this abnormality leads to a loss of CDKN1C (a cell cycle inhibitor) expression [28] (Fig. 1). As mentioned above, imprinting abnormalities may result from cytogenetic or genetic defects. Various molecular and chromosomal alterations can lead to BWS, and about 25% of cases are caused by genetic defects. Uniparental disomy of paternal origin (patUPD11, 20% of cases) is segmental and always includes the 11p15 region, but the proximal breakpoints are variable [29,30]. matUPD11 has been reported in only one RSS patient [31], but matUPD7 has been detected in 5–10% of RSS patients [22]. Furthermore, genetic mutations of the maternal allele of CDKN1C account for only 5% of BWS cases overall, but are found in more than
70% of familial cases of BWS. Maternally transmitted activating mutations of CDKN1C have been described in cases of IMAGe syndrome, which has several phenotypes in common with RSS, such as fetal growth retardation and facial dysmorphia [32 ]. In addition, an activating mutation of CDKN1C has also recently been identified in a familial case of RSS [33 ]. Duplications of the whole 11p15 domain (including both ICR1 and ICR2), resulting from unbalanced translocations, cause RSS or BWS, depending on the pattern of parental transmission: the RSS phenotype occurs in cases of maternal transmission and BWS occurs in cases of paternal transmission [34–36]. Furthermore, cis-duplications involving only one ICR are rare and induce discordant phenotypes. Indeed, cis-duplications involving the whole ICR1 IGF2/H19 domain always result in BWS if the paternal chromosome is involved, but have no phenotype if the maternal chromosome is involved [34,35,37,38]. Indeed, the duplicated ICR1 IGF2/H19 domain is reprogrammed in the paternal gametes, with the acquisition of ICR1 methylation. Upon fertilization, the duplicated allele gives rise to two expressed copies of IGF2, mimicking biallelic IGF2 expression, as shown in cases of GOM at ICR1. By contrast, in maternal gametes, the duplicated
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
&
&&
www.co-endocrinology.com
33
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
allele acquires the maternal imprinting status (non-methylation) and, upon fertilization, IGF2 is expressed exclusively from the paternal allele, accounting for the lack of phenotype. cis-Duplications involving the whole ICR2 KCNQ1/CDKN1C domain result in RSS if the maternal chromosome is involved, but in no phenotype if the paternal chromosome is involved [39,40]. Again, this is because of reprogramming of the imprinting status of the duplicated allele in the maternal and paternal gametes. cis-Duplications involving only part of one of the two imprinted domains have recently been described in cases of RSS and BWS. The phenotypic outcomes of these partial cis-duplications are different from those of a complete domain. Indeed, a maternally inherited cis-duplication involving only part of the ICR1 IGF2/H19 domain (ICR1 and the H19 gene) results in an RSS phenotype, whereas there is no phenotypic expression upon paternal transmission [35]. Two copies of H19 are expressed when two cis-duplications occur (whole or partial ICR1 IGF2/H19 domain cis-duplication) and are maternally inherited, but, in the partial cis-duplication, one maternal H19 gene is not engaged in a cis-effect [35]. Similarly, partial cis-duplications involving part of the ICR2 KCNQ1/CDKN1C result in BWS when maternally inherited but give rise to no phenotype when paternally inherited [35,41 ]. These abnormalities provide interesting insight into the normal working of imprinting control mechanisms and their alteration in human imprinting disorders. New insight into the mechanisms regulating the establishment of imprinting in the 11p15 region has emerged from the identification of several microdeletions or point mutations affecting binding sites for trans-acting factors in BWS or RSS patients. Indeed, a number of microdeletions affecting 11p15 ICR1 have been reported to date [42,43 ,44–46] in BWS patients inheriting the deletion from their mothers. These deletions remove a subset of CTCF-binding sites, thus preventing the binding of CTCF to the maternal allele, where it maintains the unmethylated state (Fig. 2) [47,48,49]. The loss of CTCF-binding sites thus impairs CTCF protection and results in gains of methylation on the maternal allele and a BWS phenotype. These data highlight the crucial role of CTCF in regulating imprinting in the ICR1 11p15 region. However, recent studies have shown that CTCF function is modulated by neighboring DNAbinding factors, such as the cohesin and pluripotency factors OCT4/SOX2 [50]. Mutations and small deletions of OCT4-binding and SOX2-binding sites have been described within ICR1 in BWS patients, &&
