archives of oral biology 60 (2015) 234–241
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Down-regulated non-coding RNA (lncRNA-ANCR) promotes osteogenic differentiation of periodontal ligament stem cells Qian Jia 1, Wenkai Jiang 1, Longxing Ni * State Key Laboratory of Military Stomatology, Department of Operative Dentistry and Endodontics, School of Stomatology, 4th Military Medical University, 145 Changle West Road, Xi’an 710032, Shannxi, PR China
article info
abstract
Article history:
Objective: Our studies aimed to figure out how anti-differentiation noncoding RNA (ANCR)
Accepted 26 October 2014
regulates the proliferation and osteogenic differentiation of periodontal ligament stem cells (PDLSCs).
Keywords:
Design: In this study, we used lentivirus infection to down-regulate the expression of ANCR
Osteogenesis
in PDLSCs. Then we compared the proliferation of control cells and PDLSC/ANCR-RNAi cells
Periodontal ligament stem cells
by Cell Counting Kit-8. And the osteogenic differentiation of control cells and PDLSC/ANCR-
LncRNA
RNAi cells were evaluated by Alkaline phosphatase (ALP) activity quantification and Alizarin
Canonical WNT signalling pathway
red staining. WNT inhibitor was used to analyze the relationship between ANCR and canonical WNT signalling pathway. The expression of osteogenic differentiation marker mRNAs, DKK1, GSK3-b and b-catenin were evaluated by qRT-PCR. Results: The results showed that down-regulated ANCR promoted proliferation of PDLSCs. Down-regulated ANCR also promoted osteogenic differentiation of PDLSCs by up-regulating osteogenic differentiation marker genes. After the inhibition of canonical WNT signalling pathway, the osteogenic differentiation of PDLSC/ANCR-RNAi cells was inhibited too. qRTPCR results also demonstrated that canonical WNT signalling pathway was activated for ANCR-RNAi on PDLSCs during the procedure of proliferation and osteogenic induction. Conclusions: These results indicated that ANCR was a key regulator of the proliferation and osteogenic differentiation of PDLSCs, and its regulating effects was associated with the canonical WNT signalling pathway, thus offering a new target for oral stem cell differentiation studies that could also facilitate oral tissue engineering. # 2014 Published by Elsevier Ltd.
1.
Introduction
Tooth regeneration has long been studied by scholars. Oral stem cells, including dental pulp stem cells (DPSCs), periodontal ligament stem cells (PDLSCs) and stem cells from the * Corresponding author. Tel.: +86 29 84776476; fax: +86 29 83224432. E-mail address: [email protected] (L. Ni). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.archoralbio.2014.10.007 0003–9969/# 2014 Published by Elsevier Ltd.
apical papilla (SCAPs) are all pluripotent stem cells which can differentiate into many kinds of cells derived from other systems and can form osteogenic tissue; thus, these cells play important roles in tooth regeneration. Since Seo et al.1 first isolated stem cells from human periodontal ligament tissues, PDLSCs have been regarded as a favourable seed cell for
archives of oral biology 60 (2015) 234–241
periodontal tissue regeneration, which could form both the cementum-periodontal ligament complex and the adjacent bone tissues.2–4 Together with SCAPs, PDLSCs were able to form functional bio-root structures when seeded into HA/TCP scaffold materials after being implanted into swine.5 However, how to regulate and control their potency of osteogenic differentiation remains to be an unsolved problem. Therefore, determining the molecular mechanism of osteogenic differentiation of stem cells such as PDLSCs is critical for tooth regeneration and oral tissue engineering. In recent years, a large-scale complementary DNA cloning project has identified that the majority of human genome is transcribed, although only a minority of the transcripts represent protein-coding genes.6 The role of these proteincoding genes have been extensively investigated while the involvement of non-protein-coding genes have been less well characterized and the function of non-coding transcripts also remains unclear.7 These ncRNAs are highly abundant and could represent an even greater fraction of transcription across the human genome than protein-coding RNAs.8 The ncRNAs can be divided into small (less than 200 bp) and long (more than 200 bp; lncRNAs) groups and the lncRNAs constitute a critical regulating role in stem cell development.9–13 However, little attention has been paid to lncRNAs on its role of oral stem cells development. Anti-differentiation noncoding RNA (ANCR) is a newly found lncRNA that is down-regulated during the procedure of stem cell differentiation, thus it is required to keep epidemic stem cells or osteoblast cells to remain an undifferentiated cell state. Depleting ANCR in progenitor-containing populations, without any other stimuli, would result in rapid differentiation of gene induction.14 Lin also found that down-regulating ANCR could promote osteoblast differentiation by targeting EZH2 and regulating Runx2 expression.15 Based on these findings, we assumed that ANCR could play a certain role in the proliferation and osteogenic differentiation of PDLSCs. And PDLSCs treated with ANCR-RNAi may be used for periodontal tissue engineering and osteogenic tissue regeneration in the future.
2.
Methods
2.1.
Sample collection and cell culturing
Healthy human impacted third molars were collected from adults between 19 and 29 years old from the dental hospital of the Fourth Military Medical University. All tooth extractions were conducted under the approval of the Ethical Committee of School of Stomatology, Fourth Military Medical University. Tissue from the periodontal ligament was isolated as previously described.1 Briefly, the tissue was gently separated and digested in a solution of 3 mg/mL of collagenase type I (Invitrogen, Carlsbad, CA, USA) and 4 mg/mL of dispase (GIBCO/Invitrogen, Carlsbad, CA, USA) for 40 min at 37 8C. Cell suspension was obtained by passing the solution through a 70-mm strainer. Then cells at the density of 1 104 cells/well were seeded into a 6-well plate (Corning Costar, Cambridge, MA, USA). a-Modification of Eagle’s Medium (a-MEM, GIBCO/ Invitrogen, Carlsbad, CA, USA) supplemented with 10% foetal
235
bovine serum (HyClone, Kerrville, TX, USA), 100 mol/L of acid 2-phosphate (Sigma, St. Louis, MO, USA), 2 mmol/L of L-glutamine (Sigma, St. Louis, MO, USA), 100 U/mL of penicillin and 100 mg/mL of streptomycin (GIBCO, Carlsbad, CA, USA) was used as the standard culturing medium for cells at 37 8C O2 atmosphere with 5% CO2. The medium was changed every 2–3 days. A limited dilution technique was applied and single cell was seeded into a 96-well plate to obtain single cell-derived colonies. A number of these single-colony-derived strains were collected for further culturing when they reached 80% confluency with a 1:3 ratio passage. L-ascorbic
2.2.
Immunophenotype analysis
PDLSCs were stained with stem cell surface markers and analyzed by flow cytometry as described previously.16 Briefly, To identify the phenotypes of PDLSCs, 5 105 cells at the 3rd passage were incubated with phycoerythrin (PE) conjugated monoclonal antibodies for human CD29 (Biolegend, San Diego, CA, USA), CD34 (Biolegend, San Diego, CA, USA), CD45 (eBioscienceInc., San Diego, CA, USA), CD90 (eBioscienceInc., San Diego, CA, USA), CD146 (eBioscienceInc., San Diego, CA, USA) and Allophycocyanin (APC) conjugated monoclonal antibodies for human stro-1 (Biolegend, San Diego, CA, USA) based on the manufacturer’s instructions. The incubated procedure was carried out at 4 8C away from light for 1 h. After washing with PBS, cells were subjected to flow cytometric analysis (Beckman Coulter, Fullerton, CA, USA).
2.3.
Osteogenic/adipogenic differentiation assay
PDLSCs were seeded into a 6 well plate at a density of approximately 1 105 cells per well. Osteogenic differentiation induction medium (50 mg/mL of ascorbic acid (Sigma, St. Louis, MO, USA), 10 mmol/L of beta-glycerophosphate (BGP, Sigma, St. Louis, MO, USA) and 10 ng/mL of dexamethasone diluted in 10% FBSa-MEM) or adipogenic medium (0.5 mmol/L methylisobutylxanthine, 1 mmol/L dexamethasone, 10 mg/mL insulin, 200 mmol/L indomethcin) was given when cells reached 80% confluence. The conditioned medium was changed every 3 days. Cells cultured with standard culturing medium were designated as control group. After 21 days of culturing, cells were fixed with 4% paraformaldehyde and stained with alizarin red or oil red O solution (Sigma, St. Louis, MO, USA). After washing in PBS, the cells were observed using an inverted microscope.
