nanomaterials Article

DNA Sequencing by Hexagonal Boron Nitride Nanopore: A Computational Study Liuyang Zhang and Xianqiao Wang * College of Engineering, University of Georgia, Athens, GA 30602, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-706-5426251 Academic Editor: Thomas Nann Received: 2 May 2016; Accepted: 31 May 2016; Published: 6 June 2016

Abstract: The single molecule detection associated with DNA sequencing has motivated intensive efforts to identify single DNA bases. However, little research has been reported utilizing single-layer hexagonal boron nitride (hBN) for DNA sequencing. Here we employ molecular dynamics simulations to explore pathways for single-strand DNA (ssDNA) sequencing by nanopore on the hBN sheet. We first investigate the adhesive strength between nucleobases and the hBN sheet, which provides the foundation for the hBN-base interaction and nanopore sequencing mechanism. Simulation results show that the purine base has a more remarkable energy profile and affinity than the pyrimidine base on the hBN sheet. The threading of ssDNA through the hBN nanopore can be clearly identified due to their different energy profiles and conformations with circular nanopores on the hBN sheet. The sequencing process is orientation dependent when the shape of the hBN nanopore deviates from the circle. Our results open up a promising avenue to explore the capability of DNA sequencing by hBN nanopore. Keywords: molecular dynamics simulation; hexagonal boron nitride; ssDNA sequencing

1. Introduction DNA sequencing has been the focus of many researchers for several decades [1–4]. The recent development of entirely new strategies for DNA sequencing has reinvigorated this field. The fundamental idea is to simultaneously thread single-stranded DNA through the nanopore and detect the sequence-dependent ionic currents through the pore. DNA translocation through nanopores could cause a sudden drop in the ionic current due to the DNA occupation of the nanopores [5–7]. Such a DNA sequencing approach with nanopores provides a promising technology for fast DNA sequencing free of fluorescent labeling steps [8]. One major challenge faced by the nanopore-based sequencing is to achieve a high spatial resolution in order to distinguish the types of DNA bases, which requires the thickness of the nanopore to be comparable with the stacking distance of the DNA base pair. Graphene, as a two-dimensional material, has been extensively studied both experimentally and theoretically due to its extraordinary mechanical, optical and electronic properties in recent years [9–14]. It has been demonstrated that nanopores fabricated from graphene sheets can be made extremely thin and structurally robust to allow the identification of single nucleotides, which opens a new chapter in DNA sequencing [15–21]. However the graphene-based nanopore suffers from significant signal noises. The reason is that graphene is highly hydrophobic and very sticky to the DNA strand, therefore trapping DNA bases during its translocation. This trap contributes to a high noise level for sequencing [15]. Hexagonal boron nitride (hBN), another type of two-dimensional material, has become a hot topic of research thanks to its structural equivalency to graphene and its outstanding mechanical [22], thermodynamic [23], and electronic properties [24]. Hexagonal boron nitride (hBN) is an atomic lattice Nanomaterials 2016, 6, 111; doi:10.3390/nano6060111

www.mdpi.com/journal/nanomaterials

Nanomaterials 2016, 6, 111

2 of 11

structure similar to graphene, but composed of the heterogeneous atoms boron and nitrogen in place of Nanomaterials 2016, 6, 111 2 of 11 carbon. hBN is less hydrophobic than graphene which can minimize the hydrophobic interaction that impedes thestructure DNA translocation throughbut thecomposed constructed nanopores. Moreover, the thickness of hBN is lattice similar to graphene, of the heterogeneous atoms boron and nitrogen comparable spacing nucleotides in graphene (single-strand ssDNAthe (0.32–0.52 nm) [25]. in place to of the carbon. hBN between is less hydrophobic than whichDNA) can minimize hydrophobic thatadvantages impedes theover DNAgraphene translocation through theinsulating constructed nanopores. Moreover, the It alsointeraction shows other in terms of its property in high-ionic-strength thickness of hBN is comparable to thethe spacing between nucleotides in (single-strand DNA)properties ssDNA of solution and fewer defects made during manufacturing process [26]. The fundamental (0.32–0.52 nm) [25]. It also shows other advantages over graphene in terms of its insulating property DNA nucleobases and hBN sheets remain unchanged upon adsorption, which suggests its promising in high-ionic-strength solution and fewer defects made during the manufacturing process [26]. The application for DNA research [27]. The ultrathin hBN nanopores provide substantial opportunities in fundamental properties of DNA nucleobases and hBN sheets remain unchanged upon adsorption, realizing high-spatial-sensitivity nanopore devices for various applications [26]. All above-mentioned which suggests its promising application for DNA research [27]. The ultrathin hBN nanopores properties suggest hBN to be a promising candidate for nanopore devices. However, the investigation provide substantial opportunities in realizing high-spatial-sensitivity nanopore devices for various of DNA sequencing two-dimensional is still suggest lacking hBN and is of exploration. applications [26].by All above-mentionedhBN properties toworthy be a promising candidate for To further evaluate the mechanism of hBN nanopores for DNA sequencing, herehBN we isreport nanopore devices. However, the investigation of DNA sequencing by two-dimensional still the studylacking of ssDNA translocation through hBN nanopores using large-scale molecular dynamics (MD) and is worthy of exploration. To further the mechanism of hBN for DNA sequencing, here weinvestigate report the the simulations which evaluate can provide atomic details ofnanopores the transport process [28]. We also study of ssDNAbetween translocation through hBN nanopores using large-scale (MD) of binding interaction the DNA base and hBN sheet as well as themolecular influencedynamics of the geometry simulations which can provide atomic details of the transport process [28]. We also investigate the base the nanopore on the sequencing outcome. Elucidating the interaction between hBN and the DNA binding interaction between the DNA base and hBN sheet as well as the influence of the geometry of is crucial for the design of next-generation hBN pore–based DNA sequencing devices. the nanopore on the sequencing outcome. Elucidating the interaction between hBN and the DNA base is and crucial for the design of next-generation hBN pore–based DNA sequencing devices. 2. Results Discussions

