118

DNA BINDINGAND BENDING

[9] D N A B e n d i n g in P r o t e i n - D N A

[9]

Complexes

By D O N A L D M . C R O T H E R S , M A R C R . G A R T E N B E R G ,

and THOMAS E. SHRADER Introduction The realization that bound proteins may greatly distort nucleic acids is not new to molecular biology. The nucleosome, the earliest protein-DNA complex to be structurally characterized, 1 remains the most dramatic example of protein-induced DNA deformation. In more recent years noncrystallographic techniques have revealed that induced DNA bending is a common but not universal characteristic of regulatory proteins. The functional purpose of DNA flexure is in a simplistic sense obvious: the bend stabilizes a particular tertiary structure of a larger complex between DNA and one or more proteins. However, this facile answer sidesteps the issue of why DNA should be required to curve in such complexes when they might equally well be organized with proteins arrayed linearly along the DNA, especially in view of the significant energetic cost of DNA bending. It seems plausible that a compact shape facilitates the structural stabilization and regulatory signals contributed by interactions at protein-protein interfaces in multiprotein-DNA complexes. As experimental understanding of intrinsic and induced DNA bending increases, we can expect more sophisticated explanations for the phenomenon to emerge. This chapter is directed at experimental approaches to the problem that make use of standard molecular biological techniques, enabling widespread application to the numerous protein-DNA interaction systems that are now under study. We divide the primary methods of interest into two categories: comparative electrophoresis and sequence perturbation. In principle both are capable of specifying the locus and direction of bends induced in DNA by proteins. The first method relies on the empirical fact that the electrophoretic mobility of DNA molecules depends on their shape, as well as on their contour length. 2 Even when a protein is bound, DNA shape still affects the mobility of the complex in nondenaturing gel electrophoresis, 2 as long as the DNA molecule is severalfold larger than the segment that interacts directly with the protein. The basic strategy of comparative 1 T. J. R i c h m o n d , T. J. F i n c h , B. R u s h t o n , D. R h o d e s , a n d A. Klug, Nature (London) 311, 532 (1984). 2 H.-M. W u a n d D. M. Crothers, Nature (London) 308, 509 (1984).

METHODS IN ENZYMOLOGY, VOL. 208

Copyright @ 1991by AcademicPress, Inc. All rights of reproduction in any form reserved.

[9]

DNA BENDINGIN PROTEIN-DNA COMPLEXES

1 19

electrophoresis is to alter DNA shape by changing the position of a bend in the molecule, 2 or by changing the helical phasing between two bends, 3 and to determine the relative electrophoretic mobility of the resulting constructs. Interpretation of experiments of this kind has a strongly empirical basis, requiring careful evaluation of alternative explanations as the technique is "bootstrapped" to new applications. By sequence perturbation we mean systematic study of bending or binding strength of a DNA-protein complex as a function of the base sequence in a region where a DNA bend is suspected; this approach applies only outside the strongly conserved sequence that forms specific hydrogen bonds to the protein. The basis for interpretation of these experiments is provided by the rules developed for nucleosomes and Escherichia coli CAP protein, according to which A/T-rich sequences are preferred when DNA bends toward its minor groove, and G/C-rich segments are favored when the bend is toward the major groove. 4-7 The degree of bending is most sensitive to sequence at the locus where one of the grooves faces the protein, 6 corresponding to sites where roll between the base pairs causes the helix to bend. Hence, from the position of maximum sequence sensitivity, and the nature of the sequences that provide maximal bending, it is possible in principle with this relatively labor-intensive method to specify the bend locus and direction with high accuracy. Comparative Electrophoresis The three major properties that characterize a bend are (1) its locus, as described by the position of its center, (2) its direction, defined, for example, relative to the roll and tilt axes of a specific helix position such as the center of the bend, and (3) its magnitude, usually measured relative to a standard bend. Comparative electrophoresis is able to provide answers to all these questions, although different constructs are required for each of the three cases. However, the experiments share a common gel electrophoresis technology.