2.4.
Lentivirus infection
The third-passage self-inactivating lentivirus vector was purchased from Neuron Biotech (Shanghai Neuron Biotech Co., Ltd., Shanghai, China). The vector contained a puromycinmarker and a U6 PolIII promoter which allowed for the introduction of oligonucleotides encoding short hairpin RNAs (shRNAs), and synthetic oligonucleotides containing the human ANCR (NCBI accession no. NR_024031.1) splice variant target sequence (GCTGACCCTTACCCTGAATAC) for cloning were synthesized, annealed and ligated into the pLKD-CMV-G lentiviral vector between the AgeI and EcoRI enzyme sites after
236
archives of oral biology 60 (2015) 234–241
the U6 promoter. The oligo sequences were: 50 -CCGGGCTGACCCTTACCCTGAATACCTCGAGGTATTCAGGGTAAGGGTCAGCTTTTTTG-30 (sense); and 50 -AATTCAAAAAAGCTGACCCTTACCCTGAATACCTCGAGGTATTCAGGGTAAGGGTCAGC-3 0 (antisense). PDLSCs at passage 3 were plated at 5 10 4 cells/ well in 6-well plates. The cells were cultured along with recombinant lentivirus encoding shRNA against ANCR at a multiplicity of infection (MOI) of 10, in a-MEM supplemented with 10% FBS containing 5 mg/mL of polybrene at 37 8C and 5% CO2 for 3 days. Then, the cells were replated in 50-mL, 25-cm2 flasks in 90% a-MEM and 10% FBS and 5 mg/mL of puromycinat 37 8C in an atmosphere of 5% CO2 with constant humidity. The effects on the expression of ANCR of ANCR-RNA interference (RNAi) were examined by qRT-PCR analysis of ANCR. Cells successfully infected with specific ANCR-RNAi were designated as PDLSC/ANCR-RNAi; wild-type PDLSCs and control cells infected by control lentivirus vector were designated as PDLSCs/wt and PDLSCs/vector, respectively.
extracted from cells using Trizol reagent (TAKARA, Osaka, Japan), and reverse-transcriptional reactions were performed using a TAKARA Reverse Transcriptase kit (TAKARA, Osaka, Japan). Real-time PCR was performed using a standard SYBR Green PCR kit (TAKARA, Osaka, Japan) protocol on an Applied Biosystems7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s instructions. b-actin was used as an internal reference. The mRNA expression of osteogenic differentiation marker ALP, dentine sialophosphoprotein (DSPP), osteocalcin (OCN), bone sialoprotein (BSP) and runt-related transcription factor 2 (Runx2) were analyzed. The expression of b-catenin, Dickkopf-related protein 1 (DKK1) and glycogen synthase kinase3b (GSK-3b) were also analyzed. Each sample was analyzed in triplicate. The 2DDCt value was used to determine the relative expression levels. The results were expressed as Log 10 (2DDCt). Sequences of the primers are shown in Table 1.
2.9. 2.5.
Cells were seeded separately into two 96-well plates at a density of approximately 1 104 cells per well. The assay was performed 24 h after seeding and lasted for 7 days; data were collected at the same time point each day. Cell Counting Kit-8 (Dojindo, Japan) was used to perform this experiment. The number of cells per well was tested by the absorbance (450 nm) of reduced WST-8 at the indicated time points.
2.6.
Alkaline phosphatase (ALP) activity quantification
Cells were separately seeded into 96-well plates at approximately 1 105 cells per well. 24 h after seeding, the culturing medium was changed into standard osteogenic differentiation induction medium (50 mg/mL of ascorbic acid (Sigma, St. Louis, MO, USA), 10 mmol/L of beta-glycerophosphate (BGP, Sigma, St. Louis, MO, USA) and 10 ng/mL of dexamethasone diluted in 10% FBS a-MEM). ALP quantification assay was performed at 3, 6, 9, 12, 15, 18 and 21 days using the alkaline phosphatase quantification assay kit (JianCheng, NanJing, JiangSu, China). The results were measured spectrophotometrically at a wavelength of 520 nm, based on the manufacturer’s instructions.
2.7.
WNT passway inhibition assay
Cell viability assay PDLSC/ANCR-RNAi cells were seeded into two 6-well plate. After 80% confluence, the culturing medium was changed into standard osteogenic differentiation induction medium and WNT passway inhibitor XAV-939 (5 mM, Selleck Chemicals, Houston, USA) was added into 3 wells in each plate according to previous study,18 equivalent dimethylsulfoxide was added into other 3 wells as control. Cells in one plate were cultured for 2 weeks for qRT-PCR analyzing ALP, DSPP, OCN, BSP and Runx2. Cells in another plate were cultured for 3 weeks for Alizarin red staining and quantification.
2.10.
Statistical analysis
Each experiment was performed in triplicate. The results were expressed in the form of means SEMs. Comparison of means between more than two groups was performed using one-way analysis of variance followed by a post hoc test (projected least
Table 1 – Primer sequences. Primer Actin-forward Actin-reverse
Alizarin red staining and quantification
Cells were seeded into 24-well plates at a density of approximately 1 105 cells per well separately. After cells reached 80% confluence, the culturing medium was changed into standard osteogenic differentiation induction medium and then cultured for another 3 weeks. The induction medium was changed every 3 days. Finally cells were stained with Alizarin red (pH = 4.1) staining solution and were quantified according to the methods previously published.17
2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) Cells were separately seeded into 60-mm dishes. After 80% confluence, all the cells were induced by standard osteogenic differentiation medium for 2 weeks. Then, total RNAs were
ANCR-forward ANCR-reverse ALP-forward ALP-reverse DSPP-forward DSPP-reverse OCN-forward OCN-reverse BSP-forward BSP-reverse Runx2-forward Runx2-reverse DKK1-forward DKK1-reverse GSK3-b-forward GSK3-b-reverse b-catenin-forward b-catenin-reverse
Sequence (50 –30 ) TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA GCCACTATGTAGCGGGTTTC ACCTGCGCTAAGAACTGAGG CCACGTCTTCACATTTGGTG AGACTGCGCCTGGTAGTTGT TCACAAGGGAGAAGGGAATG TGCCATTTGCTGTCAGTTT GGCAGCGAGGTAGTGAAGAG CTGGAGAGGAGCAGAACTGG AAAGTGAGAACGGGGAACCT GATGCAAAGCCAGAATGGAT AACCCACGGCCCTCCCTGAACTCT ACTGGCGGGGTGTAGGTAAAGGTG ATAGCACCTTGGATGGGTATTCC CTGATGACCGGAGACAAACAG CACCTCTGGCTACCATCCTTAT ATTATTGGTCTGTCCACGGTCT ATGGAAGGTCTCCTTGGGACTC CTCCACAAATTGCTGCTGTGTC
archives of oral biology 60 (2015) 234–241
significant difference Fisher). A value of P < 0.05 was considered as statistically significant.
3.
Results
3.1. Down-regulated ANCR promoted the proliferation of PDLSCs First we isolated and characterized human PDLSCs which could express mesenchymal stem cell markers (Fig. 1A–D) including CD29, CD90, CD146 and Stro-1; but were negative for hematopoietic cell marker CD34 (Fig. 1E) and leucocyte maker CD45 (Fig. 1F). These cells also showed osteogenic and adipogenic differentiation capacity after induction for 3 weeks in vitro (Fig. 2B and D). qRT-PCR analysis was performed 3 days after infection. Results showed that ANCR was knocked down with statistical significance by ANCR-specific lentivirus-delivered shRNA in the PDLSC/ANCR-RNAi group compared with control groups (PDLSCs/wt and PDLSCs/vector) (Fig. 3A). Cell viability assay was performed to quantify the proliferation level. Results showed that the growth rate of cells from PDLSC/ANCR-RNAi group was increased significantly compared with the control groups (Fig. 3B).
3.2. Down-regulated ANCR promoted the osteogenic differentiation of PDLSCs ALP activity was found significantly increased in PDLSC/ ANCR-RNAi group compared with the control groups from day 12 after induction (Fig. 4A). Alizarin red staining and quantification results indicated that, PDLSC/ANCR-RNAi group formed more mineralized nodules than the control
237
groups after induction (Fig. 4B and C). The mRNA expression of the osteogenic differentiation markers ALP, DSPP, OCN, BSP and Runx2 were analyzed by qRT-PCR. Results showed that the expression level of all these genes was higher in the PDLSC/ANCR-RNAi group after 2 weeks of induction (Fig. 4D). These data suggested that down-regulated ANCR promoted the osteogenic differentiation of PDLSCs.