2. Results and Discussions The simulation system consists of the hBN sheet with a nanopore of specific geometry and a ssDNAThe molecule. Initially, the hBN is sheet placed in athe x-y plane with geometry the center ofamass simulation system consists of sheet the hBN with nanopore of specific and at thessDNA Cartesian coordinate origin (0,0,0). A circular nanopore is constructed by deleting molecule. Initially, the hBN sheet is placed in the x-y plane with the center of mass at the the 2 < R2 , where R is the radius of the BN nanopore atomsCartesian with their coordinates x2 + ynanopore coordinate origin satisfying (0,0,0). A circular is constructed by deleting the atoms with 2 2 2 coordinates satisfying x +the y geometric < R , where effect R is the of the BN = 0.5 nm). In the (R = their 0.5 nm). In order to study ofradius nanopores, an nanopore elliptical (R nanopore with order to study the geometric effect of nanopores, an elliptical nanopore with the same area as the same area as the circular nanopore is also constructed. A model ssDNA molecule with the sequence circular nanopore is also constructed. A model ssDNA molecule with before the sequence AACCTTGGAACCTTGGAACCTTGG is introduced and energetically minimized sequencing. AACCTTGGAACCTTGGAACCTTGG is introduced and energetically minimized before The intentional ssDNA sequence with a repeated unit is to make sure the interaction energy profile sequencing. The intentional ssDNA sequence with a repeated unit is to make sure the interaction is consistent for the same type of nucleotide. We can also use the other sequence with a random energy profile is consistent for the same type of nucleotide. We can also use the other sequence with permutation or order; however, the sequence order will not affect the results. As shown in Figure 1, a random permutation or order; however, the sequence order will not affect the results. As shown in the ssDNA molecule is initially close to the nanopore. Figure 1, the ssDNA moleculeplaced is initially placed close to the nanopore. A G G T T C V

C A A

Figure 1. Scheme of single-strand DNA (ssDNA) sequencing with hexagonal boron nitride (hBN)

Figure 1. Scheme of single-strand DNA (ssDNA) sequencing with hexagonal boron nitride (hBN) nanopore. The ssDNA is placed right above the hBN nanopore and perpendicular to the hBN sheet. nanopore. The ssDNA is placed right above the hBN nanopore and perpendicular to the hBN sheet. The red, orange, pink and grey areas represent the adenine (A), thymine (T), cytosine (C) and The red, orange, pink and grey areas represent the adenine (A), thymine (T), cytosine (C) and guanine guanine (G) nucleotides separately. (G) nucleotides separately.

Nanomaterials 2016, 6, 111

3 of 11

Nanomaterials 2016, 6, 111

3 of 11

2.1. Interaction between Nucleobases and hBN Sheet

2.1. Interaction Nucleobases hBNcalculations, Sheet From density between functional theoryand (DFT) it has been revealed that the hBN possessed high sensitivity for the nucleobases has good potential in DNA detection biosensors [29,30]. From density functional theoryand (DFT) calculations, it has been revealed that the hBN possessed high sensitivity for the nucleobases and has good potential in DNA detection biosensors [29,30]. The The interfacial interaction between the single nucleobase and hBN sheet lays a critical foundation interfacial between thethe single nucleobase andon hBN sheet lays a critical the for the ssDNAinteraction sequencing. Here binding energy the interface of thefoundation hBN andfor ssDNA is ssDNA sequencing. Here the binding energy on the interface of the hBN and ssDNA is characterized characterized to distinguish different types of nucleobases. Each type of nucleobase is initially placed distinguish different types of nucleobases. Each type of nucleobase is initially placed above the abovetothe circular hBN sheet (diameter 8 nm) within the cutoff distance. Subsequently it adsorbs onto circular hBN sheet (diameter 8 nm) within the cutoff distance. Subsequently it adsorbs onto the hBN the hBN sheet due to the strong attraction force between them. For each type of nucleobase, different sheet due to the strong attraction force between them. For each type of nucleobase, different initial initialconditions conditions are studied to ensure that the calculated interfacial energy does not depend on the are studied to ensure that the calculated interfacial energy does not depend on the initial initialconformations. conformations. If the simulation were enough, all states the states of interface the interface If the simulation timetime were longlong enough, all the of the couldcould be be explored. The magnitude of the intermolecular interaction energy provides a direct measure explored. The magnitude of the intermolecular interaction energy provides a direct measure of theof the strength of the interfacial energy the nucleobase nucleobase and hBN sheet, as shown in Figure 2. strength of the interfacial energybetween between the and thethe hBN sheet, as shown in Figure 2. It seen that nucleotideGGexhibits exhibits the the strongest strongest binding ofof −55.5 kcal/mol with with the the It cancan be be seen that nucleotide bindinginteraction interaction ´55.5 kcal/mol hBN sheet compared to nucleotide A (−52.7kcal/mol), kcal/mol), nucleotide kcal/mol) and and nucleotide hBN sheet compared to nucleotide A (´52.7 nucleotideCC(−45.8 (´45.8 kcal/mol) nucleotide T (−41.2 kcal/mol), which can be attributed to different side groups of nucleobases. The initial and and T (´41.2 kcal/mol), which can be attributed to different side groups of nucleobases. The initial final configurations of nucleotide A are documented in Figure 2. Nucleotide A orientates its final configurations of nucleotide A are documented in Figure 2. Nucleotide A orientates its aromatic aromatic ring plane to align to the surface of the hBN sheet, and then moves closer to achieve a low ring plane to align to the surface of the hBN sheet, and then moves closer to achieve a low potential potential energy status. All nucleobases exhibit the same stacking arrangement on the hBN sheet energy All nucleobases the(N same stacking arrangement on thetohBN sheet duestatus. to the polarization effect:exhibit the anions and O atoms) of nucleobases prefer stay on top due of theto the polarization effect: the anions (N and O atoms) of nucleobases prefer to stay on top of the cations cations (B) of the BN sheet as far as possible, regardless of the biological properties of nucleobases (B) of the[27]. BN sheet as far as possible, regardless of the biological properties of nucleobases [27].

Binding Energy (kcal/mol)

0

-10

a

-20

b

A C G T

-30

-40

-50

-60 0

5

10

15

20 25 30 Time (ps)

35

40

45

Figure 2. Evolution of binding energy between hBN and four basic nucleotides.

Figure 2. Evolution of binding energy between hBN and four basic nucleotides.

For comparison, Figure 3 shows the interfacial energy profile between the nucleobase and a

