Gastrointestinal Cancer Symposium: Original Article
Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis Kishani‑Farahani R, Montazer‑Haghighi M, Asadzadeh‑Aghdaei H, Keshavarzi F1, Taleghani MY, Goodarzi F, Nazemalhosseini‑ Mojarad E2, Zali MR2 Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran, 1Department of biology, Sanandaj Branch, Islamic Azad University, Sanandaj, 2Gastroenterology and Liver Disease Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran Correspondence to: Dr. Mahdi Montazer Haghighi, E‑mail: [email protected]
Abstract CONTEXT: Familial adenomatous polyposis (FAP) is one type of hereditary colon cancer with a large number of precancerous polyps that initiation to growth in childhood and adolescent. Mutation in adenomatous polyposis coli (APC) gene is the cause of FAP. AIMS: The aim of the current study was to standardize multiplex ligation probe amplification (MLPA) method in screening of APC large deletions for the first time in Iranian patients with FAP. SUBJECTS AND METHODS: Deoxyribonucleic acid was extracted from 34 FAP patients by saluting out method. All patients were screened for APC large deletions whit MLPA and for the positive results, respective region was investigated by polymerase chain reaction sequencing. All genetic alterations were doubled checked in two separated rounds of MLPA. RESULTS: The detection rate of large fragment deletions in APC was 5.8% (2/34). Both of the Iranian patients had deletion in the middle and the end of exon 15, however, comparing of clinical features between patient with the large deletion and patients without deletion did not show any significant difference in each variable including, age at diagnosis, signs of disease and poly type. CONCLUSIONS: It seems that exon 15 of APC gene is probably the hotspot region in Iranian FAP patients. Association of genotype/phenotype is well known in FAP patients, but in this study statistical analyses did not show a significant difference in each considerable factor between patients with and without large deletions. It seems better to consider MLPA as an initial step to screening APC mutations. Key Words: Adenomatous polyposis coli, familial adenomatous polyposis, large deletion, multiplex ligation probe amplification
Introduction Colorectal cancer (CRC) is the third most common malignant disease in both men and women in Asia.[1] It is the second cause of cancer death in the last decade, CRC is classically divided into two categories: Hereditary and nonhereditary. [2,3] Approximately 15% of CRC cases are considered as a hereditary form which contains: Polyposis and non‑polyposis.[4,5] Familial adenomatous polyposis (FAP) is a colon cancer predisposition syndrome that resulting of mutation in adenomatous polyposis coli (APC) gene.[6] The main feature of FAP is polypogenesis beginning in the early of adulthood mainly in 16‑year‑old (with average 7‑36), polyps without early diagnosis and cure turn to colon cancer an average age of 39‑year‑old inevitably.[7] APC gene has 15 coding region that exon 15 is the largest exon of APC gene, which is the hot spot region in this gene. [8] About 60‑70% of APC mutations are microdeletions and 10‑15% are large deletion. [9‑11] Large fragments deletion do not identify by traditional methods, therefore, the use of alternative technique in detection of any more alterations in this gene is necessary. [12] There are several methods to investigate large deletions such as fluorescent in situ hybridization, semiquantitative‑polymerase chain reaction (PCR), Southern Blot and multiplex amplifiable probe hybridization but some studies suggested that multiplex ligation probe amplification (MLPA) has a higher throughput, more cheaper and very accurate technique to detection large deletion. [13‑17] APC is the first gene that is mutated in patients with FAP and has a dominant inheritance pattern in this illness moreover; conversion of Access this article online Quick Response Code:
Website: www.indianjcancer.com DOI: 10.4103/0019-509X.146758 PMID: *******
352