Methodology: Electrophoresis of Protein-DNA Complexes To detect conformation-dependent changes in mobility, DNA molecules must migrate through the gel matrix by reptation, or snakelike motion, rather than by a seiving mechanism. The empirical fact is that bent 3 S. S. Zinkel and D. M. Crothers, Nature (London) 328, 178 (1987). 4 H. R. Drew and A. A. Travers, J. Mol. Biol. 186, 773 (1985). 5 S. C. Satchwell, H. R. Drew, and A. A. Travers, J. Mol. Biol. 191, 659 (1986). 6 M. R. Gartenberg and D. M. Crothers, Nature (London) 333, 824 (1988). 7 T. E. Shrader and D. M. Crothers, Proc. Natl. Acad. Sci. U.S.A. 86, 7418 (1989).

120

DNA BINDINGAND BENDING

[9]

molecules migrate more slowly than linear ones in high-percentage acrylamide gelsa; as the gel percentage is reduced, or if agarose gels are used, the anomaly in the mobility of the bent form lessens or disappears. This fact has been interpreted, 2 perhaps simplistically, as reflecting the predicted dependence of mobility on the mean square end-to-end distance for molecules of fixed contour length. 9,~°It is likely that motion through the pores of the gel acts to straighten the molecule out, since the entire chain must follow the path chosen by its leading segment; the energy needed to straighten bent molecules may be an important factor contributing to their relatively slow motion. H On the other hand, the gel retains some local elasticity, allowing the molecule to move toward the shape that is favored in free solution, thereby reducing its end-to-end distance. This tendency to return to solution shape may account for the qualitative success of theories that predict a correlation between mean square end-to-end distance and electrophoretic mobility. 9'~° However, the problem is a difficult one, and theory is not yet a quantitatively reliable guide to the electophoretic properties of DNA molecules of complex shape. The protein-DNA complexes we have examined are quite stable and insensitive to moderate changes in electrophoresis conditions. Complexes are preformed in binding buffers appropriate for each protein, and commonly electrophoresed in nondenaturing polyacrylamide gels, of acrylamide percentage between 5 and 10%; the optimum acrylamide-to-bisacrylamide ratio has been found empirically ~2to be about 75 : 1. We prefer this ratio, used with the highest acrylamide percentage that gives adequate mobility to the complex, since we have found that these conditions yield optimally sharp bands for the complexes at a fixed migration distance.12 This observation provides support for the view that high acrylamide concentration provides a "cage" around the complex that stabilizes it against dissociation during electrophoresis, although it is also possible that the phenomenon results from other factors, such as an influence of high gel percentage on the thermodynamic activity of water. (If bound water molecules are released from DNA or protein in forming the complex, then a lowered concentration of water in the gel will result in an increased binding affinity.) The gels are generally 16 cm in length with a 1.5 mm by 14 cm cross8 j. C. Martini, S. D. Levene, D. M. Crothers, and P. T. Englund, Proc. Natl. Acad, Sci. U.S.A. 79, 7664 (1982). 9 L. S. Lerman and H. L. Frisch, Biopolymers 21, 995 (1982). to O. J. Lumpkin and B. H. Zimm, Biopolymers 21, 2315 (1982). II S. Levene and B. H. Zimm, Science (in press). 12 H.-N. Lui-Johnson, M. R. Gartenberg, and D. M. Crothers, Cell (Cambridge, Mass.) 47, 995 (1986).

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

121

section. Loading dyes containing glycerol or sucrose may be added to binding reactions immediately before electrophoresis. To obtain sharp protein-DNA complex bands, the final concentration of glycerol should be kept to a minimum (-10%, v/v). We generally electrophorese the complexes at 420 V in 0.5 × TBE buffer [45 mM Tris, 45 mM boric acid, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 8.3], maintaining a temperature of 20-25 ° in the gel with a constant temperature gel apparatus (Hoefer, San Francisco, CA) and a circulating refrigerated water bath (Neslab, Portsmouth, NH). Electrophoresis at high voltage and low ionic strength also contributes to band sharpening, since those factors act to minimize complex dissociation during electrophoresis. Modifications to the electrophoresis buffer are tolerated and often necessary. EDTA may be eliminated if divalent cations such as Zn(II) are essential for protein binding. Buffers with alternate pH may be used, for example if the protein is small and has an acidic isoelectric point, causing it to confer little or no retardation on the mobility of the DNA to which it is attached. 13 DNAs are generally detected by 32p autoradiography, /3 scanning, or ethidium fluorescence.