&&
34
www.co-endocrinology.com
and are associated with a gain of ICR1 methylation [42,43 ,49]. These results suggest that OCT4 and SOX2 protect the maternal allele from methylation during the early stages of fetal development and that mutations/small deletions affecting their binding sites prevent binding, thus leading to hypermethylation (Fig. 2) [51,52 ,47]. Paternal deletions affecting the enhancer region of the IGF2/H19 domain have recently been reported in RSS patients displaying IGF2P0 hypomethylation [48,53 ]. This last finding suggests that there may be cis-elements regulating imprinting apposition specifically at IGF2P0. Overall, these data highlight the complexity of imprinting regulation in the 11p15 region and suggest that other trans-acting factors may also be involved in this process. &&
&&
&&
MULTILOCUS IMPRINTING DISORDERS As the demonstration that imprinting defects can cause human disorders, genomic imprinting and the mechanisms underlying its regulation have become the focus of interest of several research teams. Several imprinted regions have been associated with different human syndromes and cancer [8]. It has been shown that imprinting defects are not restricted to a given locus in a particular syndrome, instead affecting multiple loci, in some patients with imprinting syndrome [10]. This observation defines a new group of imprinting disorders, now known as multilocus imprinting disorder (MID). MID is not restricted to multilocus hypomethylation, and indeed, both hypomethylation and hypermethylation may occur, at many different imprinted loci, in a given patient with RSS [54 ] or pseudohypoparathyroidism type 1b symptoms (PHP-1b) [55 ]. This observation reveals an additional layer of complexity to the issue of imprinting regulation and the occurrence of MID. MID displays mosaicism and involves both maternally and paternally imprinted ICRs, except in transient neonatal diabetes mellitus (TNDM), in which only maternal loci are affected (Table 1) [56 ,57– 65,66 ]. MID is relatively frequent, but very few mutation analyses have been carried out on recently identified trans-acting regulatory factors. ZFP57 mutations (a maternal-effect gene involved in both the establishment and maintenance of imprints) have been identified only in cases of TNDM with MID [56 ,64], and a NLRP2 (encoding a member of the NLRP family of CATERPILLER proteins) mutation has been identified in one case of BWS with MID [61] (Table 1). Several others factors have also been implicated in imprinting establishment/ maintenance in animal models [6]. Attempts have been made to identify mutations of these &
&&
&
&
&
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al. Table 1. Multilocus imprinting defects in human imprinting disorders MID frequencya
Disorder ICR2 LOM BWS
11–33%
ICR1 GOM BWS
Parental loci affected
References
Mutation of trans-regulatory factors
mat and pat
[56 ,57,58–60]
One case with NLRP2 mutation [61]
mat and pat
[56 ,57,62 ,63]
No
mat
[56 ,64,65]
ZFP57 mutations [56 ,64]
mat and pat
[55 ,56 ,66 ]
&
0%
ICR1 LOM SRS
[57,58]
8.7–17%
TNDM
50–75%
PHP1B
9–50%
&
b
&
&
&&
PWS
0%
[56 ]
AS
0%
[56 ]
&
&
&
No
&
&
AS, Angelman syndrome; ICR2 LOM BWS, Beckwith–Wiedemann patients with ICR2 loss of DNA methylation; ICR1 GOM BWS, Beckwith–Wiedemann patients with ICR1 gain of DNA methylation; ICR1 LOM SRS, Silver–Russell patients with ICR1 loss of DNA methylation; mat, maternal; MID, multilocus imprinting disorder; TNDM1: transient neonatal diabetes mellitus type 1; PHPIB: pseudohypoparathyroidism type 1B; pat, paternal; PWS: Prader–Willi syndrome; MHD, multilocus hypomethylation disorder. & a The highest frequency was reported by Court et al. [56 ], who investigated all imprinted loci. b Only maternally methylated DMRs are affected.