FAP to cancer is preventable. [18] The aim of the current study was to standardize of MLPA technique in detection of APC rearrangements for the 1st time in IRAN to improve diagnostic protocol in order to set up more complete protocol for screening of the carriers. Subjects and Methods Patients
The studied samples consist of 34 FAP patients. They had been registered in our hospital during the years 2010‑2012. The patients were selected in this study based on their colonoscopy results and all patients gave informed consent. Clinical data of patients including age of diagnosis, number of patients diagnosed with cancer, polyp type, polyp site and symptoms at diagnosis were recorded for the further investigation. All patients were screened for probably APC large deletions mutation. When, positive result was found, the given region was screened by PCR sequencing. All genetic alterations were confirmed in two separate rounds of MLPA. This study was conducted under the approval of the ethics committee of the gastroenterology and liver disease. Deoxyribonucleic acid (DNA) extraction
DNA was obtained from peripheral blood were collected from the patients. Genomic DNA was extracted using saluting out standard method.[19] MLPA
The MLPA analysis was performed on the APC gene using the probe mix PO43. The procedure conditions were conducted as recommended by the manufactures (MRC Holland, Amesterdam, The Netherlands). In brief, 250 ng of DNA was denatured during 5 min at 98°C and afterwards hybridized during 18 h at 60°C with the corresponding probes for each exon of each gene was analyzed. Subsequently, the hybridized products were incubated with a ligase for 15 min at 54°C and the ligation reaction was stopped with 5 min incubation at 98°C. Finally, the ligation products were amplified by PCR using a single set of FAM labeled primers and resolved by capillary Indian Journal of Cancer | July–September 2014 | Volume 51 | Issue 3
Kishani‑Farahani, et al.: APC gene large deletions in Iranian FAP patients
electrophoresis on an ABI PRISM 3130 genetic analyzer. The obtained results were analyzed using the software Gene‑Marker v1.6 (Soft Genetics, LLC.PA, USA). PCR sequencing of the altered region in exon 15
To confirm the alteration detected by MLPA in two patients, two pairs primers were designed for PCR amplification 5′TGTCAGTAGTAGTGATGGTTATG3′ (Forward), 5′CAGATGAACTCTTTGAGAATG3′ (Reverse) for amplification region near probe number 03324‑L02527 binding site and 5′TGAAGAAGAAGAGAGACCAAC3′ (Forward), 5′AAGTGAACTGACAGAAGTACATC3′ (Reverse) for amplification region near probe number 03325‑L02528 binding site. The first primer PCR condition is initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 40 s at 52.3°C, 40 s at 72°C and a final 5 min extension at 72°C. And for the second primer PCR condition was carried out with the following condition: Initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 50 s at 57.6°C, 40 s at 72°C and a final 5 min extension at 72°C. A PCR reaction without DNA template was used as a negative control in each run. PCR was performed in a total volume of 25 μl of the reaction mixture containing 100 ng of genomic DNA of each sample, ×10 PCR buffer 2.5 μl, MgCl2 2 mM, dNTP 0.2 mM and 1.25 U Super Taq polymerase, first pair primers 4.10 −7 mM and second pair primers 2.10 −7 mM were used. The amplified products were separated on 1% agarose gel in Tris boric acid containing ethidium boromaid and were photographed under ultraviolet light. Afterward 0.5 μl PCR product were submitted to the sequencing reaction using the BigDye Terminator V3.1 sequencing kit (Applied Biosystems). 25 cycles were amplified employing 0.5 μl of sense primer, with denaturing at 95°C for 30s annealing at 60°C for 15 s and extension at 60°C for 4 min. Sequences were analyzed using a sequencer (ABI 3130 XL Genetic analyzer).The electropherograms were analyzed using software DNA Lasergene version 6 (DNA STAR, Inc, Wisconsin USA). Statistical analysis was performed using the SPSS software program for Windows, Release 13.0.0 (SPSS Inc., Chicago, IL). Comparison of variables was performed using Pearson’s Chi‑square test, Fisher’s exact test, or the Mann‑Whitney U‑test, depending on the nature of the data. Two‑tailed P