Mapping Bend Locus by Circular Permutation of Sequence A DNA bend reduces the end-to-end distance of a DNA fragment and therefore its electrophoretic mobility if it is located near the center of the molecule; a bend near a molecular end influences neither appreciably (see Fig. 1). This simple determinant of gross molecular shape is the basis of the circular permutation assay used to map the locus of DNA bending. 2 A tandem dimer or multimer of a binding site fragment is cloned and cleaved with restriction enzymes that cut only once within the sequence, resulting in a set of circularly permuted DNA molecules that differ in the position of the binding site relative to the molecular ends. Figure 2 shows the variation in gel mobility for two series of circularly permuted lac promoters, one wild type (lanes 1-5) and one mutated (lanes 6-10), bound by E. coli CAP protein. 12The slowest moving species (lanes 1 and 6) position the protein-binding site near the molecular center. CAP-induced DNA bending and not the influence of bound protein is thought to be responsible for the observed position-dependent variation in gel mobility; complexes with lac repressor, another globular protein, migrate equivalently regardless of binding site position, z However, DNAbinding proteins with extended and negatively charged domains, as pro-

13 j. Carey, Proc. Natl. Acad. Sci. U.S.A. 85, 975 (1988).

122

D N A BINDING AND BENDING

(2) (I) I

I I

(I) I

I

l

l

t

&

t

[9]

{2) I t

i l

t

tandem dimer I restriction digestion

(1) low-mobility fragment

(2) high-mobility fragment

FIG. I. Logic of the circular permutation experiment for determination of bend position. 2 A cloned tandem dimer or higher order repeat is cleaved with a series of restriction enzymes that cut once in the sequence of interest. Fragment (1), having a bend in the center, is highly bent and therefore of low gel mobility. Fragment (2) is nearly linear since the bend is near the end, and hence nearly normal in electrophoretic mobility.

posed for GCN4, may modulate electrophoretic mobility of protein-DNA complexes in a position-dependent manner without inducing DNA bends. 14 For identification of the bend center one can use a plot such as that shown in Fig. 3, which is based on the data in Fig. 2. The mobilities of the complexes with circularly permuted DNAs are plotted against position of the DNA molecular end in the numbering system of the parent fragment. Distance moved down the gel reaches a maximum (corresponding to the minimum in the plot of Fig. 3) when the binding site, and hence the bend, is near the molecular end. Extrapolation of the lines on both sides of the minimum to their intersection enables identification of the bend center, often to within a few base pairs. If the DNA molecule has a more complex shape than provided by a single symmetric bend, the curve in Fig. 3 can be asymmetric, and the minimum need not correspond to the center of the local bend. For example, the minimum in Fig. 3 is displaced about half a z4 M. R. Gartenberg, C. Ampe, T. R. Steitz, and D. M. Crothers, Proc. Natl. Acad. Sci. U.S.A. in press (1990).

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

123

complext

free DNA

12345678910 FIG. 2. Illustration of the circular permutation mobility assay.lZ Circularly permuted 203bp lac promoter fragments complexed with CAP protein are shown in lanes 1-5, and a similar series is shown in lanes 6-10 for a mutated sequence (sy203). Electrophoresis is on a 10% polyacrylamide gel, 75 : 1 (w/w) acrylamide : bisacrylamide in TBE buffer.

helical turn downstream in the lac promoter from the center of the CAP binding site, an effect thought to be due to additional in-phase curvature in the promoter.12 The mobility of CAP protein complexed with the mutant DNA sequence in Figs. 2 and 3 is larger than that of the wild-type complex when the bend is near the center of the molecule, implying a smaller bend with the mutant sequence. In contrast, when the bend is near the end of the molecule, the mutant sequence provides a complex with lower gel mobility, an effect that was interpreted as a reflection of a bend in excess of 900.12

Assigning D N A Bend Direction by Phase-Sensitive Detection Static DNA bends are characterized by their direction relative to distal features, such as other DNA bends or bound proteins, as well as local helical parameters, including the major and minor grooves within the

124

D N A BINDING AND BENDING

[9]

1.4 1.8

Q"~

'~\

/j / •...