trans-acting factors in various MID syndromes, but with no great success to date [56 ,67,66 ]. The factors identified to date do not fully explain the cause of monolocus defects or MID and suggest the involvement of a multitude of other, as yet unidentified factors. &
&
CLINICAL OUTCOMES One of the most challenging aspects of imprinting diseases for both physicians and researchers is their intrinsic and extrinsic clinical heterogeneity and the overlap between the features of different syndromes. Indeed, not only is there a spectrum of clinical signs within a given syndrome, but some syndromes have several clinical features in common. It is usually straightforward to establish a diagnosis in extreme cases, but it can be much more difficult in mildly affected individuals. This clinical complexity makes it difficult to infer a given clinical feature to a given locus, particularly in patients with MID [8,10]. With the exception of one RSS patient [57] and a patient with TNDM [56 ] displaying MID and atypical clinical features, none of the clinical reports in this field have described additional clinical features in MID patients. One recent report showed that BWS patients with MID displayed significant developmental delay and abnormal glycemia control. Additional congenital abnormalities have also been detected in RSS patients with MID [62 ]. However, although these data suggest that MID may modify the clinical signs, which seems likely, the statistical analysis in this study included only a small number of patients and requires confirmation in a larger cohort. &
&
METABOLIC IMPRINTING OF FETAL DEVELOPMENT Over the last few years, a new concept of fetal programming has emerged from various genetic
and epigenetic studies; the concept that diseases of adulthood may have a fetal origin [1]. According to this theory, an adverse event during a critical period of fetal development can activate a series of adaptive mechanisms to ensure survival, but at the expense of an increase in the risk of metabolic diseases in later life if there is a mismatch between the fetal and postnatal environments. Convincing data have been obtained in favor of an association between birth weight and the risk of presenting metabolic syndrome and type 2 diabetes in adulthood [25,68,69]. Disorders associated with suboptimal fetal growth are caused by changes in the development of key endocrine axes, with postnatal consequences for these axes, including the somatotrophic and hypothalamo–pituitary–adrenal axes and the endocrine pancreas [26,70,71]. These mechanisms presumably operate though epigenetic changes to the genome. Considerable support for this hypothesis has been provided by experimental data for rodents and observational studies in humans [1]. Metabolic disorder is one of the principal clinical features observed in many human imprinting disorders. Indeed, TNDM patients present diabetes within the first few months of postnatal life. This condition generally resoles by the age of 3 months, on average, but type 2 diabetes later in life, during adulthood, is more frequent in these patients than in the general population [72], because of a lack of normal insulin secretion. Indeed, it has been shown that Zac1 (a gene involved in TNDM) plays a key role in pancreatic development and insulin secretion [73 ]. Obesity is commonly observed in patients with Prader–Willi syndrome (a syndrome associated with chromosome 15q13.3) [74] and Temple syndrome (associated with mUPD14 or hypomethylation of the 14q32 region) [75]. These two chromosomal regions harbor a cluster of noncoding RNAs, including
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
&
www.co-endocrinology.com
35
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development
several from which microRNAs playing different biological roles are synthesized [76]. Changes to the expression of these regions may provide a molecular cause for the metabolic disorders observed in these two syndromes. RSS patients are of clinical interest in terms of metabolic disorders. They tend to be very lean and present nutritional problems during early childhood, but may become obese or develop excess fat mass if overnourished by enteral nutrition. Furthermore, some patients spontaneously develop obesity later in life. In addition, RSS patients are treated with GH to counter their growth retardation, but some patients have elevated serum insulin-like growth factor I (IGF-I; GH effector) concentrations even without GH treatment, and such high concentrations tend to be associated with early adrenarche and puberty. All these metabolic disorders probably result from inappropriate changes in the expression of imprinted genes. Again, it should be noted that these features are also common to several imprinting syndromes, potentially reflecting a tissue-specific MID.