Adenomatous polyposis coli gene large deletions in Iranian patients with familial adenomatous polyposis Kishani‑Farahani R, Montazer‑Haghighi M, Asadzadeh‑Aghdaei H, Keshavarzi F1, Taleghani MY, Goodarzi F, Nazemalhosseini‑ Mojarad E2, Zali MR2 Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran, 1Department of biology, Sanandaj Branch, Islamic Azad University, Sanandaj, 2Gastroenterology and Liver Disease Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran Correspondence to: Dr. Mahdi Montazer Haghighi, E‑mail: [email protected]
Abstract CONTEXT: Familial adenomatous polyposis (FAP) is one type of hereditary colon cancer with a large number of precancerous polyps that initiation to growth in childhood and adolescent. Mutation in adenomatous polyposis coli (APC) gene is the cause of FAP. AIMS: The aim of the current study was to standardize multiplex ligation probe amplification (MLPA) method in screening of APC large deletions for the first time in Iranian patients with FAP. SUBJECTS AND METHODS: Deoxyribonucleic acid was extracted from 34 FAP patients by saluting out method. All patients were screened for APC large deletions whit MLPA and for the positive results, respective region was investigated by polymerase chain reaction sequencing. All genetic alterations were doubled checked in two separated rounds of MLPA. RESULTS: The detection rate of large fragment deletions in APC was 5.8% (2/34). Both of the Iranian patients had deletion in the middle and the end of exon 15, however, comparing of clinical features between patient with the large deletion and patients without deletion did not show any significant difference in each variable including, age at diagnosis, signs of disease and poly type. CONCLUSIONS: It seems that exon 15 of APC gene is probably the hotspot region in Iranian FAP patients. Association of genotype/phenotype is well known in FAP patients, but in this study statistical analyses did not show a significant difference in each considerable factor between patients with and without large deletions. It seems better to consider MLPA as an initial step to screening APC mutations. Key Words: Adenomatous polyposis coli, familial adenomatous polyposis, large deletion, multiplex ligation probe amplification
Introduction Colorectal cancer (CRC) is the third most common malignant disease in both men and women in Asia.[1] It is the second cause of cancer death in the last decade, CRC is classically divided into two categories: Hereditary and nonhereditary. [2,3] Approximately 15% of CRC cases are considered as a hereditary form which contains: Polyposis and non‑polyposis.[4,5] Familial adenomatous polyposis (FAP) is a colon cancer predisposition syndrome that resulting of mutation in adenomatous polyposis coli (APC) gene.[6] The main feature of FAP is polypogenesis beginning in the early of adulthood mainly in 16‑year‑old (with average 7‑36), polyps without early diagnosis and cure turn to colon cancer an average age of 39‑year‑old inevitably.[7] APC gene has 15 coding region that exon 15 is the largest exon of APC gene, which is the hot spot region in this gene. [8] About 60‑70% of APC mutations are microdeletions and 10‑15% are large deletion. [9‑11] Large fragments deletion do not identify by traditional methods, therefore, the use of alternative technique in detection of any more alterations in this gene is necessary. [12] There are several methods to investigate large deletions such as fluorescent in situ hybridization, semiquantitative‑polymerase chain reaction (PCR), Southern Blot and multiplex amplifiable probe hybridization but some studies suggested that multiplex ligation probe amplification (MLPA) has a higher throughput, more cheaper and very accurate technique to detection large deletion. [13‑17] APC is the first gene that is mutated in patients with FAP and has a dominant inheritance pattern in this illness moreover; conversion of Access this article online Quick Response Code:
Website: www.indianjcancer.com DOI: 10.4103/0019-509X.146758 PMID: *******
352