2.6 ~

1/

ip" "- 3

22

i

¢11

".

,

."

30

I-_.1

m o

3.4 3.8 4.2 46 I

-144 -124 EcoRI Pvu]I

I

I

-104

-82 Hhol

I

-62

I

I

I

-41 -31 -20 8slNI Hpoll

I

+61 EcoRI

POSITION (relotive to stort site of tronscription,0) FIG. 3. Mapping the bending locus.12 Filled circles show the mobility of the CAP-wt203 complexes (Fig. 2); open circles indicate the CAP-sy203 complexes. Filled squares show the mobility of the naked DNAs, which run identically. The center of sequence symmetry is between - 61 and - 62. The bend center in the sy203 fragment, labeled x, is at about - 58, and the estimated center of the wt203 bend (y) is at about - 60. The regions of the naked D N A where a bend is suspected are indicated by braces.

binding site. Most protein-induced DNA bends examined are directed toward the protein; however, the structure of the DNase I - D N A cocrystal demonstrates that protein-induced bends need not be oriented in this fashion. ~5 Structural variability extends further: at the center of some DNA-binding sites, such as those for y8 resolvase ~6and the nucleosome, 1 the major groove faces the protein, while at others, such as those for C A P 17 and typical dimeric prokaryotic repressors, 18-2° the minor groove faces the protein. 15 D. Suck, A. Lahm, and C. Oefner, Nature (London) 332, 464 (1988). 16 G. F. Hatfull, S. Z. Noble, and N. D. F. Grindley, Cell (Cambridge, Mass.) 49, 103 (1987). 17 j. Waricker, B. P. Engelman, and T. A. Steitz, Proteins 2, 283 (1988). Is C. Wohlberger, Y. Dong, M. Ptashne, and S. C. Harrison, Nature (London) 335, 789 (1988). t9 S. R. Jordan and C. O. Pabo, Science 242, 893 (1988).

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

125

a

FIG. 4. Logic of the phase-sensitive experiment for determination of bend direction. 3 Shown are (a) cis and (b) trans isomers of DNA constructs containing both A tract (heavy line) and CAP-induced bends. Phasing between the two bends is controlled by the length of the variable linker region in the center of the molecule.

The relative directions of two DNA bends located in the same fragment may be determined from the electrophoretic mobilities of isomers that differ by the length of the intervening DNA; as the orientation of the bends varies, the mobility of the protein-DNA complexes should increase from a minimum when the end-to-end distance is short to a maximum when the end-to-end distance is long. 3'zl Figure 4 provides a schematic representation of the cis and trans isomeric structures on which this assay depends. In this example, a fragment containing a CAP binding site is fused to a fragment containing phased adenine (A) tracts. The spacing between the two loci is varied over a full turn of the double helix by the insertion of linkers of variable length. Adenine tracts provide an excellent standard because the direction 22 and magnitude 23 of the A tract bend have been determined. Exogenous bends are not required if only the relative orientation of multiple endogenous bends is of interest. 24'z5

2o A. K. Aggarwal, D. W. Rodgers, M. Drottar, M. Ptashne, and S. C. Harrison, Science 242, 899 (1988). 21 j. j. Salvo and N. D. F. Grindley, Nucleic Acids Res. 15, 9771 (1987). 22 H.-S. Koo and D. M. Crothers, Proc. Natl. Acad. Sci. U.S.A. 85, 1763 (1988). 23 H.-S. Koo, J. Drak, J. A. Rice, and D. M. Crothers, Biochemistry 29, 4227 (1990). 24 j. j. Salvo and N. D. F. Grindley, EMBO J. 7, 3609 (1988). 25 U. K. Snyder, J. F. Thompson, and A. Landy, Nature (London) 341, 255 (1989).