CONCLUSION Abnormalities affecting epigenetic mechanisms, including imprinting in particular, can lead to abnormal gene expression, resulting in various developmental diseases and tumors. BWS and RSS are among the most characteristic pediatric diseases involving imprinting abnormalities, affecting the 11p15 region in both these syndromes. Studies of these human imprinting disorders have led to the identification of key cis-regulatory elements in imprinting centers and various trans-acting regulatory factors. Most of the work on these 11p15-related imprinting disorders has focused on DNA methylation. However, other epigenetic marks and factors, such as histone acetylation and methylation, long noncoding RNAs, small RNAs and miRNAs, together with genetic variation (single nucleotide polymorphisms, copy number variation) involved in chromatin organization, should be explored to determine their involvement in the pathogenesis of 11p15-related imprinting disorders. Furthermore, intensive studies of multilocus imprinting in various human imprinting disorders has led to the identification of the first trans-acting factors involved in the establishment/maintenance of imprinting in humans. However, this work constitutes no more than the top of the iceberg and many other factors and mechanisms remain to be identified. The clinical diagnosis and follow-up of patients is challenging for physicians. Both clinical heterogeneity and the clinical overlap between syndromes 36
www.co-endocrinology.com
make it difficult to develop clinical guidelines and to orient the molecular diagnosis. Metabolic disorder is part of the phenotype of various imprinting disorders, including RSS. This aspect is important for improving patient follow-up, but published data useful for the establishment of clinical guidelines remain scarce and there are data for adult cohorts and the risk of transmission and fertility. Progress in these fields should provide new diagnostic and predictive tools. However, the molecular diagnosis of these epigenetic abnormalities, which display mosaicism, remains challenging. Progress in our understanding of these conditions should also make it possible to improve genetic counseling for families. Acknowledgements None. Conflicts of interest This work was supported by INSERM, UPMC-Paris6 funding, ANR EPIFEGRO 2010, Pfizer grant, Agence de Biome´decine 2010 grant. W.A.H. was supported from the People Programme (Marie Curie Actions) of the European Union’s Seventh Framework Programme FP7/2007-2013/ under REA grant agreement no. 290123. S.A. was supported by Novonordisk and the INSERM-ANR EPIFEGRO 2010. I.N. is a member of the COST Action BM1208.
REFERENCES AND RECOMMENDED READING Papers of particular interest, published within the annual period of review, have been highlighted as: & of special interest && of outstanding interest 1. Gicquel C, El-Osta A, Le Bouc Y. Epigenetic regulation and fetal programming. Best Pract Res 2008; 22:1–16. 2. Abramowitz LK, Bartolomei MS. Genomic imprinting: recognition and marking of imprinted loci. Curr Opin Genet Dev 2012; 22:72–78. 3. Hajkova P, Erhardt S, Lane N, et al. Epigenetic reprogramming in mouse primordial germ cells. Mech Dev 2002; 117:15–23. 4. Oswald J, Engemann S, Lane N, et al. Active demethylation of the paternal genome in the mouse zygote. Curr Biol 2000; 10:475–478. 5. Santos F, Hendrich B, Reik W, Dean W. Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol 2002; 241:172–182. 6. Kelsey G, Feil R. New insights into establishment and maintenance of DNA methylation imprints in mammals. Philos Trans R Soc Lond B Biol Sci 2013; 368:20110336. 7. Seki Y, Hayashi K, Itoh K, et al. Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Dev Biol 2005; 278:440–458. 8. Azzi S, Brioude F, Le Bouc Y, Netchine I. Human imprinting anomalies in Fetal and Childhood Growth Disorders: clinical implications and molecular mechanisms. Curr Pharm Des 2013. [Epub ahead of print] 9. Tomizawa S, Sasaki H. Genomic imprinting and its relevance to congenital disease, infertility, molar pregnancy and induced pluripotent stem cell. J Hum Genet 2012; 57:84–91. 10. Azzi S, Rossignol S, Le Bouc Y, Netchine I. Lessons from imprinted multilocus loss of methylation in human syndromes: a step toward understanding the mechanisms underlying these complex diseases. Epigenetics 2010; 5:373– 377. 11. Wiedemann HR. The EMG-syndrome: exomphalos, macroglossia, gigantism and disturbed carbohydrate metabolism. Z Kinderheilkd 1969; 106:171– 185.