3.3. ANCR regulated the osteogenic differentiation of PDLSCs through canonical WNT signalling pathway Previous studies have indicated that Runx2 was a target gene of the canonical WNT signalling pathway, that is, stable expression of b-catenin in activated wnt pathway could further activate the expression of Runx2 in bone mesenchymal stem cells (BMSCs).19 Therefore, we analyzed the mRNA expression of DKK1, GSK-3b and b-catenin by qRT-PCR. Results showed that the mRNA expression of GSK-3b was lower while b-catenin was higher in PDLSC/ANCR-RNAi group than in the control group after osteogenic induction. In the mean time, the mRNA expression of DKK1 had no significant change (Fig. 5A). After the inhibition of canonical WNT signalling pathway by XAV-939, the osteogenic differentiation marker genes ALP, DSPP, OCN, BSP and Runx2 were downregulated (Fig. 5D) and there were less mineralized nodules formed in PDLSC/ANCR-RNAi cells compared to the PDLSC/ ANCR-RNAi cells without XAV-939 inhibition (Fig. 5B and C).
4.
Discussion
Potency of osteogenic differentiation is one of the most important characteristics of the pluripotency of oral stem cells. As a result, repair and regeneration of periodontal
Fig. 1 – The characterization of human PDLSCs (Immunophenotype analysis). The cells we isolated could express mesenchymal stem cell markers including CD29 (A), CD90 (B), CD146 (C) and Stro-1 (D); but were negative for hematopoietic cell marker CD34 (E) and leucocyte maker CD45 (F).
238
archives of oral biology 60 (2015) 234–241
Fig. 2 – The characterization of human PDLSCs (osteogenic/adipogenic differentiation assay). These cells also showed osteogenic (B) and adipogenic (D) differentiation capacity after induction for 3 weeks in vitro compared to control groups (A, C).
tissues in tissue engineering project mostly rely on the osteogenic differentiation of PDLSCs. A porcine model study reported that transplanting autologous PDLSCs in swine could regenerate root-periodontal complex which was capable of supporting a porcelain crown as in normal tooth function.5 There was a similar study in histological level revealing that periodontal tissues were regenerated in swine by injecting autologous PDLSCs in vivo.20 The regulatory function of small noncoding RNA and microRNA in the osteogenic differentiation of PDLSCs have been extensively studied in recent years.21–25 Liu et al. discovered that MiR-17 modulated the osteogenic differentiation of PDLSCs through a coherent feed-forward loop in patients with periodontitis.24 Another study showed that
osteogenic tissue-type differentiation in PDLSCs was associated with a decrease in hsa-mir-218 expression.21 There has also been research on lncRNAs and their regulatory functions in cell differentiation. A recent study indicated that terminal differentiation – induced nc-RNA (TINCR) could regulate somatic tissue differentiation.26 Sun et al. reported that MEN e/b lncRNAs exhibited more than two-fold up-regulation upon the differentiation of C2C12 myoblasts into myotubes.27 However, there has been no research on the regulatory functions of lncRNA in the field of osteogenic differentiation of PDLSCs. In our study, we used RNAi to down-regulate ANCR by lentivirus infection of PDLSCs. After 3 weeks of osteogenic induction, cells from PDLSC/ANCR-RNAi group formed more
Fig. 3 – The down-regulation of ANCR promoted PDLSC proliferation. (A) 3 days after lentivirus infection, we evaluated the effects of ANCR-RNAi by qRT-PCR. The results showed that the ANCR expression of PDLSC/ANCR-RNAi cells was remarkably down-regulated, compared with control cells. *P < 0.05. (B) From day 1 to day 7, the cell viability of PDLSC/ANCRRNAi cells was greater than that of the control cells, which indicated that ANCR down-regulation promoted PDLSC proliferation. *P < 0.05.
archives of oral biology 60 (2015) 234–241
239
Fig. 4 – The down-regulation of ANCR promoted PDLSC osteogenic differentiation. (A) ALP activity quantification allowed for a clear view of ALP activity changes in the 3 weeks of induction. ALP activity was found to be significantly increased in PDLSC/ANCR-RNAi cells, compared with control cells, beginning on day 12. *P < 0.05. (B) 3 weeks after induction, the cells were stained with alizarin red (pH = 4.1), and the results showed that PDLSC/ANCR-RNAi cells formed more mineralized nodules than the control groups. (C) To confirm the alizarin red staining results, we performed alizarin red quantification. The results of quantification confirmed that PDLSC/ANCR-RNAi cells formed more mineralized nodules than the control groups. *P < 0.05. (D) The mRNA expressions of ALP, OCN, DSPP, BSP and Runx2 were remarkably up-regulated in PDLSC/ ANCR-RNAi cells compared to control cells after 2 weeks of induction. *P < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
mineralized nodules than the control group. ALP activity quantification also showed the same tendency. Then, we compared the mRNA expression of ALP, DSPP, OCN, BSP and Runx2. Expressions of all these genes were increased in experimental group after 2 weeks induction which was in accordance with previous studies.14,15 Our research further confirmed that ANCR was an anti-differentiation RNA and its down-regulation would promote the osteogenic differentiation potency of PDLSCs. Previous studies have indicated that activation of canonical WNT signalling pathway could promote osteogenic differentiation of mesenchymal stem cells.28 Runx2 was a target gene of the canonical WNT signalling pathway, and stable expression of b-catenin could further activate the expression of Runx2 in BMSCs.19 Therefore, we speculated that down-regulation of ANCR would activate the canonical WNT signalling pathway. In our study, we analyzed the mRNA expression of DKK1, GSK-3b and bcatenin. qRT-PCR results showed that the mRNA expression of DKK1 had no significant change after the inhibition of ANCR. However, the mRNA expression of GSK3b was down-regulated while that of b-catenin was up-regulated after down-regulating ANCR. These results indicated that the influence on canonical WNT pathway of down-regulating ANCR was started from the b-catenin degradation compounds which was represented with GSK3b in cytoplasm instead of DKK1 on
the cell membrane. Previous research reported that the downregulation of GSK3-b would immediately stop the degradation of b-catenin and promote the nuclear translocation of bcatenin.29 Scholars also have considered that the nuclear translocation of b-catenin could increase the Runx2 receptor activity.19,30,31 Our study showed that after down-regulating ANCR, the gene expression of Runx2 was more significantly up-regulated in PDLSCs after osteogenic induction compared with control groups. So we infer that after down-regulating ANCR, the expression level of GSK3b is supressed which further led to the activation of b-catenin and the activation of b-catenin activates Runx2 which finally results in the promotion of osteogenic differentiation of PDLSCs. To confirm our result, we use XAV-939 to inhibit the canonical WNT signalling pathway of PDLSC/ANCR-RNAi cells during the osteogenic induction. The qRT-PCR and Alizarin red staining results showed that after the inhibition of canonical WNT signalling pathway the osteogenic differentiation marker genes were down-regulated and there were less mineralized nodules formed. In summary, these findings demonstrated that canonical WNT signalling pathway was activated for ANCR-RNAi on PDLSCs during the procedure of osteogenic induction. Our result also showed that down-regulated ANCR promote the proliferation of PDLSCs. We infer that it is also related to
240
archives of oral biology 60 (2015) 234–241
Fig. 5 – ANCR regulated PDLSC osteogenic differentiation by activating the canonical WNT signalling pathway. (A) The result showed that the mRNA expression of DKK1 have no significant change in PDLSC/ANCR-RNAi cells compared to control cells after 2 weeks of induction. However, the mRNA expression of GSK3-b was down-regulated and the mRNA expression of b-catenin was remarkably up-regulated in PDLSC/ANCR-RNAi cells compared to control cells after 2 weeks of induction. *P < 0.05. (B) 3 weeks after induction, the cells were stained with alizarin red (pH = 4.1), and the results showed that PDLSC/ ANCR-RNAi cells treated with XAV-939 formed less mineralized nodules than the control group. (C) The results of quantification confirmed that PDLSC/ANCR-RNAi cells treated with XAV-939 formed less mineralized nodules than the control group. *P < 0.05. (D) The mRNA expressions of ALP, DSPP, BSP and Runx2 were down-regulated in PDLSC/ANCRRNAi cells treated with XAV-939 compared to control cells after 2 weeks of induction. However, the expression of OCN had no significant change. *P < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the activation of canonical WNT pathway. Previous researches reported that after the activation of canonical WNT pathway, b-catenin translocated to the nuclear and activated T cell factor/lymphoid enhancer factor (TCF/LEF) promoter. Constitutive activation of downstream target genes, such as c-myc and cyclin D1 by the TCF/LEF-b-catenin complex will promote the proliferation of cells.32–34 We also found out that down-regulated ANCR could promote not only the osteogenic differentiation but also the adipocyte differentiation (unpublished data) of PDLSC which may infer that ANCR is a very important regulator in the differentiation of PDLSC. In the future study, we will deeper focus on the interrelationship between ANCR and canonical WNT signalling pathway. How ANCR interact with canonical WNT signalling pathway? What is the regulatory protein between them? There are many questions needed to be answered. In summary, our study showed that down-regulation of ANCR would promote the proliferation of PDLSCs. Furthermore, the osteogenic differentiation of PDLSCs could also be up regulated through activating canonical wnt signalling pathway when ANCR was down regulated. These findings suggest that ANCR is a critical important regulator of PDLSC by means of proliferation and osteogenic differentiation. PDLSCs
treated with ANCR-RNAi could be used for periodontal tissue engineering and osteogenic tissue regeneration.