126

DNA BINDING AND BENDING

+CAP A B C

D

E

F

-CAP G H I

[9]

J

K

I

CAP

FIG. 5. Illustration of mobility shifts for the binding of CAP to the variable-linker constructs? Lanes A-F, CAP-DNA complexes in which the distance between the centers of the CAP and A tract bends varies from 104 to 94 bp. Electrophoresis was in a 5% polyacrylamide gel, 39 : 1 acrylamide : bisacrylamide, in TBE buffer.

As shown in Figs. 5 and 6, the gel mobilities o f CAP-bound spacer constructs vary sinusoidally with a period of approximately 10 bp in their d e p e n d e n c e on linker length. The CAP-bound construct with an 18-bp insert (lane B, Fig. 5) migrates slowest, and is thereby identified as the cis isomer, in which the molecule is nearly planar and the two bends are in essentially the same direction (see Fig. 4). Determination of bend direction in the local coordinate frame o f the nucleotides at the bend center requires that one know the number o f helical turns between bend centers. This experiment was originally designed to r e m o v e a residual ambiguity concerning the direction o f curvature of A tracts, namely whether the bend is directed toward the major or the minor groove at the A tract center. 3 Given that D N A bends toward the minor groove at the center of the CAP binding site, only integral or half-integral numbers of helical turns need be considered between the positions of the CAP and A tract bends in the cis isomer. The centers are separated by 101.5 bp; with a helical repeat of 10.5 to 10.7 bp, the only acceptable answer is 9.5 helical turns.

1.1

I

I

I

I

I

1.1,

I

I

I

I

t

}

t

I

I

1

I

I

1.01

'.----- 1.0 ..0 0

0

.~_ 0.9

0.91

o: 0.8

a:

I

~

1

[

I

I

t

I

0.81

t

1.1

1.1

1.0

1.0

"~ 0.9 .$

0.9 137

rr

0.8F

0.8 1

20

I

1

1

I

18 16 14 12 Linker Length (bp) "m"

=>, o

I

I

I

l

10

20

18

I

T

[

1

I

I

I

I

16 14 12 Linker Length (bp)

1.1 1.0

,m.

0.9 r~

0.8

1

I

20

18

16 14 12 Linker Length (bp)

I

10

FIG. 6. Quantitative analysis of the phase dependence of the electrophoretic mobility. 3 (I) and (II) show relative mobility, normalized to the average for the set of values, for the lac repressor (I) and CAP protein (II) DNA complexes. In (I) and (II) the top graph (A) is for the free DNA, and the lower graph (B) for the protein-DNA complex. Note that for lac repressor, unlike the CAP-DNA complex, the fractional variation in gel mobility is very similar for free DNA and the complex. This is the behavior expected when a DNA fragment has some intrinsic curvature, which is unaltered by protein binding. (III) shows the ratio of the normalized mobilities for the protein-DNA complex, divided by the corresponding normalized free DNA mobility. Squares show values for CAP-DNA, and triangles are for repressor-DNA complexes. Note the strong periodic variation of relative mobility for the C A P - D N A complex normalized values. This is the behavior expected when a proteininduced bend is superimposed on intrinsic fragment curvature. From the mobility minimum, the construct with linker length 18 is the cis isomer. The tack of significant variation of normalized mobility in (III) confirms the lack of DNA bending by lac repressor.

I

10

128

DNA BINDINGAND BENDING

[9]

Hence, with a half-integral number of turns, the coordinate frame for the A tract bend is half a turn displaced from that for the CAP bend, and the overall center of the A tract bend is directed toward the major groove at its center. (Individual A tracts bend toward the minor groove at their centers, but the center of the collective bend produced by four A tracts is toward the major groove in the central 5-bp segment that lies between A tracts.) As a result of this and related experiments, the A tract bend can now be used as a comparative standard in experiments designed to determine the direction of bending induced by proteins whose structure is less well understood than CAP. Almost no variation in mobility is observed for the same constructs when bound by lac repressor, 3 as expected for a nonbending protein. The circular permutation and phase-sensitive detection assays are complementary in that the first maps bend loci irrespective of bend direction while the second assigns bend direction but provides insufficient information to map bend loci precisely.