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
11p15 region and its growth disorder related syndromes Azzi et al. 12. Pettenati MJ, Haines JL, Higgins RR, et al. Wiedemann–Beckwith syndrome: presentation of clinical and cytogenetic data on 22 new cases and review of the literature. Hum Genet 1986; 74:143–154. 13. Elliott M, Bayly R, Cole T, et al. Clinical features and natural history of Beckwith-Wiedemann syndrome: presentation of 74 new cases. Clin Genet 1994; 46:168–174. 14. DeBaun MR, Tucker MA. Risk of cancer during the first four years of life in children from The Beckwith–Wiedemann Syndrome Registry. J Pediatr 1998; 132 (3 Pt 1):398–400. 15. Weksberg R, Nishikawa J, Caluseriu O, et al. Tumor development in the Beckwith–Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 2001; 10:2989–3000. 16. Engstrom W, Lindham S, Schofield P. Wiedemann–Beckwith syndrome. Eur J Pediatr 1988; 147:450–457. 17. Bliek J, Gicquel C, Maas S, et al. Epigenotyping as a tool for the prediction of tumor risk and tumor type in patients with Beckwith–Wiedemann syndrome (BWS). J Pediatr 2004; 145:796–799. 18. Cooper WN, Luharia A, Evans GA, et al. Molecular subtypes and phenotypic expression of Beckwith–Wiedemann syndrome. Eur J Hum Genet 2005; 13:1025–1032. 19. Eggermann T, Algar E, Lapunzina P, et al. Clinical utility gene card for: Beckwith–Wiedemann syndrome. Eur J Hum Genet 2013. [Epub ahead of print] 20. Rump P, Zeegers MP, van Essen AJ. Tumor risk in Beckwith–Wiedemann syndrome: a review and meta-analysis. Am J Med Genet A 2005; 136:95– 104. 21. Abu-Amero S, Wakeling EL, Preece M, et al. Epigenetic signatures of Silver– Russell syndrome. J Med Genet 2010; 47:150–154. 22. Netchine I, Rossignol S, Dufourg MN, et al. 11p15 imprinting center region 1 loss of methylation is a common and specific cause of typical Russell–Silver syndrome: clinical scoring system and epigenetic-phenotypic correlations. J Clin Endocrinol Metab 2007; 92:3148–3154. 23. Price SM, Stanhope R, Garrett C, et al. The spectrum of Silver–Russell syndrome: a clinical and molecular genetic study and new diagnostic criteria. J Med Genet 1999; 36:837–842. 24. Wakeling EL, Amero SA, Alders M, et al. Epigenotype–phenotype correlations in Silver–Russell syndrome. J Med Genet 2010; 47:760–768. 25. Barker DJ. Fetal origins of coronary heart disease. BMJ 1995; 311:171– 174. 26. McMillen IC, Robinson JS. Developmental origins of the metabolic syndrome: prediction, plasticity, and programming. Physiol Rev 2005; 85:571–633. 27. Gicquel C, Rossignol S, Cabrol S, et al. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver–Russell syndrome. Nat Genet 2005; 37:1003–1007. 28. Gaston V, Le Bouc Y, Soupre V, et al. Analysis of the methylation status of the KCNQ1OT and H19 genes in leukocyte DNA for the diagnosis and prognosis of Beckwith–Wiedemann syndrome. Eur J Hum Genet 2001; 9:409–418. 29. Cooper WN, Curley R, Macdonald F, Maher ER. Mitotic recombination and uniparental disomy in Beckwith–Wiedemann syndrome. Genomics 2007; 89:613–617. 30. Romanelli V, Meneses HN, Fernandez L, et al. Beckwith–Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques. Eur J Hum Genet 2011; 19:416–421. 31. Bullman H, Lever M, Robinson DO, et al. Mosaic maternal uniparental disomy of chromosome 11 in a patient with Silver–Russell syndrome. J Med Genet 2008; 45:396–399. 