Funding This study was supported by grants from the National Natural Science Foundation of China (Nos. 81170946, 81371139) and National Key Technologies R&D Program of the twelve-five Year Plan, the Ministry of Science and Technology of China (2012BAI07B03).
Conflict of interest The authors deny any conflicts of interests.
Ethical approval The ethics committee of the Fourth Military Medical University School of Stomatology approved the experimental protocols (permission number IRB-REV-2012-017).
archives of oral biology 60 (2015) 234–241
references 18. 1. Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004;364(9249):149–55. 2. Hiraga T, Ninomiya T, Hosoya A, Takahashi M, Nakamura H. Formation of bone-like osteogenic matrix by periodontal ligament cells in vivo: a morphological study in rats. J Bone Miner Metab 2009;27(2):149–57. 3. Huang GT, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs those from other sources: their biology and role in regenerative medicine. J Dent Res 2009;88(9):792–806. 4. Kato T, Hattori K, Deguchi T, Katsube Y, Matsumoto T, Ohgushi H, et al. Osteogenic potential of rat stromal cells derived from periodontal ligament. J Tissue Eng Regen Med 2011;5(10):798–805. 5. Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, et al. Mesenchymal stem cell-mediated functional tooth regeneration in Swine. PLOS ONE 2006;1:e79. 6. Liao Q, Liu C, Yuan X, Kang S, Miao R, Xiao H, et al. Large scale prediction of long non-coding RNA functions in a coding–non-coding gene co-expression network. Nucleic Acids Res 2011;39:3864–78. 7. Huo JS, Zambidis ET. Pivots of pluripotency: the roles of noncoding RNA in regulating embryonic and induced pluripotent stem cells. Biochim Biophys Acta 2013;1830(2):2385–94. 8. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The transcriptional landscape of the mammalian genome. Science 2005;309:1559–63. 9. Jia H, Osak M, Bogu GK, Stanton LW, Johnson R, Lipovich L. Genome-wide computational identification and manual annotation of human long noncoding RNA genes. RNA 2010;16:478–87. 10. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, et al. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 2009;458:223–7. 11. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci 2009;106:11667–72. 12. Sheik Mohamed J, Gaughwin PM, Lim B, Robson P, Lipovich L. Conserved long noncoding RNAs transcriptionally regulated by Oct4 and Nanog modulate pluripotency in mouse embryonic stem cells. RNA 2010;16:324–37. 13. Ng S-Y, Johnson R, Stanton LW. Human long non-coding RNAs promote pluripotency and neuronal differentiation by association with chromatin modifiers and transcription factors. EMBO J 2012;31:522–33. 14. Kretz M, Webster DE, Flockhart RJ, Lee CS, Zehnder A, Lopez-Pajares V, et al. Suppression of progenitor differentiation requires the long noncoding RNA ANCR. Genes Dev 2012;26:338–43. 15. Zhu L, Xu PC. Downregulated LncRNA-ANCR promotes osteoblast differentiation by targeting EZH2 and regulating Runx2 expression. Biochem Biophys Res Commun 2013;432:612–7. 16. Gronthos S, Mrozik K, Shi S, Bartold PM. Ovine periodontal ligament stem cells: isolation, characterization, and differentiation potential. Calcif Tissue Int 2006;79:310–7. 17. Osathanon T, Nowwarote N, Pavasant P. Basic fibroblast growth factor inhibits osteogenic differentiation but induces neuronal differentiation by human dental pulp
19.
20.
21.
22.
23.
24.
25.
26.
27.
28. 29.
30.
31.
32.
33.
34.
241
stem cells through a FGFR and PLCg signaling pathway. Cell Biochem 2011;112(7):1807–16. Ma Q, Guin S, Padhye SS, Zhou YQ, Zhang RW, Wang MH. Ribosomal protein S6 kinase (RSK)-2 as a central effector molecule in RON receptor tyrosine kinase mediated epithelial to mesenchymal transition induced by macrophage-stimulating protein. Mol Cancer 2011;28(10):66. Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical wnt signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280(39):33132–40. Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, et al. Periodontal ligament stem cell mediated treatment for periodontitis in Miniature Swine. Stem Cells 2008;26:1065–73. Gay I, Cavender A, Peto D, Sun Z, Speer A, Cao H, et al. Differentiation of human dental stem cells reveals a role for microRNA-218. J Periodontal Res 2014;49(1):110–20. Liu W, Liu Y, Guo T, Hu C, Luo H, Zhang L, et al. A novel positive regulator of osteogenesis, plays a crucial role in miR17 modulating the diverse effect of canonical Wnt signaling in different microenvironments. Cell Death Dis 2013;4:e539. Ng TK, Carballosa CM, Pelaez D, Wong HK, Choy KW, Pang CP, et al. Nicotine alters MicroRNA expression and hinders human adult stem cell regenerative potential. Stem Cells Dev 2013;22(5):781–90. Liu Y, Liu W, Hu C, Xue Z, Wang G, Ding B, et al. MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis. Stem Cells 2011;29(11):1804–16. Zhou Q, Zhao ZN, Cheng JT, Zhang B, Xu J, Huang F, et al. Ibandronate promotes osteogenic differentiation of periodontal ligament stem cells by regulating the expression of microRNAs. Biochem Biophys Res Commun 2011;404(1):127–32. Kretz M, Siprashvili Z, Chu C, Webster DE, Zehnder A, Qu K, et al. Control of somatic tissue differentiation by the long non-coding RNA TINCR. Nature 2013;493(7431):231–5. Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL. MEN epsilon/beta nuclear-retained non-coding RNAs are up-regulated upon muscle differentiation and are essential components of paraspeckles. Genome Res 2009;19:347–59. Ling L, Nurcombe V, Cool SM. Wnt signaling controls the fate of mesenchymal stem cells. Gene 2009;433(1–2):1–7. Davidson G, Wu W, Shen J, Bilic J, Fenger U, Stannek P, et al. Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal transduction. Nature 2005;438(7069):867–72. Rodrı´guez-Carballo E, Ulsamer A, Susperregui AR, Manzanares-Ce´spedes C, Sa´nchez-Garcı´a E, Bartrons R, et al. Conserved regulatory motifs in osteogenic gene promoters integrate cooperative effects of canonical Wnt and BMP pathways. J Bone Miner Res 2011;26(4):718–29. Cho YD, Kim WJ, Yoon WJ, Woo KM, Baek JH, Lee G, et al. Wnt3a stimulates Mepe, matrix extracellular phosphoglycoprotein, expression directly by the activation of the canonical Wnt signaling pathway and indirectly through the stimulation of autocrine Bmp-2 expression. J Cell Physiol 2012;227(6):2287–96. Takemaru KI, Moon RT. The transcriptional coactivator CBP interacts with beta-catenin to activate gene expression. J Cell Biol 2000;149(2):249–54. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12. Hecht A, Litterst CM, Huber O, Kemler R. Functional characterization of multiple transactivating elements in bcatenin, some of which interact with the TATA-binding protein in vitro. J Biol Chem 1999;25:18017–21802.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Down-regulated non-coding RNA (lncRNA-ANCR) promotes osteogenic differentiation of periodontal ligament stem cells Qian Jia 1, Wenkai Jiang 1, Longxing Ni * State Key Laboratory of Military Stomatology, Department of Operative Dentistry and Endodontics, School of Stomatology, 4th Military Medical University, 145 Changle West Road, Xi’an 710032, Shannxi, PR China
article info
abstract
Article history:
Objective: Our studies aimed to figure out how anti-differentiation noncoding RNA (ANCR)
Accepted 26 October 2014
regulates the proliferation and osteogenic differentiation of periodontal ligament stem cells (PDLSCs).