For comparison, Figure G 3 exhibits shows the interfacial energy ofprofile the the nucleobase graphene sheet. Nucleotide the strongest interaction −33.28 between kcal/mol with graphene and a graphene sheet. Nucleotide G exhibits thekcal/mol), strongestnucleotide interactionC of ´33.28 kcal/mol the graphene sheet compared to nucleotide A (−30.32 (−28.16 kcal/mol) andwith nucleotide T kcal/mol). The magnitudes of thekcal/mol), interaction nucleotide energies of the nucleobases with graphene are sheet(−27.9 compared to nucleotide A (´30.32 C (´28.16 kcal/mol) and nucleotide similar to those The found with single-walled carbon nanotubes By isothermal titration T (´27.9 kcal/mol). magnitudes of the interaction energies [31–34]. of the nucleobases with graphene calorimetry [35], the relative interaction energies of the nucleobases with graphene have been found are similar to those found with single-walled carbon nanotubes [31–34]. By isothermal titration to decrease in the order G > A > C~T in aqueous solution. Our simulations observe the same trend calorimetry [35], the relative interaction energies of the nucleobases with graphene have been found that the graphene sheet shows while the strength between them is significantly high [31,32,36,37]. to decrease in the order G > A > C~T in aqueous solution. Our simulations observe the same trend Compared with the hBN sheet, the binding interaction between the graphene and nucleobase are that the graphene sheet shows while the strength between them is significantly high [31,32,36,37]. only from the van der Waals (vdW) interaction. Except for the van der Waals interaction between the Compared with the hBN sheet, bindinginteraction interaction between thefor graphene and interaction. nucleobase are hBN sheet and nucleobase, the the electrostatic is also involved the interfacial only from the van der Waals (vdW)with interaction. Except for the van der Waals C–C interaction between Graphene is a gapless semimetal the nonpolar nature of the homonuclear bond, while the the hBN BN sheet andis nucleobase, the electrostatic involved the interfacial interaction. sheet an insulator with a polar natureinteraction underlying is thealso charge transferfor between its constituent B Graphene is a gapless semimetal with the nonpolar nature of the homonuclear C–C bond, while the BN sheet is an insulator with a polar nature underlying the charge transfer between its constituent

Nanomaterials 2016, 6, 111

4 of 11

Nanomaterials 2016, 6, 111

4 of 11

B andand N atoms [30]. between B and N results a combination of Nanomaterials 2016, 6,The 111 4 of of 11 N atoms [30]. Thedifference difference in in electronegativity electronegativity between B and N results in ain combination weakweak ionicionic and and covalent bonding that is quite distinct from neutral graphene sheets [38,39]. covalent bonding that is quite distinct from neutral graphene sheets [38,39]. and N atoms [30]. The difference in electronegativity between B and N results in a combination of weak ionic and covalent 0bonding that is quite distinct from neutral graphene sheets [38,39]. A C G A T C

Binding (kcal/mol) Binding EnergyEnergy (kcal/mol)

0 -5 -5 -10

G T

-10 -15 -15 -20 -20 -25 -25 -30 -30 -35 0

10

20

30

40

50

Time (ps)

-35 0

10 30 50 Figure 3. Evolution of binding energy20 between graphene and 40 four basic nucleotides.

Time (ps) Figure 3. Evolution of binding energy between graphene and four basic nucleotides.

Figure 3. Evolution of binding energy betweenrole graphene four basicinteraction nucleotides.between the The electrostatic interaction plays an important in theand interfacial

The electrostatic interaction role electrostatic in the interfacial interaction between the BN BN sheet and nucleobase, as plays shownaninimportant Figure 4. The interaction contributes to the electrostatic interaction plays an the interfacial interaction between the interaction theFigure nucleobases A, C,role G, Tinand hBN whichcontributes are −21.2 kcal/mol, −15.8 sheetinterfacial andThe nucleobase, as between shown in 4. important Theofelectrostatic interaction to the interfacial BN sheet and nucleobase, as −12.1 shown 4. The interaction tokcal/mol, the kcal/mol, −20.5 kcal/mol, and respectively. Besides, thecontributes interfacial energy interaction between the nucleobases ofkcal/mol, A,inC,Figure G, T and hBNelectrostatic which arebased ´21.2onkcal/mol, ´15.8 interfacial interaction between the nucleobases ofpresents A, C, G, higher T and hBN which are −21.2 kcal/mol, −15.8 profile of nucleotide C and T, the hBN sheet sensitivity to the nucleobase than ´20.5 kcal/mol, and ´12.1 kcal/mol, respectively. Besides, based on the interfacial energy profile of kcal/mol, −20.5 kcal/mol, and −12.1 kcal/mol, respectively. based on the interfacial energy graphene and T, could better differentiate thehigher nucleotides C Besides, andto T.the The difference ofthan the graphene interfacial nucleotide C and the hBN sheet presents sensitivity nucleobase and profile of nucleotide C and T, the hBN sheet presents higher sensitivity to the nucleobase than interaction between the hBN sheet and the nucleobase could distinguish nucleotides A, T, C, G from couldgraphene better differentiate the nucleotides C and T. The difference of the interfacial interaction between and could better differentiate themeasurement nucleotides C and T. The of the interfacial one another and acts as a scalable powerful parameter for difference ssDNA sequencing. the hBN sheet and the nucleobase could nucleotides A, T, C,nucleotides G from one and acts interaction between the hBN sheet and distinguish the nucleobase could distinguish A, another T, C, G from as a scalable powerful measurement parameter for ssDNAparameter sequencing. one another and acts as a0scalable powerful measurement for ssDNA sequencing.

Binding Energy (kcal/mol) Binding Energy (kcal/mol)

0 -10 -10 -20 -20 -30 -30 -40 -40 -50 -50 -60

Electrostatic vdW

A

C

G

T Electrostatic vdW

-60 of van der Waals (vdW) and electrostatic interaction in the binding energy Figure 4. Contribution A C G T between hBN and four basic nucleotides. Figure 4. Contribution of van der Waals (vdW) and electrostatic interaction in the binding energy Figure 4. Contribution of van der Waals (vdW) and electrostatic interaction in the binding energy betweenAligning hBN and four basic nucleotides. 2.2. ssDNA

between hBN and four basic nucleotides. The aligning and sequencing process of ssDNA translocation through the circular BN nanopore 2.2. ssDNA Aligning is shown in Figure 5. After energy minimization, the ssDNA forms a cluster structure due to the 2.2. ssDNA Aligning The aligning and sequencing ssDNA translocation throughthe thenucleobases circular BN nanopore hydrogen bonding, e.g., A-T, C-G,process which of makes it difficult to uncouple from one is shown in Figure 5. After energy minimization, the ssDNA forms a cluster structure due to the The aligning process of ssDNA the circular BNto nanopore another. Also,and the sequencing ssDNA cluster is easy to stick translocation to the surfacethrough of the hBN sheet due the hydrogen bonding, e.g., A-T, C-G,minimization, which makes it the difficult to uncouple nucleobases from oneto the is shown in Figure 5. After energy ssDNA forms a the cluster structure due another. Also, the ssDNA clusterwhich is easy to stick to the surface of the the hBNnucleobases sheet due tofrom the one hydrogen bonding, e.g., A-T, C-G, makes it difficult to uncouple

another. Also, the ssDNA cluster is easy to stick to the surface of the hBN sheet due to the appreciable