32. Arboleda VA, Lee H, Parnaik R, et al. Mutations in the PCNA-binding domain & of CDKN1C cause IMAGe syndrome. Nature genetics 2012; 44:788– 792. This are the first mutations of CDKN1C identified in IMAGe patients whom share clinical features with RSS patients. 33. Brioude F, Oliver-Petit I, Blaise A, et al. CDKN1C mutation affecting the && PCNA-binding domain as a cause of familial Russell Silver syndrome. J Med Genet 2013; 50:823–830. 11p15 ICR2 domain is involved in RSS through maternal duplication mechanism. This is the first report of CDKN1C missense point mutation in RSS patient without IMAGe phenotype. This constitutes a new molecular cause of RSS and CDKN1C mutations should be searched in some RSS patients without identified molecular abnormality. 34. Bliek J, Snijder S, Maas SM, et al. Phenotypic discordance upon paternal or maternal transmission of duplications of the 11p15 imprinted regions. Eur J Med Genet 2009; 52:404–408. 35. Demars J, Rossignol S, Netchine I, et al. New insights into the pathogenesis of beckwith-wiedemann and silver-russell syndromes: contribution of small copy number variations to 11p15 imprinting defects. Hum Mutat 2011; 32:1171– 1182. 36. Soejima H, Higashimoto K. Epigenetic and genetic alterations of the imprinting disorder Beckwith–Wiedemann syndrome and related disorders. J Hum Genet 2013; 58:402–409. 37. Algar EM, St Heaps L, Darmanian A, et al. Paternally inherited submicroscopic duplication at 11p15.5 implicates insulin-like growth factor II in overgrowth and Wilms’ tumorigenesis. Cancer Res 2007; 67:2360–2365.
38. Russo S, Finelli P, Recalcati MP, et al. Molecular and genomic characterisation of cryptic chromosomal alterations leading to paternal duplication of the 11p15.5 Beckwith–Wiedemann region. J Med Genet 2006; 43:e39. 39. Bonaldi A, Mazzeu JF, Costa SS, et al. Microduplication of the ICR2 domain at chromosome 11p15 and familial Silver–Russell syndrome. Am J Med Genet A 2011; 155A:2479–2483. 40. Schonherr N, Meyer E, Roos A, et al. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 2007; 44:59–63. 41. Chiesa N, De Crescenzo A, Mishra K, et al. The KCNQ1OT1 imprinting && control region and noncoding RNA: new properties derived from the study of Beckwith-Wiedemann syndrome and Silver-Russell syndrome cases. Hum Mol Genet 2012; 21:10–25. This study provides a mechanism through which KCNQ1OT1 likely mediates the silencing of the paternal allele of the 11p15 ICR2. 42. Demars J, Shmela ME, Rossignol S, et al. Analysis of the IGF2/H19 imprinting control region uncovers new genetic defects, including mutations of OCTbinding sequences, in patients with 11p15 fetal growth disorders. Hum Mol Genet 2010; 19:803–814. 43. Beygo J, Citro V, Sparago A, et al. The molecular function and clinical && phenotype of partial deletions of the IGF2/H19 imprinting control region depends on the spatial arrangement of the remaining CTCF-binding sites. Hum Mol Genet 2013; 22:544–557. This study explored the relationship between 11p15 ICR1 microdeletions and phenotype. It demonstrates the crucial role of CTCF binding-sites spacing in the regulation of activity of ICR1. Thus, the extent of ICR1 inactivation and the clinical phenotype are influenced by the arrangement of the residual CTCF binding sites. 44. Prawitt D, Enklaar T, Gartner-Rupprecht B, et al. Microdeletion of target sites for insulator protein CTCF in a chromosome 11p15 imprinting center in Beckwith–Wiedemann syndrome and Wilms’ tumor. Proc Natl Acad Sci U S A 2005; 102:4085–4090. 