Keywords:
Design: In this study, we used lentivirus infection to down-regulate the expression of ANCR
Osteogenesis
in PDLSCs. Then we compared the proliferation of control cells and PDLSC/ANCR-RNAi cells
Periodontal ligament stem cells
by Cell Counting Kit-8. And the osteogenic differentiation of control cells and PDLSC/ANCR-
LncRNA
RNAi cells were evaluated by Alkaline phosphatase (ALP) activity quantification and Alizarin
Canonical WNT signalling pathway
red staining. WNT inhibitor was used to analyze the relationship between ANCR and canonical WNT signalling pathway. The expression of osteogenic differentiation marker mRNAs, DKK1, GSK3-b and b-catenin were evaluated by qRT-PCR. Results: The results showed that down-regulated ANCR promoted proliferation of PDLSCs. Down-regulated ANCR also promoted osteogenic differentiation of PDLSCs by up-regulating osteogenic differentiation marker genes. After the inhibition of canonical WNT signalling pathway, the osteogenic differentiation of PDLSC/ANCR-RNAi cells was inhibited too. qRTPCR results also demonstrated that canonical WNT signalling pathway was activated for ANCR-RNAi on PDLSCs during the procedure of proliferation and osteogenic induction. Conclusions: These results indicated that ANCR was a key regulator of the proliferation and osteogenic differentiation of PDLSCs, and its regulating effects was associated with the canonical WNT signalling pathway, thus offering a new target for oral stem cell differentiation studies that could also facilitate oral tissue engineering. # 2014 Published by Elsevier Ltd.
1.
Introduction
Tooth regeneration has long been studied by scholars. Oral stem cells, including dental pulp stem cells (DPSCs), periodontal ligament stem cells (PDLSCs) and stem cells from the * Corresponding author. Tel.: +86 29 84776476; fax: +86 29 83224432. E-mail address: [email protected] (L. Ni). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.archoralbio.2014.10.007 0003–9969/# 2014 Published by Elsevier Ltd.
apical papilla (SCAPs) are all pluripotent stem cells which can differentiate into many kinds of cells derived from other systems and can form osteogenic tissue; thus, these cells play important roles in tooth regeneration. Since Seo et al.1 first isolated stem cells from human periodontal ligament tissues, PDLSCs have been regarded as a favourable seed cell for
archives of oral biology 60 (2015) 234–241
periodontal tissue regeneration, which could form both the cementum-periodontal ligament complex and the adjacent bone tissues.2–4 Together with SCAPs, PDLSCs were able to form functional bio-root structures when seeded into HA/TCP scaffold materials after being implanted into swine.5 However, how to regulate and control their potency of osteogenic differentiation remains to be an unsolved problem. Therefore, determining the molecular mechanism of osteogenic differentiation of stem cells such as PDLSCs is critical for tooth regeneration and oral tissue engineering. In recent years, a large-scale complementary DNA cloning project has identified that the majority of human genome is transcribed, although only a minority of the transcripts represent protein-coding genes.6 The role of these proteincoding genes have been extensively investigated while the involvement of non-protein-coding genes have been less well characterized and the function of non-coding transcripts also remains unclear.7 These ncRNAs are highly abundant and could represent an even greater fraction of transcription across the human genome than protein-coding RNAs.8 The ncRNAs can be divided into small (less than 200 bp) and long (more than 200 bp; lncRNAs) groups and the lncRNAs constitute a critical regulating role in stem cell development.9–13 However, little attention has been paid to lncRNAs on its role of oral stem cells development. Anti-differentiation noncoding RNA (ANCR) is a newly found lncRNA that is down-regulated during the procedure of stem cell differentiation, thus it is required to keep epidemic stem cells or osteoblast cells to remain an undifferentiated cell state. Depleting ANCR in progenitor-containing populations, without any other stimuli, would result in rapid differentiation of gene induction.14 Lin also found that down-regulating ANCR could promote osteoblast differentiation by targeting EZH2 and regulating Runx2 expression.15 Based on these findings, we assumed that ANCR could play a certain role in the proliferation and osteogenic differentiation of PDLSCs. And PDLSCs treated with ANCR-RNAi may be used for periodontal tissue engineering and osteogenic tissue regeneration in the future.
2.
Methods
2.1.
Sample collection and cell culturing
Healthy human impacted third molars were collected from adults between 19 and 29 years old from the dental hospital of the Fourth Military Medical University. All tooth extractions were conducted under the approval of the Ethical Committee of School of Stomatology, Fourth Military Medical University. Tissue from the periodontal ligament was isolated as previously described.1 Briefly, the tissue was gently separated and digested in a solution of 3 mg/mL of collagenase type I (Invitrogen, Carlsbad, CA, USA) and 4 mg/mL of dispase (GIBCO/Invitrogen, Carlsbad, CA, USA) for 40 min at 37 8C. Cell suspension was obtained by passing the solution through a 70-mm strainer. Then cells at the density of 1 104 cells/well were seeded into a 6-well plate (Corning Costar, Cambridge, MA, USA). a-Modification of Eagle’s Medium (a-MEM, GIBCO/ Invitrogen, Carlsbad, CA, USA) supplemented with 10% foetal
235
bovine serum (HyClone, Kerrville, TX, USA), 100 mol/L of acid 2-phosphate (Sigma, St. Louis, MO, USA), 2 mmol/L of L-glutamine (Sigma, St. Louis, MO, USA), 100 U/mL of penicillin and 100 mg/mL of streptomycin (GIBCO, Carlsbad, CA, USA) was used as the standard culturing medium for cells at 37 8C O2 atmosphere with 5% CO2. The medium was changed every 2–3 days. A limited dilution technique was applied and single cell was seeded into a 96-well plate to obtain single cell-derived colonies. A number of these single-colony-derived strains were collected for further culturing when they reached 80% confluency with a 1:3 ratio passage. L-ascorbic
2.2.
Immunophenotype analysis
PDLSCs were stained with stem cell surface markers and analyzed by flow cytometry as described previously.16 Briefly, To identify the phenotypes of PDLSCs, 5 105 cells at the 3rd passage were incubated with phycoerythrin (PE) conjugated monoclonal antibodies for human CD29 (Biolegend, San Diego, CA, USA), CD34 (Biolegend, San Diego, CA, USA), CD45 (eBioscienceInc., San Diego, CA, USA), CD90 (eBioscienceInc., San Diego, CA, USA), CD146 (eBioscienceInc., San Diego, CA, USA) and Allophycocyanin (APC) conjugated monoclonal antibodies for human stro-1 (Biolegend, San Diego, CA, USA) based on the manufacturer’s instructions. The incubated procedure was carried out at 4 8C away from light for 1 h. After washing with PBS, cells were subjected to flow cytometric analysis (Beckman Coulter, Fullerton, CA, USA).
2.3.
Osteogenic/adipogenic differentiation assay
PDLSCs were seeded into a 6 well plate at a density of approximately 1 105 cells per well. Osteogenic differentiation induction medium (50 mg/mL of ascorbic acid (Sigma, St. Louis, MO, USA), 10 mmol/L of beta-glycerophosphate (BGP, Sigma, St. Louis, MO, USA) and 10 ng/mL of dexamethasone diluted in 10% FBSa-MEM) or adipogenic medium (0.5 mmol/L methylisobutylxanthine, 1 mmol/L dexamethasone, 10 mg/mL insulin, 200 mmol/L indomethcin) was given when cells reached 80% confluence. The conditioned medium was changed every 3 days. Cells cultured with standard culturing medium were designated as control group. After 21 days of culturing, cells were fixed with 4% paraformaldehyde and stained with alizarin red or oil red O solution (Sigma, St. Louis, MO, USA). After washing in PBS, the cells were observed using an inverted microscope.