Determination of Bend Magnitude by Comparison to Calibrated Standards The magnitude of the protein-induced bends in a DNA fragment can be estimated by comparison of the electrophoretic mobility of the fragment with those of molecules containing well-characterized bends. 26 Specifically, a calibration curve is generated from the mobilities of DNA constructs in which the protein-binding site has been replaced by DNA sequences containing from three to nine adenine tracts, repeated with a period of 10.5 bp (Fig. 7). These "in-phase" bends add to produce molecules with increasing curvature, known to correspond to a deflection of the helix axis of about 18°/CA6 C repeat. 23 To ensure that the differences in mobility are caused predominantly by the shape of the DNA molecule, the total lengths of the DNA fragments are held nearly constant and a protein-binding site is included at the end of the calibration fragments (Fig. 7). In Fig. 8, a typical calibration curve shows a plot of relative mobility versus the square of the number of resident A tracts. For molecules with less than six A tracts, the data are adequately fit by a second order polynomial. The mobility of the fragment with the centrally bound CAP is also shown. The interpolated bend magnitude is roughly 5.6 A tract equivalents or 101°, a value that is nearly invariant to changes in acrylamide concentration. 26 26 S. S. Zinkel and D. M. Crothers,

Biopolymers 29, 29 (1990).

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

129

/ Standard Bends

Test Bend

FIG. 7. Logic of the experiment to determine the magnitude of the CAP-induced bend by comparison with A tract bends. 26 The standard bends consist of a set of DNA molecules containing runs of from three to nine A tracts phased at 10.5-bp intervals, located in the center of the molecule; the A tract bend in these sequences is known to be 18°/A tract. 23 A CAP-binding site at the end of the standard fragments corrects for gel retardation due to bound CAP protein, which is shown both cis and trans to the A tract bends; experiments showed that the relative orientation has little effect when the CAP bend is at the end of the molecule,z6The magnitude of the CAP-induced bend is taken to be equal to that provided by A tracts in the standard-bend DNA molecule, the mobility of which (with CAP bound) matches the mobility of the test bend molecule with CAP bound.

A n a l t e r n a t i v e a p p r o a c h 27 c o m p a r e s t h e r a t i o o f t h e m o b i l i t i e s o f m o l e c u l e s t h a t h a v e a b e n d o f u n k n o w n m a g n i t u d e in t h e c e n t e r o r at t h e e n d to t h e s a m e r a t i o f o r m o l e c u l e s w i t h s t a n d a r d b e n d s .

Sequence Perturbation E x p e r i m e n t a l e v i d e n c e c o n t i n u e s to a c c u m u l a t e s h o w i n g t h a t D N A f l e x i b i l i t y a n d b e n d i n g a n i s o t r o p y p l a y a r o l e in p r o t e i n r e c o g n i t i o n . D N A sequences isolated from chicken erythrocyte nucleosomal core particles are probably selected for favorable DNA binding and bending, and show a c o r r e s p o n d i n g s e q u e n c e s i g n a t u r e in t h e i r n o n r a n d o m d i s t r i b u t i o n o f A • T- a n d G • C - r i c h s e q u e n c e s . 4,5 T h e o b s e r v a t i o n s i n c l u d e a n i n c r e a s e d p r o b a b i l i t y for G • C - r i c h r e g i o n s to o c c u p y p o s i t i o n s w h e r e t h e m a j o r g r o o v e is c o m p r e s s e d as t h e D N A c u r v e s a r o u n d t h e p r o t e i n , w h e r e a s A • T - r i c h r e g i o n s a r e f a v o r e d in r e g i o n s s u b j e c t e d to m i n o r g r o o v e c o m p r e s s i o n . T h e s e s e q u e n c e s p r e f e r e n t i a l l y o c c u p y s i m i l a r o r i e n t a t i o n s in s m a l l , h i g h l y s t r a i n e d D N A c i r c l e s , 4 s u g g e s t i n g t h a t D N A flexibility m a y b e a d r i v i n g f o r c e in n u c l e o s o m e p l a c e m e n t . S i m i l a r r u l e s h a v e b e e n d e d u c e d f r o m t h e p r o p e r t i e s o f m u t a n t s o f t h e D N A - b i n d i n g site for 27 j. F. Thompson and A. Landy, Nucleic Acids Res. 16, 9687 (1988).