45. Sparago A, Cerrato F, Vernucci M, et al. Microdeletions in the human H19 DMR result in loss of IGF2 imprinting and Beckwith–Wiedemann syndrome. Nature genetics 2004; 36:958–960. 46. Sparago A, Russo S, Cerrato F, et al. Mechanisms causing imprinting defects in familial Beckwith–Wiedemann syndrome with Wilms’ tumour. Hum Mol Genet 2007; 16:254–264. 47. Sakaguchi R, Okamura E, Matsuzaki H, et al. Sox-Oct motifs contribute to maintenance of the unmethylated H19 ICR in YAC transgenic mice. Hum Mol Genet 2013; 22:4627–4637. 48. Gronskov K, Poole RL, Hahnemann JM, et al. Deletions and rearrangements of the H19/IGF2 enhancer region in patients with Silver–Russell syndrome and growth retardation. J Med Genet 2011; 48:308–311. 49. Poole RL, Leith DJ, Docherty LE, et al. Beckwith–Wiedemann syndrome caused by maternally inherited mutation of an OCT-binding motif in the IGF2/ H19-imprinting control region, ICR1. Eur J Hum Genet 2011; 20:240–243. 50. Weth O, Renkawitz R. CTCF function is modulated by neighboring DNA binding factors. Biochem Cell Biol 2011; 89:459–468. 51. Hori N, Nakano H, Takeuchi T, et al. A dyad oct-binding sequence functions as a maintenance sequence for the unmethylated state within the H19/Igf2imprinted control region. J Biol Chem 2002; 277:27960–27967. 52. Hori N, Yamane M, Kouno K, Sato K. Induction of DNA demethylation && depending on two sets of Sox2 and adjacent Oct3/4 binding sites (SoxOct motifs) within the mouse H19/insulin-like growth factor 2 (Igf2) imprinted control region. J Biol Chem 2012; 287:44006–44016. This study highlighted the crucial role of Sox2/Oct4 factors in the regulation of imprinting at the H19/Igf2 domain. 53. Begemann M, Spengler S, Gogiel M, et al. Clinical significance of copy && number variations in the 11p15.5 imprinting control regions: new cases and review of the literature. J Med Genet 2012; 49:547–553. The authors give an overview on the genotype–phenotype correlation in chromosomal rearrangements in 11p15 as the basis for a directed genetic counseling. 54. Kannenberg K, Urban C, Binder G. Increased incidence of aberrant DNA & methylation within diverse imprinted gene loci outside of IGF2/H19 in SilverRussell syndrome. Clin Genet 2012; 81:366–377. In this report, the authors used genome wide methylation microarray to study the whole genome methylation in RSS patient with 11p15 ICR1 loss of methylation. They showed that methylation abnormalities are not restricted only to imprinted genes. 55. Maupetit-Mehouas S, Azzi S, Steunou V, et al. Simultaneous hyper- and && hypomethylation at imprinted loci in a subset of patients with GNAS epimutations underlies a complex and different mechanism of multilocus methylation defect in pseudohypoparathyroidism type 1b. Human mutation 2013; 34:1172–1180. In this study, the authors provide the first evidence that both loss and gain of methylation at different imprinted genes could occur in the same PHP-1b patient. This new insight highlights the complexity of imprinting regulation. 56. Court F, Martin-Trujillo A, Romanelli V, et al. Genome-wide allelic methylation & analysis reveals disease-specific susceptibility to multiple methylation defects in imprinting syndromes. Hum Mutat 2013; 34:595–602. The authors used a custom Illumina GoldenGate array targeting 27 imprinted DMRs to screen for imprinting anomalies and MID 65 patients affected by various imprinting related syndromes.