2.4.
Lentivirus infection
The third-passage self-inactivating lentivirus vector was purchased from Neuron Biotech (Shanghai Neuron Biotech Co., Ltd., Shanghai, China). The vector contained a puromycinmarker and a U6 PolIII promoter which allowed for the introduction of oligonucleotides encoding short hairpin RNAs (shRNAs), and synthetic oligonucleotides containing the human ANCR (NCBI accession no. NR_024031.1) splice variant target sequence (GCTGACCCTTACCCTGAATAC) for cloning were synthesized, annealed and ligated into the pLKD-CMV-G lentiviral vector between the AgeI and EcoRI enzyme sites after
236
archives of oral biology 60 (2015) 234–241
the U6 promoter. The oligo sequences were: 50 -CCGGGCTGACCCTTACCCTGAATACCTCGAGGTATTCAGGGTAAGGGTCAGCTTTTTTG-30 (sense); and 50 -AATTCAAAAAAGCTGACCCTTACCCTGAATACCTCGAGGTATTCAGGGTAAGGGTCAGC-3 0 (antisense). PDLSCs at passage 3 were plated at 5 10 4 cells/ well in 6-well plates. The cells were cultured along with recombinant lentivirus encoding shRNA against ANCR at a multiplicity of infection (MOI) of 10, in a-MEM supplemented with 10% FBS containing 5 mg/mL of polybrene at 37 8C and 5% CO2 for 3 days. Then, the cells were replated in 50-mL, 25-cm2 flasks in 90% a-MEM and 10% FBS and 5 mg/mL of puromycinat 37 8C in an atmosphere of 5% CO2 with constant humidity. The effects on the expression of ANCR of ANCR-RNA interference (RNAi) were examined by qRT-PCR analysis of ANCR. Cells successfully infected with specific ANCR-RNAi were designated as PDLSC/ANCR-RNAi; wild-type PDLSCs and control cells infected by control lentivirus vector were designated as PDLSCs/wt and PDLSCs/vector, respectively.
extracted from cells using Trizol reagent (TAKARA, Osaka, Japan), and reverse-transcriptional reactions were performed using a TAKARA Reverse Transcriptase kit (TAKARA, Osaka, Japan). Real-time PCR was performed using a standard SYBR Green PCR kit (TAKARA, Osaka, Japan) protocol on an Applied Biosystems7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s instructions. b-actin was used as an internal reference. The mRNA expression of osteogenic differentiation marker ALP, dentine sialophosphoprotein (DSPP), osteocalcin (OCN), bone sialoprotein (BSP) and runt-related transcription factor 2 (Runx2) were analyzed. The expression of b-catenin, Dickkopf-related protein 1 (DKK1) and glycogen synthase kinase3b (GSK-3b) were also analyzed. Each sample was analyzed in triplicate. The 2DDCt value was used to determine the relative expression levels. The results were expressed as Log 10 (2DDCt). Sequences of the primers are shown in Table 1.
2.9. 2.5.
Cells were seeded separately into two 96-well plates at a density of approximately 1 104 cells per well. The assay was performed 24 h after seeding and lasted for 7 days; data were collected at the same time point each day. Cell Counting Kit-8 (Dojindo, Japan) was used to perform this experiment. The number of cells per well was tested by the absorbance (450 nm) of reduced WST-8 at the indicated time points.
2.6.
Alkaline phosphatase (ALP) activity quantification
Cells were separately seeded into 96-well plates at approximately 1 105 cells per well. 24 h after seeding, the culturing medium was changed into standard osteogenic differentiation induction medium (50 mg/mL of ascorbic acid (Sigma, St. Louis, MO, USA), 10 mmol/L of beta-glycerophosphate (BGP, Sigma, St. Louis, MO, USA) and 10 ng/mL of dexamethasone diluted in 10% FBS a-MEM). ALP quantification assay was performed at 3, 6, 9, 12, 15, 18 and 21 days using the alkaline phosphatase quantification assay kit (JianCheng, NanJing, JiangSu, China). The results were measured spectrophotometrically at a wavelength of 520 nm, based on the manufacturer’s instructions.
2.7.
WNT passway inhibition assay
Cell viability assay PDLSC/ANCR-RNAi cells were seeded into two 6-well plate. After 80% confluence, the culturing medium was changed into standard osteogenic differentiation induction medium and WNT passway inhibitor XAV-939 (5 mM, Selleck Chemicals, Houston, USA) was added into 3 wells in each plate according to previous study,18 equivalent dimethylsulfoxide was added into other 3 wells as control. Cells in one plate were cultured for 2 weeks for qRT-PCR analyzing ALP, DSPP, OCN, BSP and Runx2. Cells in another plate were cultured for 3 weeks for Alizarin red staining and quantification.
2.10.
Statistical analysis
Each experiment was performed in triplicate. The results were expressed in the form of means SEMs. Comparison of means between more than two groups was performed using one-way analysis of variance followed by a post hoc test (projected least
Table 1 – Primer sequences. Primer Actin-forward Actin-reverse
Alizarin red staining and quantification
Cells were seeded into 24-well plates at a density of approximately 1 105 cells per well separately. After cells reached 80% confluence, the culturing medium was changed into standard osteogenic differentiation induction medium and then cultured for another 3 weeks. The induction medium was changed every 3 days. Finally cells were stained with Alizarin red (pH = 4.1) staining solution and were quantified according to the methods previously published.17
2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) Cells were separately seeded into 60-mm dishes. After 80% confluence, all the cells were induced by standard osteogenic differentiation medium for 2 weeks. Then, total RNAs were
ANCR-forward ANCR-reverse ALP-forward ALP-reverse DSPP-forward DSPP-reverse OCN-forward OCN-reverse BSP-forward BSP-reverse Runx2-forward Runx2-reverse DKK1-forward DKK1-reverse GSK3-b-forward GSK3-b-reverse b-catenin-forward b-catenin-reverse
Sequence (50 –30 ) TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA GCCACTATGTAGCGGGTTTC ACCTGCGCTAAGAACTGAGG CCACGTCTTCACATTTGGTG AGACTGCGCCTGGTAGTTGT TCACAAGGGAGAAGGGAATG TGCCATTTGCTGTCAGTTT GGCAGCGAGGTAGTGAAGAG CTGGAGAGGAGCAGAACTGG AAAGTGAGAACGGGGAACCT GATGCAAAGCCAGAATGGAT AACCCACGGCCCTCCCTGAACTCT ACTGGCGGGGTGTAGGTAAAGGTG ATAGCACCTTGGATGGGTATTCC CTGATGACCGGAGACAAACAG CACCTCTGGCTACCATCCTTAT ATTATTGGTCTGTCCACGGTCT ATGGAAGGTCTCCTTGGGACTC CTCCACAAATTGCTGCTGTGTC
archives of oral biology 60 (2015) 234–241
significant difference Fisher). A value of P < 0.05 was considered as statistically significant.
3.
Results
3.1. Down-regulated ANCR promoted the proliferation of PDLSCs First we isolated and characterized human PDLSCs which could express mesenchymal stem cell markers (Fig. 1A–D) including CD29, CD90, CD146 and Stro-1; but were negative for hematopoietic cell marker CD34 (Fig. 1E) and leucocyte maker CD45 (Fig. 1F). These cells also showed osteogenic and adipogenic differentiation capacity after induction for 3 weeks in vitro (Fig. 2B and D). qRT-PCR analysis was performed 3 days after infection. Results showed that ANCR was knocked down with statistical significance by ANCR-specific lentivirus-delivered shRNA in the PDLSC/ANCR-RNAi group compared with control groups (PDLSCs/wt and PDLSCs/vector) (Fig. 3A). Cell viability assay was performed to quantify the proliferation level. Results showed that the growth rate of cells from PDLSC/ANCR-RNAi group was increased significantly compared with the control groups (Fig. 3B).
3.2. Down-regulated ANCR promoted the osteogenic differentiation of PDLSCs ALP activity was found significantly increased in PDLSC/ ANCR-RNAi group compared with the control groups from day 12 after induction (Fig. 4A). Alizarin red staining and quantification results indicated that, PDLSC/ANCR-RNAi group formed more mineralized nodules than the control
237
groups after induction (Fig. 4B and C). The mRNA expression of the osteogenic differentiation markers ALP, DSPP, OCN, BSP and Runx2 were analyzed by qRT-PCR. Results showed that the expression level of all these genes was higher in the PDLSC/ANCR-RNAi group after 2 weeks of induction (Fig. 4D). These data suggested that down-regulated ANCR promoted the osteogenic differentiation of PDLSCs.