130

D N A BINDING AND BENDING

[9]

5% Calibration Curve .-

4

CAP~, . . . . . . . . . . . . . . . . .

S

L

/ '

0

,

I

20

,

!I~"

5.6

J

,

.

40

I

60

'

'

80

(# A T r a c t s ) 2 FXG. 8. Calibration curve for measurement of the magnitude of the CAP-induced bend. 26 The RL value is the apparent number of base pairs in the C A P - D N A complex, determined by comparison with a ladder of normal DNA fragments, divided by the actual number of base pairs in the test fragment. Deviation of RL from 1 when the number of A tracts is 0 reflects the gel retardation due to CAP protein bound at the end of the corresponding standard bend fragment. The plot of RL versus the square of the number of A tracts was fitted to a quadratic polynomial for the purpose of interpolation to find the number of A tracts (5.6) that corresponds to the R L value (3.49) measured for CAP bound to the center of the test bend fragment. Electrophoresis was on a 5% polyacryamide gel (acrylamide : bisacrylamide, 39 : 1).

E. coli CAP protein6; this system and the sequence preferences of nucleo-

somes are discussed more extensively below. Another example is provided by the phage 434 repressor system, for which the protein-binding constant is affected by mutations in the central 4 bp of the binding site, shown by diffraction studies not to contact the protein, z8 These effects correlate with the stiffness of the central 4-bp segment, suggesting that the ability of this segment to bend and twist affects the binding constant by providing optimal protein-DNA contacts 28 G. B. Koudelka, S. C. Harrison, and M. Ptashne, Nature (London) 326, 886 (1987).

[9]

DNA BENDINGIN PROTEIN-DNA COMPLEXES

131

in more distal regions of the binding site. 29However, effects due to bending may be of secondary importance relative to twisting in this case, since the mutated segment may have a critical effect on the helical phasing between the two DNA segments whose interactions dominate specific binding. We have reduced the importance of this factor in the case of CAP protein by focusing on bends that lie distal to the consensus recognition sequence, as measured from the central axis of the binding site. In the case of nucleosomes, it was possible to design sequences to test directly the importance of helical twist in determining relative binding constants. 3° Our reported studies on CAP and nucleosomes were designed primarily for the purpose of elucidating the sequence dependence of DNA bending. In retrospect, it is clear that the results further refine our understanding of the nature and extent of the bent regions in the protein-DNA complexes. For example, the sites one helical turn and 1.5 helical turns from the dyad axis of the CAP-DNA complex showed maximal sensitivity in the dependence of bending on sequence. 6 However, no sequence-dependent modulation of bending could be detected at the locus two full turns removed (except when a permanent DNA bend resulting from an A tract was inserted). These results indicate that DNA is bent primarily by alternately compressing its major and minor grooves as it wraps around the protein, and that the bent region covers 1.5 helical turns on each side of the bending locus. In the case of nucleosomes, we were able to show that sequences that favor bending have little preference for any special site on the surface of the histone core, implying relatively uniform bending. 3° We expect that future studies of other complexes by these methods will be similarly informative about the position and direction of induced bends. Escherichia coli CAP Protein

The CAP binding site consists of a consensus binding domain that interacts with the helix-turn-helix recognition motif of the protein and a distal binding domain that flanks the consensus and presumably interacts nonspecifically with a ramp of positive electrostatic potential that is present on the protein surface. 6,12'17,31 To examine the influence of DNA sequence on induced bending and binding, we generated an extensive library of CAP binding site mutants. We deliberately restricted the size of randomized regions in each mutant, so that the sequences examined can be regarded as local perturbations on the wild-type sequence. The extent 29 M. E. H o g a n and R. H. Austin, Nature (London) 329, 263 (1987). 3o T. E. Shrader and D. M. Crothers, J. Mol. Biol. in press. 31 T. A. Steitz, Q. Rev. Biophys. 23, 205 (1990).