1752-296X ß 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins
www.co-endocrinology.com
37
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Growth and development 57. Azzi S, Rossignol S, Steunou V, et al. Multilocus methylation analysis in a large cohort of 11p15-related foetal growth disorders (Russell Silver and Beckwith Wiedemann syndromes) reveals simultaneous loss of methylation at paternal and maternal imprinted loci. Hum Mol Genet 2009; 18:4724–4733. 58. Bliek J, Verde G, Callaway J, et al. Hypomethylation at multiple maternally methylated imprinted regions including PLAGL1 and GNAS loci in Beckwith– Wiedemann syndrome. Eur J Hum Genet 2009; 17:611–619. 59. Lim D, Bowdin SC, Tee L, et al. Clinical and molecular genetic features of Beckwith–Wiedemann syndrome associated with assisted reproductive technologies. Hum Reprod 2009; 24:741–747. 60. Rossignol S, Steunou V, Chalas C, et al. The epigenetic imprinting defect of patients with Beckwith-Wiedemann syndrome born after assisted reproductive technology is not restricted to the 11p15 region. J Med Genet 2006; 43:902–907. 61. Meyer E, Lim D, Pasha S, et al. Germline mutation in NLRP2 (NALP2) in a familial imprinting disorder (Beckwith–Wiedemann Syndrome). PLoS Genet 2009; 5:e1000423. 62. Poole RL, Docherty LE, Al Sayegh A, et al. Targeted methylation testing of a & patient cohort broadens the epigenetic and clinical description of imprinting disorders. Am J Med Genet 2013; 161:2174–2182. This study showed that patients affected with MID could have additional clinical features compared with monolocus patients. 63. Turner CL, Mackay DM, Callaway JL, et al. Methylation analysis of 79 patients with growth restriction reveals novel patterns of methylation change at imprinted loci. Eur J Hum Genet 2010; 18:648–655. 64. Mackay DJ, Callaway JL, Marks SM, et al. Hypomethylation of multiple imprinted loci in individuals with transient neonatal diabetes is associated with mutations in ZFP57. Nat Genet 2008; 40:949–951. 65. Mackay DJ, Boonen SE, Clayton-Smith J, et al. A maternal hypomethylation syndrome presenting as transient neonatal diabetes mellitus. Hum Genet 2006; 120:262–269.
38
www.co-endocrinology.com
66. Perez-Nanclares G, Romanelli V, Mayo S, et al. Detection of hypomethylation syndrome among patients with epigenetic alterations at the GNAS locus. J Clin Endocrinol Metabol 2012; 97:E1060–E1067. This is the first report of MID in PHP-1b patients. 67. Begemann M, Spengler S, Kanber D, et al. Silver–Russell patients showing a broad range of ICR1 and ICR2 hypomethylation in different tissues. Clin Genet 2011; 80:83–88. 68. Dyck RF, Klomp H, Tan L. From thrifty genotype’ to ‘hefty fetal phenotype’: the relationship between high birth weight and diabetes in Saskatchewan Registered Indians. Can J Public Health 2001; 92:340–344. 69. Harder T, Rodekamp E, Schellong K, et al. Birth weight and subsequent risk of type 2 diabetes: a meta-analysis. Am J Epidemiol 2007; 165:849–857. 70. Gluckman PD, Hanson MA, Beedle AS. Early life events and their consequences for later disease: a life history and evolutionary perspective. Am J Hum Biol 2007; 19:1–19. 71. Fowden AL, Giussani DA, Forhead AJ. Endocrine and metabolic programming during intrauterine development. Early Hum Dev 2005; 81:723–734. 72. Temple IK, Shield JP. Transient neonatal diabetes, a disorder of imprinting. J Med Genet 2002; 39:872–875. 73. Hoffmann A, Spengler D. Transient neonatal diabetes mellitus gene Zac1 & impairs insulin secretion in mice through Rasgrf1. Mol Cell Biol 2012; 32:2549–2560. ZAC1 is involved in pancreatic development and insulin secretion. This study provides additional molecular mechanism through with Zac1 acts to regulate insulin secretion in b-cell. 74. Emerick JE, Vogt KS. Endocrine manifestations and management of Prader– Willi syndrome. Int J Pediatr Endocrinol 2013; 2013:14. 75. Hoffmann K, Heller R. Uniparental disomies 7 and 14. Best Pract Res 2011; 25:77–100. 76. Royo H, Cavaille J. Noncoding RNAs in imprinted gene clusters. Biol Cell 2008; 100:149–166. &
Volume 21 Number 1 February 2014
Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