Nanomaterials 2016, 6, 111 Nanomaterials 2016, 6, 111

5 of 11 5 of 11

appreciable van derelectrostatic Waals and electrostatic interfacial interactions. The phenomenon sticking phenomenon causes van der Waals and interfacial interactions. The sticking causes the low the low accuracy of detecting different nucleobases. the aligning process of ssDNA is critical to accuracy of detecting different nucleobases. Thus, Thus, the aligning process of ssDNA is critical to the the sequencing and increases the detection accuracy of the nucleobase. It is unavoidable and sequencing and increases the detection accuracy of the nucleobase. It is unavoidable and extremely extremelytonecessary to separate eachbefore nucleobase passing through In theour nanopore. In our necessary separate each nucleobase passingbefore through the nanopore. simulations, one simulations, the one end of ssDNA is selected and outcluster from the ssDNAin nucleotide onone the nucleotide one end of on ssDNA is selected and pulled out from thepulled ssDNA as shown cluster5a–d. as shown in Figure 5a–d. Toprocess clarify the aligning process nucleobases before passing BN Figure To clarify the aligning of nucleobases beforeofpassing the BN nanopore, thethe radius radius of gyration Rg ofisall atoms of as ssDNA is calculated as [40,41], ofnanopore, gyration the Rg of all atoms of ssDNA calculated [40,41],

c 2 1 ÿ 2 2 1 ∑ |𝑟2 =√ − r𝑟com 22 | R𝑅gg “ |r𝑖i ´ com | 𝑛n

(1)(1)

wherennisisthe thenumber numberof ofatoms, atoms,rri i is is the the position position of of the the center center of of mass mass of of the the ith atom atom and where and rrcom the comisisthe positionofofthe thecenter centerofofmass massofofthe thessDNA. ssDNA.AtAtthe thebeginning, beginning,with with the minimum value 14.04Å, position the minimum value ofof RgR=g =14.04 Å , ssDNA the ssDNA a stable state. The increase of Rg indicates that thecluster ssDNA cluster is the keepskeeps a stable clustercluster state. The increase of Rg indicates that the ssDNA is uncoupled uncoupled and is thealigned ssDNAinto is aligned into a thread-like structure. The g with a large valueÅ ofindicates 55.68 Å and the ssDNA a thread-like structure. The Rg with aR large value of 55.68 indicates that the ssDNA reaches a sparse distribution, seen here as a thread-like distribution. Theis that the ssDNA reaches a sparse distribution, seen here as a thread-like distribution. The nucleobase nucleobase is uniformly distributed along the thread-like structure. uniformly distributed along the thread-like structure.

a

e

b

f

c

g

d

h

60 i

d

55 50 45

g

R (Å)

40

c

35 30 25 b

20 a

15 10 0

5

10

15

20 Time (ps)

25

30

35

Figure of ssDNA ssDNA before before passing passing through throughthe thehBN hBNnanopore nanopore Figure5.5.Conformation Conformation of of stretching stretching process process of (a–d); Evolution of real-time process of passing-through the hBN nanopore (e–h); Evolution of real-time (a–d); Evolution of real-time process of passing-through the hBN nanopore (e–h); Evolution of radius of gyration (i). real-time radius of gyration (i).

2.3. 2.3.ssDNA ssDNASequencing Sequencing With first nucleotide nucleotideisischosen chosento topull pullthrough through Withthe thethread-like thread-likessDNA, ssDNA, the the center center of mass of the first the The hBN hBN nanopore nanopore with with aa diameter diameter~1 ~1nm nm thehBN hBNnanopore nanopore at ataaconstant constant velocity velocity of of 0.1 0.1 Å/ps. Å /ps. The corresponds to the optimal spatial resolution by geometry-mapping curves from another

Nanomaterials 2016, 6, 111

6 of 11

Nanomaterials 2016, 6, 111

6 of 11

correspondswork to the[26]. optimal spatial resolution geometry-mapping from obtained another researcher’s researcher’s It also agrees with theby geometric diameter ofcurves nanopores from TEM work [26]. It also agrees with the geometric diameter of nanopores obtained from TEM characterization of the pore by considering the stern layer or immobilized hydrates’ characterization layer thickness of the the stern layer immobilized thickness through on the pore on the pore pore by andconsidering solution interface [42]. Theorbasic nucleotidehydrates’ is foundlayer to translocate the and solution interface [42]. The basic nucleotide is found to translocate through the nanopore in nanopore in a similar way with the translocation process exhibiting a base-by-base ratcheting a similar way with the translocation process exhibiting a base-by-base ratcheting fashion [43] that fashion [43] that could significantly slow down the ssDNA translocation and extends the DNA could significantly slow down the ssDNA translocation and the extends the DNA detection five time.times In order detection time. In order to increase the detection accuracy, simulation is repeated for to increase the detection accuracy, the simulation is repeated five times for each simulation system. each simulation system. has been been demonstrated demonstrated that that the the shape shape of of nanopores nanopores in in graphene graphene plays plays aa vital vital role role in in the the ItIt has accuracy of DNA sequencing [44]. To investigate the effect of nanopore geometry in the hBN sheet accuracy of DNA sequencing [44]. To investigate the effect of nanopore geometry in the hBN sheet on sequencing, sequencing, circular circular and and elliptical ellipticalnanopores nanoporeswith withsame samearea areaare areconstructed constructedon onthe theBN BNsheet, sheet, on respectively, as as shown shown in in Figure Figure 6. 6. respectively,

a

b

Figure Figure 6. 6. Hexagonal Hexagonalboron boronnitride nitride(hBN) (hBN) nanopores nanopores of of different different geometries geometries and and illustration illustration of of nucleotides nucleotidespassing passing through through the the nanopore: nanopore: (a) (a) circular circular nanopore; nanopore; (b) (b) elliptical elliptical nanopore. nanopore.