3.3. ANCR regulated the osteogenic differentiation of PDLSCs through canonical WNT signalling pathway Previous studies have indicated that Runx2 was a target gene of the canonical WNT signalling pathway, that is, stable expression of b-catenin in activated wnt pathway could further activate the expression of Runx2 in bone mesenchymal stem cells (BMSCs).19 Therefore, we analyzed the mRNA expression of DKK1, GSK-3b and b-catenin by qRT-PCR. Results showed that the mRNA expression of GSK-3b was lower while b-catenin was higher in PDLSC/ANCR-RNAi group than in the control group after osteogenic induction. In the mean time, the mRNA expression of DKK1 had no significant change (Fig. 5A). After the inhibition of canonical WNT signalling pathway by XAV-939, the osteogenic differentiation marker genes ALP, DSPP, OCN, BSP and Runx2 were downregulated (Fig. 5D) and there were less mineralized nodules formed in PDLSC/ANCR-RNAi cells compared to the PDLSC/ ANCR-RNAi cells without XAV-939 inhibition (Fig. 5B and C).
4.
Discussion
Potency of osteogenic differentiation is one of the most important characteristics of the pluripotency of oral stem cells. As a result, repair and regeneration of periodontal
Fig. 1 – The characterization of human PDLSCs (Immunophenotype analysis). The cells we isolated could express mesenchymal stem cell markers including CD29 (A), CD90 (B), CD146 (C) and Stro-1 (D); but were negative for hematopoietic cell marker CD34 (E) and leucocyte maker CD45 (F).
238
archives of oral biology 60 (2015) 234–241
Fig. 2 – The characterization of human PDLSCs (osteogenic/adipogenic differentiation assay). These cells also showed osteogenic (B) and adipogenic (D) differentiation capacity after induction for 3 weeks in vitro compared to control groups (A, C).
tissues in tissue engineering project mostly rely on the osteogenic differentiation of PDLSCs. A porcine model study reported that transplanting autologous PDLSCs in swine could regenerate root-periodontal complex which was capable of supporting a porcelain crown as in normal tooth function.5 There was a similar study in histological level revealing that periodontal tissues were regenerated in swine by injecting autologous PDLSCs in vivo.20 The regulatory function of small noncoding RNA and microRNA in the osteogenic differentiation of PDLSCs have been extensively studied in recent years.21–25 Liu et al. discovered that MiR-17 modulated the osteogenic differentiation of PDLSCs through a coherent feed-forward loop in patients with periodontitis.24 Another study showed that
osteogenic tissue-type differentiation in PDLSCs was associated with a decrease in hsa-mir-218 expression.21 There has also been research on lncRNAs and their regulatory functions in cell differentiation. A recent study indicated that terminal differentiation – induced nc-RNA (TINCR) could regulate somatic tissue differentiation.26 Sun et al. reported that MEN e/b lncRNAs exhibited more than two-fold up-regulation upon the differentiation of C2C12 myoblasts into myotubes.27 However, there has been no research on the regulatory functions of lncRNA in the field of osteogenic differentiation of PDLSCs. In our study, we used RNAi to down-regulate ANCR by lentivirus infection of PDLSCs. After 3 weeks of osteogenic induction, cells from PDLSC/ANCR-RNAi group formed more
Fig. 3 – The down-regulation of ANCR promoted PDLSC proliferation. (A) 3 days after lentivirus infection, we evaluated the effects of ANCR-RNAi by qRT-PCR. The results showed that the ANCR expression of PDLSC/ANCR-RNAi cells was remarkably down-regulated, compared with control cells. *P < 0.05. (B) From day 1 to day 7, the cell viability of PDLSC/ANCRRNAi cells was greater than that of the control cells, which indicated that ANCR down-regulation promoted PDLSC proliferation. *P < 0.05.
archives of oral biology 60 (2015) 234–241
239
Fig. 4 – The down-regulation of ANCR promoted PDLSC osteogenic differentiation. (A) ALP activity quantification allowed for a clear view of ALP activity changes in the 3 weeks of induction. ALP activity was found to be significantly increased in PDLSC/ANCR-RNAi cells, compared with control cells, beginning on day 12. *P < 0.05. (B) 3 weeks after induction, the cells were stained with alizarin red (pH = 4.1), and the results showed that PDLSC/ANCR-RNAi cells formed more mineralized nodules than the control groups. (C) To confirm the alizarin red staining results, we performed alizarin red quantification. The results of quantification confirmed that PDLSC/ANCR-RNAi cells formed more mineralized nodules than the control groups. *P < 0.05. (D) The mRNA expressions of ALP, OCN, DSPP, BSP and Runx2 were remarkably up-regulated in PDLSC/ ANCR-RNAi cells compared to control cells after 2 weeks of induction. *P < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
mineralized nodules than the control group. ALP activity quantification also showed the same tendency. Then, we compared the mRNA expression of ALP, DSPP, OCN, BSP and Runx2. Expressions of all these genes were increased in experimental group after 2 weeks induction which was in accordance with previous studies.14,15 Our research further confirmed that ANCR was an anti-differentiation RNA and its down-regulation would promote the osteogenic differentiation potency of PDLSCs. Previous studies have indicated that activation of canonical WNT signalling pathway could promote osteogenic differentiation of mesenchymal stem cells.28 Runx2 was a target gene of the canonical WNT signalling pathway, and stable expression of b-catenin could further activate the expression of Runx2 in BMSCs.19 Therefore, we speculated that down-regulation of ANCR would activate the canonical WNT signalling pathway. In our study, we analyzed the mRNA expression of DKK1, GSK-3b and bcatenin. qRT-PCR results showed that the mRNA expression of DKK1 had no significant change after the inhibition of ANCR. However, the mRNA expression of GSK3b was down-regulated while that of b-catenin was up-regulated after down-regulating ANCR. These results indicated that the influence on canonical WNT pathway of down-regulating ANCR was started from the b-catenin degradation compounds which was represented with GSK3b in cytoplasm instead of DKK1 on
the cell membrane. Previous research reported that the downregulation of GSK3-b would immediately stop the degradation of b-catenin and promote the nuclear translocation of bcatenin.29 Scholars also have considered that the nuclear translocation of b-catenin could increase the Runx2 receptor activity.19,30,31 Our study showed that after down-regulating ANCR, the gene expression of Runx2 was more significantly up-regulated in PDLSCs after osteogenic induction compared with control groups. So we infer that after down-regulating ANCR, the expression level of GSK3b is supressed which further led to the activation of b-catenin and the activation of b-catenin activates Runx2 which finally results in the promotion of osteogenic differentiation of PDLSCs. To confirm our result, we use XAV-939 to inhibit the canonical WNT signalling pathway of PDLSC/ANCR-RNAi cells during the osteogenic induction. The qRT-PCR and Alizarin red staining results showed that after the inhibition of canonical WNT signalling pathway the osteogenic differentiation marker genes were down-regulated and there were less mineralized nodules formed. In summary, these findings demonstrated that canonical WNT signalling pathway was activated for ANCR-RNAi on PDLSCs during the procedure of osteogenic induction. Our result also showed that down-regulated ANCR promote the proliferation of PDLSCs. We infer that it is also related to
240
archives of oral biology 60 (2015) 234–241
Fig. 5 – ANCR regulated PDLSC osteogenic differentiation by activating the canonical WNT signalling pathway. (A) The result showed that the mRNA expression of DKK1 have no significant change in PDLSC/ANCR-RNAi cells compared to control cells after 2 weeks of induction. However, the mRNA expression of GSK3-b was down-regulated and the mRNA expression of b-catenin was remarkably up-regulated in PDLSC/ANCR-RNAi cells compared to control cells after 2 weeks of induction. *P < 0.05. (B) 3 weeks after induction, the cells were stained with alizarin red (pH = 4.1), and the results showed that PDLSC/ ANCR-RNAi cells treated with XAV-939 formed less mineralized nodules than the control group. (C) The results of quantification confirmed that PDLSC/ANCR-RNAi cells treated with XAV-939 formed less mineralized nodules than the control group. *P < 0.05. (D) The mRNA expressions of ALP, DSPP, BSP and Runx2 were down-regulated in PDLSC/ANCRRNAi cells treated with XAV-939 compared to control cells after 2 weeks of induction. However, the expression of OCN had no significant change. *P < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the activation of canonical WNT pathway. Previous researches reported that after the activation of canonical WNT pathway, b-catenin translocated to the nuclear and activated T cell factor/lymphoid enhancer factor (TCF/LEF) promoter. Constitutive activation of downstream target genes, such as c-myc and cyclin D1 by the TCF/LEF-b-catenin complex will promote the proliferation of cells.32–34 We also found out that down-regulated ANCR could promote not only the osteogenic differentiation but also the adipocyte differentiation (unpublished data) of PDLSC which may infer that ANCR is a very important regulator in the differentiation of PDLSC. In the future study, we will deeper focus on the interrelationship between ANCR and canonical WNT signalling pathway. How ANCR interact with canonical WNT signalling pathway? What is the regulatory protein between them? There are many questions needed to be answered. In summary, our study showed that down-regulation of ANCR would promote the proliferation of PDLSCs. Furthermore, the osteogenic differentiation of PDLSCs could also be up regulated through activating canonical wnt signalling pathway when ANCR was down regulated. These findings suggest that ANCR is a critical important regulator of PDLSC by means of proliferation and osteogenic differentiation. PDLSCs
treated with ANCR-RNAi could be used for periodontal tissue engineering and osteogenic tissue regeneration.