FAP to cancer is preventable. [18] The aim of the current study was to standardize of MLPA technique in detection of APC rearrangements for the 1st time in IRAN to improve diagnostic protocol in order to set up more complete protocol for screening of the carriers. Subjects and Methods Patients
The studied samples consist of 34 FAP patients. They had been registered in our hospital during the years 2010‑2012. The patients were selected in this study based on their colonoscopy results and all patients gave informed consent. Clinical data of patients including age of diagnosis, number of patients diagnosed with cancer, polyp type, polyp site and symptoms at diagnosis were recorded for the further investigation. All patients were screened for probably APC large deletions mutation. When, positive result was found, the given region was screened by PCR sequencing. All genetic alterations were confirmed in two separate rounds of MLPA. This study was conducted under the approval of the ethics committee of the gastroenterology and liver disease. Deoxyribonucleic acid (DNA) extraction
DNA was obtained from peripheral blood were collected from the patients. Genomic DNA was extracted using saluting out standard method.[19] MLPA
The MLPA analysis was performed on the APC gene using the probe mix PO43. The procedure conditions were conducted as recommended by the manufactures (MRC Holland, Amesterdam, The Netherlands). In brief, 250 ng of DNA was denatured during 5 min at 98°C and afterwards hybridized during 18 h at 60°C with the corresponding probes for each exon of each gene was analyzed. Subsequently, the hybridized products were incubated with a ligase for 15 min at 54°C and the ligation reaction was stopped with 5 min incubation at 98°C. Finally, the ligation products were amplified by PCR using a single set of FAM labeled primers and resolved by capillary Indian Journal of Cancer | July–September 2014 | Volume 51 | Issue 3
Kishani‑Farahani, et al.: APC gene large deletions in Iranian FAP patients
electrophoresis on an ABI PRISM 3130 genetic analyzer. The obtained results were analyzed using the software Gene‑Marker v1.6 (Soft Genetics, LLC.PA, USA). PCR sequencing of the altered region in exon 15
To confirm the alteration detected by MLPA in two patients, two pairs primers were designed for PCR amplification 5′TGTCAGTAGTAGTGATGGTTATG3′ (Forward), 5′CAGATGAACTCTTTGAGAATG3′ (Reverse) for amplification region near probe number 03324‑L02527 binding site and 5′TGAAGAAGAAGAGAGACCAAC3′ (Forward), 5′AAGTGAACTGACAGAAGTACATC3′ (Reverse) for amplification region near probe number 03325‑L02528 binding site. The first primer PCR condition is initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 40 s at 52.3°C, 40 s at 72°C and a final 5 min extension at 72°C. And for the second primer PCR condition was carried out with the following condition: Initial denaturation at 95°C for 5 min was followed by 30 cycles comprising 45 s at 95°C, 50 s at 57.6°C, 40 s at 72°C and a final 5 min extension at 72°C. A PCR reaction without DNA template was used as a negative control in each run. PCR was performed in a total volume of 25 μl of the reaction mixture containing 100 ng of genomic DNA of each sample, ×10 PCR buffer 2.5 μl, MgCl2 2 mM, dNTP 0.2 mM and 1.25 U Super Taq polymerase, first pair primers 4.10 −7 mM and second pair primers 2.10 −7 mM were used. The amplified products were separated on 1% agarose gel in Tris boric acid containing ethidium boromaid and were photographed under ultraviolet light. Afterward 0.5 μl PCR product were submitted to the sequencing reaction using the BigDye Terminator V3.1 sequencing kit (Applied Biosystems). 25 cycles were amplified employing 0.5 μl of sense primer, with denaturing at 95°C for 30s annealing at 60°C for 15 s and extension at 60°C for 4 min. Sequences were analyzed using a sequencer (ABI 3130 XL Genetic analyzer).The electropherograms were analyzed using software DNA Lasergene version 6 (DNA STAR, Inc, Wisconsin USA). Statistical analysis was performed using the SPSS software program for Windows, Release 13.0.0 (SPSS Inc., Chicago, IL). Comparison of variables was performed using Pearson’s Chi‑square test, Fisher’s exact test, or the Mann‑Whitney U‑test, depending on the nature of the data. Two‑tailed P