Figures 7 and 8 depict the profile of interaction energy when the ssDNA threads the circular Figures 7 and 8 depict the profile of interaction energy when the ssDNA threads the circular and and elliptical nanopores, respectively. As shown in Figure 7, the magnitudes in the ssDNA elliptical nanopores, respectively. As shown in Figure 7, the magnitudes in the ssDNA translocation translocation through the nanopores imply that each nucleobase threading the BN nanopore can be through the nanopores imply that each nucleobase threading the BN nanopore can be read off from the read off from the profile of interaction energy directly. Each nucleotide threading the nanopore profile of interaction energy directly. Each nucleotide threading the nanopore undergoes a significant undergoes a significant conformational change that explains the change of the magnitude of conformational change that explains the change of the magnitude of interaction energy when the interaction energy when the nucleobase passes through the nanopore. With the circular hBN nucleobase passes through the nanopore. With the circular hBN nanopore, the characteristic magnitude nanopore, the characteristic magnitude peaks for the two pyrimidine bases (C and T) are lower than peaks for the two pyrimidine bases (C and T) are lower than those of the purine bases (A and G). those of the purine bases (A and G). The different components of nucleobases make the volume of The different components of nucleobases make the volume of the purine bases larger than that of the purine bases larger than that of pyrimidine bases and lead to the difference in the characteristic pyrimidine bases and lead to the difference in the characteristic peaks of binding energy when the peaks of binding energy when the ssDNA passes through the nanopore [44]. The binding energy ssDNA passes through the nanopore [44]. The binding energy peak values averaged over the same peak values averaged over the same nucleotides from 10 simulations are calculated and are shown nucleotides from 10 simulations are calculated and are shown in Figure 7. The magnitude peaks of in Figure 7. The magnitude peaks of interaction energy of nucleotides A, T, C, and G are 25.5 interaction energy of nucleotides A, T, C, and G are 25.5 kcal/mol, 20 kcal/mol, 20.5 kcal/mol, and kcal/mol, 20 kcal/mol, 20.5 kcal/mol, and 27.06 kcal/mol, respectively. The magnitude of energy peak 27.06 kcal/mol, respectively. The magnitude of energy peak decreases with the order G > A > C > T decreases with the order G > A > C > T following the trends of interfacial interaction between the BN following the trends of interfacial interaction between the BN sheet and nucleobases. From the binding sheet and nucleobases. From the binding energy peaks, we can find that the nucleotides A, T, C, G in energy peaks, we can that the nucleotides A, another T, C, G inwith the ssDNA could be distinguished the ssDNA could befind distinguished from one the circular hBN nanopore. from The one anotherenergy with the circular hBN nanopore. The interaction profile in our simulation interaction profile observed in our simulation agreesenergy with the forceobserved profile obtained from the agrees with the forceby profile the ssDNA the grapheneviewpoint, nanopore [44]. ssDNA sequencing the obtained graphenefrom nanopore [44].sequencing From the by experimental the From the experimental viewpoint, the interaction energy between the nucleobase and two-dimensional interaction energy between the nucleobase and two-dimensional layers has a correlation with the layers has a correlation witha the conductance which shows a means to differentiate four nucleobase conductance which shows means to differentiate the four nucleobase types [45].the For example, the types [45]. For example, the conductance fluctuation of pyrimidines is found to be much larger than conductance fluctuation of pyrimidines is found to be much larger than that of purines, resulting that of resulting from the interaction strengthand between the nucleobase and the nanopore. from thepurines, interaction strength between the nucleobase the nanopore.

Nanomaterials 2016, 6, 111 Nanomaterials 2016, 6, 111 Nanomaterials 2016, 6, 111

7 of 11 7 of 11 7 of 11

20

30

EnergyBarrier Barrier Peak (kcal/mol) Energy Peak (kcal/mol)

25

20

Energy Barrier (kcal/mol)

Energy Barrier (kcal/mol)

30

A CA GC TG T

25

15

15

10

10

5

5

0

0

0

0

100100

200200

300 300 Time (ps) Time (ps)

400 400

25 25 20 20 15 15 10 10 5 5

00

500 500

A A

CC

GG

T T

Figure 7. profile when hBN nanopores. The energy peak Figure 7. Energy profile whenssDNA ssDNApassed passedthrough through the the energy peak Figure 7. Energy Energy profile when ssDNA passed through thecircular circularhBN hBNnanopores. nanopores.The The energy peak values for different nucleotides are extracted from the energy profile. values for different nucleotides are extracted from the energy profile. values for different nucleotides are extracted from the energy profile.

Energy Barrier (kcal/mol)

Energy Barrier (kcal/mol)

20

15

20

15

10

10

5

5

30 30

Energy Barrier Peak (kcal/mol) Energy Barrier Peak (kcal/mol)

AA CC GG T T

25 25

25 25

20

20

15

15

10

10 5

5

0

0 0

0

100

100

200

200

300 400 Time 300 (ps) 400

500

500

600

600

0

0

A

A

C

C

G

G

T

T

Time (ps)

Figure 8. 8. Energy the elliptical ellipticalhBN hBNnanopores. nanopores.The The energy peak Figure Energyprofile profilewhen whenssDNA ssDNApasses passes through the energy peak Figure 8. profile when ssDNA passes through elliptical hBN nanopores. The energy peak values forEnergy different nucleotides are from energy profile. values for different nucleotides areextracted extracted from the thethe profile. values for different nucleotides are extracted from the energy profile.

seen fromFigure Figure8,8,the theinteraction interaction energy energy profile thethe elliptical AsAs seen from profile for fordifferent differentnucleobases nucleobaseswith with elliptical As seen from Figure 8, the interaction energy profile for different nucleobases with the elliptical nanopore is different from that of the circular nanopore. As discussed in ssDNA sequencing by nanopore is different from that of the circular nanopore. As discussed in ssDNA sequencing by rhombicispore on graphene [44], of thethe conformation of the nucleotide with theinphosphodiester bond isby nanopore different from that circular nanopore. As discussed ssDNA sequencing rhombic pore on graphene [44], the conformation of the nucleotide with the phosphodiester bond is narrow which it easier nucleotide to through thewith nanopore along the majorbond axis is rhombic pore on makes graphene [44], for thethe conformation ofpass the nucleotide the phosphodiester narrow which makes it easier for the nucleotide to pass through the nanopore along the major axis than along the minor axis of the elliptical nanopore. It has been recorded that the conformational narrow which makes it easier for the nucleotide to pass through the nanopore along the major axis than along the minor axis of the elliptical nanopore. It has been recorded that the conformational change theminor nucleotide quite different when threading the nanopore various orientations than alongofthe axis ofis the elliptical nanopore. It has been recorded in that the conformational change of the nucleotide is quite different when threading the nanopore in various orientations [17,46]. areaisofquite the elliptical nanopore for the ssDNA pass through is smaller as is[17,46]. the change of The the effective nucleotide different when threading the to nanopore in various orientations The effectivealong area of the elliptical nanopore for the ssDNA to passmakes through is smaller difficult as is the for direction direction the minor axis of the elliptical nanopore, which it extremely the [17,46]. The effective area of the elliptical nanopore for the ssDNA to pass through is smaller as is the along minor axis ofnanopore. the elliptical nanopore, which makes it extremely difficult forpeaks the base to thread basethe toalong thread could increase energy when direction thethe minor axis ofThe the ratcheting-fashion elliptical nanopore, which makesthe it extremely difficult forthe the theorientation nanopore.ofThe could increase energynanopore peaks when theratcheting-fashion nucleobase changes; therefore, the the elliptical couldthe notorientation guarantee of thethe base to thread the nanopore. The ratcheting-fashion could increase the energy peaks when the nucleobase changes; therefore, the elliptical could not guarantee correct nanopore discrimination correct discrimination of different typesnanopore of nucleotides. However, thethecircular is orientation of the nucleobase changes; therefore, the elliptical nanopore could not guarantee the of axisymmetric different typesand of nucleotides. However, the circular nanopore is axisymmetric and the energy the energy peak of a nucleobase through the nanopore is almost correct discrimination of different types of nucleotides. However, the circular nanopore is peak of a nucleobase through nanopore circular is almost orientation-independent. The axisymmetric orientation-independent. The the axisymmetric nanopore is more robust to the orientation of axisymmetric and the energy peak of a nucleobase through the nanopore is almost the nucleobase the robust asymmetrically elliptical of nanopore. The observed difference of the binding circular nanoporethan is more to the orientation the nucleobase than the asymmetrically elliptical orientation-independent. The axisymmetric circular nanopore is sequencing more robust to the orientation of energy further verifies difference the fact that acid (DNA)verifies is very sensitive to the nanopore. The observed ofdeoxyribonucleic the binding energy further the fact that deoxyribonucleic theorientation nucleobaseofthan the asymmetrically elliptical nanopore. The observed difference of the the nucleotide when thetogeometry of the nanopore is asymmetrical Thebinding basic acid (DNA) sequencing is very sensitive the orientation of the nucleotide when the[47]. geometry of the energy further verifies the fact that deoxyribonucleic acid (DNA) sequencing is very sensitive to the nucleotides (A, T, C, G) can be The identified by the interaction peaks with the hBN nanopore is asymmetrical [47]. basic nucleotides (A, T,energy C, G) can be only identified by circular the interaction orientation of thethe nucleotide when the geometry ofisthe nanopore asymmetrical [47]. The basic nanopore magnitude of the peaks dependent on is the type of nucleobase, which energy peaksand only with the circular hBNenergy nanopore and the magnitude of the energy peaks is dependent nucleotides (A, T, C, G) can be identified by the interaction energy peaks only with the circular hBN that of different geometries could be identified with the hBN could nanopore. onmeans the type ofbases nucleobase, which means that bases of different geometries be identified with the nanopore and the magnitude of the energy peaks is dependent on the type of nucleobase, which hBN nanopore. means that bases of different geometries could be identified with the hBN nanopore.