Funding This study was supported by grants from the National Natural Science Foundation of China (Nos. 81170946, 81371139) and National Key Technologies R&D Program of the twelve-five Year Plan, the Ministry of Science and Technology of China (2012BAI07B03).
Conflict of interest The authors deny any conflicts of interests.
Ethical approval The ethics committee of the Fourth Military Medical University School of Stomatology approved the experimental protocols (permission number IRB-REV-2012-017).
archives of oral biology 60 (2015) 234–241
references 18. 1. Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004;364(9249):149–55. 2. Hiraga T, Ninomiya T, Hosoya A, Takahashi M, Nakamura H. Formation of bone-like osteogenic matrix by periodontal ligament cells in vivo: a morphological study in rats. J Bone Miner Metab 2009;27(2):149–57. 3. Huang GT, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs those from other sources: their biology and role in regenerative medicine. J Dent Res 2009;88(9):792–806. 4. Kato T, Hattori K, Deguchi T, Katsube Y, Matsumoto T, Ohgushi H, et al. Osteogenic potential of rat stromal cells derived from periodontal ligament. J Tissue Eng Regen Med 2011;5(10):798–805. 5. Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, et al. Mesenchymal stem cell-mediated functional tooth regeneration in Swine. PLOS ONE 2006;1:e79. 6. Liao Q, Liu C, Yuan X, Kang S, Miao R, Xiao H, et al. Large scale prediction of long non-coding RNA functions in a coding–non-coding gene co-expression network. Nucleic Acids Res 2011;39:3864–78. 7. Huo JS, Zambidis ET. Pivots of pluripotency: the roles of noncoding RNA in regulating embryonic and induced pluripotent stem cells. Biochim Biophys Acta 2013;1830(2):2385–94. 8. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The transcriptional landscape of the mammalian genome. Science 2005;309:1559–63. 9. Jia H, Osak M, Bogu GK, Stanton LW, Johnson R, Lipovich L. Genome-wide computational identification and manual annotation of human long noncoding RNA genes. RNA 2010;16:478–87. 10. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, et al. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 2009;458:223–7. 11. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci 2009;106:11667–72. 12. Sheik Mohamed J, Gaughwin PM, Lim B, Robson P, Lipovich L. Conserved long noncoding RNAs transcriptionally regulated by Oct4 and Nanog modulate pluripotency in mouse embryonic stem cells. RNA 2010;16:324–37. 13. Ng S-Y, Johnson R, Stanton LW. Human long non-coding RNAs promote pluripotency and neuronal differentiation by association with chromatin modifiers and transcription factors. EMBO J 2012;31:522–33. 14. Kretz M, Webster DE, Flockhart RJ, Lee CS, Zehnder A, Lopez-Pajares V, et al. Suppression of progenitor differentiation requires the long noncoding RNA ANCR. Genes Dev 2012;26:338–43. 15. Zhu L, Xu PC. Downregulated LncRNA-ANCR promotes osteoblast differentiation by targeting EZH2 and regulating Runx2 expression. Biochem Biophys Res Commun 2013;432:612–7. 16. Gronthos S, Mrozik K, Shi S, Bartold PM. Ovine periodontal ligament stem cells: isolation, characterization, and differentiation potential. Calcif Tissue Int 2006;79:310–7. 17. Osathanon T, Nowwarote N, Pavasant P. Basic fibroblast growth factor inhibits osteogenic differentiation but induces neuronal differentiation by human dental pulp
19.
20.
21.
22.
23.
24.
25.
26.
27.
28. 29.
30.
31.
32.
33.
34.
241
stem cells through a FGFR and PLCg signaling pathway. Cell Biochem 2011;112(7):1807–16. Ma Q, Guin S, Padhye SS, Zhou YQ, Zhang RW, Wang MH. Ribosomal protein S6 kinase (RSK)-2 as a central effector molecule in RON receptor tyrosine kinase mediated epithelial to mesenchymal transition induced by macrophage-stimulating protein. Mol Cancer 2011;28(10):66. Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical wnt signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280(39):33132–40. Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, et al. Periodontal ligament stem cell mediated treatment for periodontitis in Miniature Swine. Stem Cells 2008;26:1065–73. Gay I, Cavender A, Peto D, Sun Z, Speer A, Cao H, et al. Differentiation of human dental stem cells reveals a role for microRNA-218. J Periodontal Res 2014;49(1):110–20. Liu W, Liu Y, Guo T, Hu C, Luo H, Zhang L, et al. A novel positive regulator of osteogenesis, plays a crucial role in miR17 modulating the diverse effect of canonical Wnt signaling in different microenvironments. Cell Death Dis 2013;4:e539. Ng TK, Carballosa CM, Pelaez D, Wong HK, Choy KW, Pang CP, et al. Nicotine alters MicroRNA expression and hinders human adult stem cell regenerative potential. Stem Cells Dev 2013;22(5):781–90. Liu Y, Liu W, Hu C, Xue Z, Wang G, Ding B, et al. MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis. Stem Cells 2011;29(11):1804–16. Zhou Q, Zhao ZN, Cheng JT, Zhang B, Xu J, Huang F, et al. Ibandronate promotes osteogenic differentiation of periodontal ligament stem cells by regulating the expression of microRNAs. Biochem Biophys Res Commun 2011;404(1):127–32. Kretz M, Siprashvili Z, Chu C, Webster DE, Zehnder A, Qu K, et al. Control of somatic tissue differentiation by the long non-coding RNA TINCR. Nature 2013;493(7431):231–5. Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL. MEN epsilon/beta nuclear-retained non-coding RNAs are up-regulated upon muscle differentiation and are essential components of paraspeckles. Genome Res 2009;19:347–59. Ling L, Nurcombe V, Cool SM. Wnt signaling controls the fate of mesenchymal stem cells. Gene 2009;433(1–2):1–7. Davidson G, Wu W, Shen J, Bilic J, Fenger U, Stannek P, et al. Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal transduction. Nature 2005;438(7069):867–72. Rodrı´guez-Carballo E, Ulsamer A, Susperregui AR, Manzanares-Ce´spedes C, Sa´nchez-Garcı´a E, Bartrons R, et al. Conserved regulatory motifs in osteogenic gene promoters integrate cooperative effects of canonical Wnt and BMP pathways. J Bone Miner Res 2011;26(4):718–29. Cho YD, Kim WJ, Yoon WJ, Woo KM, Baek JH, Lee G, et al. Wnt3a stimulates Mepe, matrix extracellular phosphoglycoprotein, expression directly by the activation of the canonical Wnt signaling pathway and indirectly through the stimulation of autocrine Bmp-2 expression. J Cell Physiol 2012;227(6):2287–96. Takemaru KI, Moon RT. The transcriptional coactivator CBP interacts with beta-catenin to activate gene expression. J Cell Biol 2000;149(2):249–54. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12. Hecht A, Litterst CM, Huber O, Kemler R. Functional characterization of multiple transactivating elements in bcatenin, some of which interact with the TATA-binding protein in vitro. J Biol Chem 1999;25:18017–21802.