Nanomaterials 2016, 6, 111

8 of 11

3. Methods In molecular dynamic (MD) simulations, we adopt the modified CHARMM27 force field [48] to describe the bonded and non-bonded interactions between atoms. The potential components described in the CHARMM27 force field are defined as the intramolecular interactions (bond stretch, bond angle, dihedral angle, improper angle, Urey-Bradley) characterizing the short-range bonding and intermolecular non-bonded interactions describing the long-range van der Waals (vdW) interactions and electrostatic interactions. The non-bonded part is computed as a sum of Coulomb and Lennard-Jones contributions for pairwise intra- and inter-molecular interactions related to electrostatic and van der Waals interactions: Enonbonded “

ÿ qi q j σ6ij σ12 ij r ` 4εij p 12 ´ 6 qs rij rij rij iă j

(2)

where rij is the distance between two atoms i and j, εij is the depth of the potential well, and σij is the distance at which the potential becomes zero. qi and qj are the charge on atom i and j. The summation runs over all of the pairs of atom i < j on molecules A and B or A and A for the intramolecular interactions. For the Lennard-Jones (LJ) potential, Lorentz-Berthelot mixing rules for the Lennard-Jones ` ˘1{2 coefficients are employed: σij = (σii + σjj )/2 and εij “ εii ε jj . For hBN, σB = 3.453 Å, σN = 3.365 Å and εB = 4.16 meV, εN = 6.281 meV [49,50]. The partial charges on hBN are taken from previous density functional theory calculations [38,51]. In our MD simulation, qB = 0.37e, qN = ´0.37e, qH´B “ 0.32e, qH´N “ ´0.19e. Boron atoms with a lower electronegativity compared to the nitrogen atoms are positively charged while the nitrogen atoms are negatively charged in B–N bonding. H atoms forming dangling bonds with B and N atoms at the edge of the sheet have either positive or negative charges depending on the atoms to which the H atoms bind. Energy minimization based on the conjugated gradient algorithm is performed to find the thermally stable configuration and achieve a conformation with a minimum potential energy for the system. After the equilibrium state is achieved, canonical ensemble (constant-number, constant-volume, constant-temperature) simulations with temperature 300 K are carried out based on the Berendsen thermostat [52]. The velocity Verlet time stepping method is utilized with the integration time step 0.5 fs. A cutoff distance of 10 Å is used for all potentials. All simulations are performed in the generalized born implicit solvent environment [53]. To speed up computation, the hBN atoms are fixed to their initial position which facilitates the geometrical characterization of the ssDNA with respect to the hBN. The global cutoff for the LJ term is set here to be 10 Å as a good balance between computational cost and accuracy. 4. Conclusions In summary, here we have performed molecular dynamics simulations to investigate the mechanism of ssDNA sequencing using the hBN nanopore. We first demonstrate the interfacial interaction between the hBN sheet and a single nucleobase which lays the foundation for hBN-based ssDNA sequencing. With strong vdW and electrostatic interactions, the nucleobase can fully interact with the hBN sheet and attach onto its surface. The simulation results demonstrate that nucleotide G has the strongest binding strength compared with other nucleobases. The type of nucleobase could be classified and identified from the binding strength between the nucleobase and hBN sheet. Compared with the binding strength between graphene and the nucleobases, our result implies that the effect of hBN-based ssDNA sequencing is more sensitive than graphene-based ssDNA sequencing. The ability of nucleobase detection by the hBN nanopore depends both on the binding strength between the nucleobase and hBN sheet and the nanopore geometry. Our simulation suggests that a circular nanopore on the hBN sheet is better suited to DNA sequencing than an asymmetric nanopore. These fundamental findings from the interfacial binding strength between hBN and nucleobases provide promising guidance for designing novel hBN-based devices for biological applications.

Nanomaterials 2016, 6, 111

9 of 11

Acknowledgments: The authors acknowledge support from National Science Foundation and University of Georgia (UGA) start-up fund. The facility support for modeling and simulations from the UGA Advanced Computing Resource Center is greatly appreciated. Author Contributions: Liuyang Zhang performed the simulation, collected the data and wrote the manuscript in this study. Xianqiao Wang supervised all the work. Conflicts of Interest: The authors declare no competing financial interests.

References 1.

2.

3. 4.

5. 6. 7.

8.

9. 10. 11. 12. 13. 14. 15.

16. 17. 18.

Benner, S.; Chen, R.J.; Wilson, N.A.; Abu-Shumays, R.; Hurt, N.; Lieberman, K.R.; Deamer, D.W.; Dunbar, W.B.; Akeson, M. Sequence-specific detection of individual DNA polymerase complexes in real time using a nanopore. Nat. Nanotechnol. 2007, 2, 718–724. [CrossRef] [PubMed] Flusberg, B.A.; Webster, D.R.; Lee, J.H.; Travers, K.J.; Olivares, E.C.; Clark, T.A.; Korlach, J.; Turner, S.W. Direct detection of DNA methylation during single-molecule, real-time sequencing. Nat. Methods 2010, 7, 461–465. [CrossRef] [PubMed] Wanunu, M. Nanopores: A journey towards DNA sequencing. Phys. Life Rev. 2012, 9, 125–158. [CrossRef] [PubMed] Rajan, A.C.; Rezapour, M.R.; Yun, J.; Cho, Y.; Cho, W.J.; Min, S.K.; Lee, G.; Kim, K.S. Two Dimensional Molecular Electronics Spectroscopy for Molecular Fingerprinting, DNA Sequencing, and Cancerous DNA Recognition. ACS Nano 2014, 8, 1827–1833. [CrossRef] [PubMed] Guo, B.-Y.; Zeng, T.; Wu, H.-C. Recent advances of DNA sequencing via nanopore-based technologies. Sci. Bull. 2015, 60, 287–295. [CrossRef] Min, S.K.; Kim, W.Y.; Cho, Y.; Kim, K.S. Fast DNA sequencing with a graphene-based nanochannel device. Nat. Nano 2011, 6, 162–165. [CrossRef] [PubMed] Laszlo, A.H.; Derrington, I.M.; Ross, B.C.; Brinkerhoff, H.; Adey, A.; Nova, I.C.; Craig, J.M.; Langford, K.W.; Samson, J.M.; Daza, R.; et al. Decoding long nanopore sequencing reads of natural DNA. Nat. Biotechnol. 2014, 32, 829–833. [CrossRef] [PubMed] Branton, D.; Deamer, D.W.; Marziali, A.; Bayley, H.; Benner, S.A.; Butler, T.; di Ventra, M.; Garaj, S.; Hibbs, A.; Huang, X.; et al. The potential and challenges of nanopore sequencing. Nat. Biotechnol. 2008, 26, 1146–1153. [CrossRef] [PubMed] Zhang, L.; Wang, X. Atomistic Insights into the Nanohelix of Hydrogenated Graphene: Formation, Characterization and Application. Phys. Chem. Chem. Phys. 2014, 16, 2981–2988. [CrossRef] [PubMed] Zhang, L.; Wang, X. Computational Insights of Water Droplet Transport on Graphene Sheet with Chemical Density. J. Appl. Phys. 2014, 115. [CrossRef] Chen, X.; Zhang, L.; Zhao, Y.; Wang, X.; Ke, C. Graphene folding on flat substrates. J. Appl. Phys. 2014, 116. [CrossRef] Zhang, L.; Becton, M.; Wang, X. Mechanical Analysis of Graphene-Based Woven Nano-Fabric. Mater. Sci. Eng. A 2015, 620, 367–374. [CrossRef] Becton, M.; Zhang, L.; Wang, X. Molecular Dynamics Study of Programmable Nanoporous Graphene. J. Nanomech. Micromech. 2014, 4, 2153–5477. [CrossRef] Zhang, L.; Zeng, X.; Wang, X. Programmable Hydrogenation of Graphene for Novel Nanocages. Sci. Rep. 2013, 3. [CrossRef] [PubMed] Merchant, C.A.; Healy, K.; Wanunu, M.; Ray, V.; Peterman, N.; Bartel, J.; Fischbein, M.D.; Venta, K.; Luo, Z.; Johnson, A.T.C.; et al. DNA Translocation through Graphene Nanopores. Nano Lett. 2010, 10, 2915–2921. [CrossRef] [PubMed] Sathe, C.; Zou, X.; Leburton, J.-P.; Schulten, K. Computational Investigation of DNA Detection Using Graphene Nanopores. ACS Nano 2011, 5, 8842–8851. [CrossRef] [PubMed] Wells, D.B.; Belkin, M.; Comer, J.; Aksimentiev, A. Assessing Graphene Nanopores for Sequencing DNA. Nano Lett. 2012, 12, 4117–4123. [CrossRef] [PubMed] Prasongkit, J.; Grigoriev, A.; Pathak, B.; Ahuja, R.; Scheicher, R.H. Transverse Conductance of DNA Nucleotides in a Graphene Nanogap from First Principles. Nano Lett. 2011, 11, 1941–1945. [CrossRef] [PubMed]

Nanomaterials 2016, 6, 111

19.

20. 21. 22. 23. 24. 25. 26.

27.

28. 29. 30. 31. 32.

33. 34. 35. 36. 37. 38. 39. 40. 41. 42.

10 of 11

Saha, K.K.; Drndi´c, M.; Nikoli´c, B.K. DNA Base-Specific Modulation of Microampere Transverse Edge Currents through a Metallic Graphene Nanoribbon with a Nanopore. Nano Lett. 2012, 12, 50–55. [CrossRef] [PubMed] Heerema, S.J.; Schneider, G.F.; Rozemuller, M.; Vicarelli, L.; Zandbergen, H.W.; Dekker, C. 1/f noise in graphene nanopores. Nanotechnology 2015, 26. [CrossRef] [PubMed] Sourav, K.; Karmakar, S.N. Detection of base-pair mismatches in DNA using graphene-based nanopore device. Nanotechnology 2016, 27. [CrossRef] Chen, X.; Zhang, L.; Park, C.; Fay, C.C.; Wang, X.; Ke, C. Mechanical strength of boron nitride nanotube-polymer interfaces. Appl. Phys. Lett. 2015, 107. [CrossRef] Liu, H.; Turner, C.H. Adsorption properties of nitrogen dioxide on hybrid carbon and boron-nitride nanotubes. Phys. Chem. Chem. Phys. 2014, 16, 22853–22860. [CrossRef] [PubMed] Li, X.; Wu, X.; Zeng, X.C.; Yang, J. Band-Gap Engineering via Tailored Line Defects in Boron-Nitride Nanoribbons, Sheets, and Nanotubes. ACS Nano 2012, 6, 4104–4112. [CrossRef] [PubMed] Zhao, Y.; Xie, Y.; Liu, Z.; Wang, X.; Chai, Y.; Yan, F. Two-Dimensional Material Membranes: An Emerging Platform for Controllable Mass Transport Applications. Small 2014, 10, 4521–4542. [CrossRef] [PubMed] Liu, S.; Lu, B.; Zhao, Q.; Li, J.; Gao, T.; Chen, Y.; Zhang, Y.; Liu, Z.; Fan, Z.; Yang, F.; et al. Boron Nitride Nanopores: Highly Sensitive DNA Single-Molecule Detectors. Adv. Mater. 2013, 25, 4549–4554. [CrossRef] [PubMed] Lin, Q.; Zou, X.; Zhou, G.; Liu, R.; Wu, J.; Li, J.; Duan, W. Adsorption of DNA/RNA nucleobases on hexagonal boron nitride sheet: An ab initio study. Phys. Chem. Chem. Phys. 2011, 13, 12225–12230. [CrossRef] [PubMed] Gu, Z.; Zhang, Y.; Luan, B.; Zhou, R. DNA translocation through single-layer boron nitride nanopores. Soft Matter 2016, 12, 817–823. [CrossRef] [PubMed] Ding, N.; Chen, X.; Wu, C.-M.L.; Li, H. Adsorption of nucleobase pairs on hexagonal boron nitride sheet: hydrogen bonding versus stacking. Phys. Chem. Chem. Phys. 2013, 15, 10767–10776. [CrossRef] [PubMed] Lee, J.-H.; Choi, Y.-K.; Kim, H.-J.; Scheicher, R.H.; Cho, J.-H. Physisorption of DNA Nucleobases on h-BN and Graphene: vdW-Corrected DFT Calculations. J. Phys. Chem. C 2013, 117, 13435–13441. [CrossRef] Johnson, R.R.; Johnson, A.T.C.; Klein, M.L. The Nature of DNA-Base–Carbon-Nanotube Interactions. Small 2010, 6, 31–34. [CrossRef] [PubMed] Johnson, R.R.; Kohlmeyer, A.; Johnson, A.T.C.; Klein, M.L. Free Energy Landscape of a DNA–Carbon Nanotube Hybrid Using Replica Exchange Molecular Dynamics. Nano Lett. 2009, 9, 537–541. [CrossRef] [PubMed] Enyashin, A.N.; Gemming, S.; Seifert, G. DNA-wrapped carbon nanotubes. Nanotechnology 2007, 18. [CrossRef] Gowtham, S.; Scheicher, R.H.; Pandey, R.; Karna, S.P.; Ahuja, R. First-principles study of physisorption of nucleic acid bases on small-diameter carbon nanotubes. Nanotechnology 2008, 19. [CrossRef] [PubMed] Varghese, N.; Mogera, U.; Govindaraj, A.; Das, A.; Maiti, P.K.; Sood, A.K.; Rao, C.N.R. Binding of DNA Nucleobases and Nucleosides with Graphene. ChemPhysChem 2009, 10, 206–210. [CrossRef] [PubMed] Gowtham, S.; Scheicher, R.H.; Ahuja, R.; Pandey, R.; Karna, S.P. Physisorption of nucleobases on graphene: Density-functional calculations. Phys. Rev. B 2007, 76. [CrossRef] Ortmann, F.; Schmidt, W.G.; Bechstedt, F. Attracted by Long-Range Electron Correlation: Adenine on Graphite. Phys. Rev. Lett. 2005, 95. [CrossRef] [PubMed] Nasrabadi, A.T.; Foroutan, M. Interactions between Polymers and Single-Walled Boron Nitride Nanotubes: A Molecular Dynamics Simulation Approach. J. Phys. Chem. B 2010, 114, 15429–15436. [CrossRef] [PubMed] Chen, X.; Zhang, L.; Zheng, M.; Park, C.; Wang, X.; Ke, C. Quantitative nanomechanical characterization of the van der Waals interfaces between carbon nanotubes and epoxy. Carbon 2015, 82, 214–228. [CrossRef] Becton, M.; Zhang, L.; Wang, X. Mechanics of Graphyne Crumpling. Phys. Chem. Chem. Phys. 2014, 16, 18233–18240. [CrossRef] [PubMed] Zhang, L.; Xu, B.; Wang, X. Cholesterol Extraction from Cell Membrane by Graphene Nanosheets: A Computational Study. J. Phys. Chem. B 2016, 120, 957–964. [CrossRef] [PubMed] Jiang, Y.; Gao, J.; Guo, W.; Jiang, L. Mechanical exfoliation of track-etched two-dimensional layered materials for the fabrication of ultrathin nanopores. Chem. Commun. 2014, 50, 14149–14152. [CrossRef] [PubMed]

Nanomaterials 2016, 6, 111

43. 44. 45.

46. 47.

48.

49. 50. 51. 52. 53.

11 of 11

Luan, B.; Peng, H.; Polonsky, S.; Rossnagel, S.; Stolovitzky, G.; Martyna, G. Base-By-Base Ratcheting of Single Stranded DNA through a Solid-State Nanopore. Phys. Rev. Lett. 2010, 104. [CrossRef] [PubMed] Zhang, Z.; Shen, J.; Wang, H.; Wang, Q.; Zhang, J.; Liang, L.; Ågren, H.; Tu, Y. Effects of Graphene Nanopore Geometry on DNA Sequencing. J. Phys. Chem. Lett. 2014, 5, 1602–1607. [CrossRef] [PubMed] Prasongkit, J.; Feliciano, G.T.; Rocha, A.R.; He, Y.; Osotchan, T.; Ahuja, R.; Scheicher, R.H. Theoretical assessment of feasibility to sequence DNA through interlayer electronic tunneling transport at aligned nanopores in bilayer graphene. Sci. Rep. 2015, 5. [CrossRef] [PubMed] Nelson, T.; Zhang, B.; Prezhdo, O.V. Detection of Nucleic Acids with Graphene Nanopores: Ab Initio Characterization of a Novel Sequencing Device. Nano Lett. 2010, 10, 3237–3242. [CrossRef] [PubMed] Avdoshenko, S.M.; Nozaki, D.; da Rocha, C.G.; González, J.W.; Lee, M.H.; Gutierrez, R.; Cuniberti, G. Dynamic and Electronic Transport Properties of DNA Translocation through Graphene Nanopores. Nano Lett. 2013, 13, 1969–1976. [CrossRef] [PubMed] Brooks, B.R.; Bruccoleri, R.E.; Olafson, B.D.; States, D.J.; Swaminathan, S.; Karplus, M. CHARMM: A program for macromolecular energy, minimization, and dynamics calculations. J. Comput. Chem. 1983, 4, 187–217. [CrossRef] Baowan, D.; Hill, J.M. Nested boron nitride and carbon-boron nitride nanocones. IET Micro Nano Lett. 2007, 2, 46–49. [CrossRef] Neek-Amal, M.; Peeters, F.M. Graphene on boron-nitride: Moiré pattern in the van der Waals energy. Appl. Phys. Lett. 2014, 104. [CrossRef] Won, C.Y.; Aluru, N. Structure and dynamics of water confined in a boron nitride nanotube. J. Phys. Chem. C 2008, 112, 1812–1818. [CrossRef] Berendsen, H.J.C.; Postma, J.P.M.; van Gunsteren, W.F.; DiNola, A.; Haak, J.R. Molecular dynamics with coupling to an external bath. J. Chem. Phys. 1984, 81, 3684–3690. [CrossRef] Bashford, D.; Case, D.A. Generalized Born Models OF Macromolecular Solvation Effects. Ann. Rev. Phys. Chem. 2000, 51, 129–152. [CrossRef] [PubMed] © 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).