132

DNA BINDING AND BENDING -80

-75

-70

-65

~

-60

[9] -55

-50

-45

-40

CGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGG CAP binding site

-25

-20

-15

10

-5

0

+5

+10

+15

+20

I

!

AGCGCCATGGCGC,~CGC/~TTAATGTGAGTTAGCTCACTCATTAGGCACGCTAGG I

s~,'

I

t

l

~-ql

8 bp insert

D -25

-20

-15

-10

-5

0

CCATGGCGCAACGC~TTAATGTGAGTT... E

C

II

A

FIG. 9. Constructs for sequence-perturbation studies of CAP-induced bending.6 (a) The sequence and features of the wild-type CAP-binding site in the lac promoter. The underlined region denotes the thermodynamically defined binding domain,~2boldface type indicates nucleotides in the consensus sequence region, and an arrow identifies the pseudodyad axis of symmetry. Positions are numbered relative to the transcription start site. (b) The sequence changes introduced to create StyI restriction sites; dinucleotide steps are numbered relative to the pseudodyad axis. A 21 l-bp lac promoter fragment containing this sequence was cloned into the EcoRI site of pGEM-2 (Promega). (c) The location of sites fully randomized by oligonucleotide replacement. Each site was mutagenized independently of the others.

of bending and stability of complexes of the mutant binding sites were compared to those of the wild type by nondenaturing gel electrophoresis. Methods. Engineering of unique StyI restriction sites flanking the CAP binding site in the lac p r o m o t e r permitted derivatization of the natural sequence by replacement with synthetic oligonucleotides (Fig. 9a). Sequence changes were confined to the distal binding domains to avoid disruption of critical recognition contacts. The oligonucleotides contained regions of randomized sequence two or three consecutive base pairs in length, produced by degenerate synthesis. Each of the five sites A - E (Fig. 9b) were mutagenized independently of one another. Individual binding site clones were resolved from the pool of degenerate constructs by bacterial transformation and identified by sequencing of supercoiled miniprep D N A of individual colonies, n Mutant binding sites, centrally located within 211-bp lac p r o m o t e r fragments, were analyzed both for extent o f induced D N A bending, taken 32Promega Biotech Technical Manual (1986).

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

133

CAP-DNA complexes

....

A

~

B

....

C

D

E

F

free D N A

G

H

I

d

FIG. 10. Electrophoresis gel showing the variability of the mobility of CAP protein bound to DNA-binding site mutants.6 Electrophoresis was on a 10% polyacrylamide gel, 75 : 1 acrylamide : bisacrylamide. The sample in lane H has an A tract bend centered at position -22, in phase with the CAP-induced bend, lane E contains an out-of-phase A tract bend centered at position -27, and lane F contains the wild-type sequence. The other lanes illustrate the electrophoretic properties of some of the mutants A-D in Fig. 9.

to be a simple function of the electrophoretic mobility anomaly, and relative CAP binding affinity. In order to calibrate the dependence of mobility on extent of bending, constructs were made in which A tracts were placed in phase (A tract center two helical turns from the central dyad axis) and out of phase (A tract 2.5 turns from the dyad). These constructs had mobilities about 20% smaller and larger, respectively, than the wild-type CAP complex. Figure 10 illustrates this analysis: lanes E, G, and H contain the wild-type binding sequences except that in E an out-of-phase A tract has been added in the region flanking the binding site, and in lane H the added A tract is in phase with the CAP bend; the fragment in lane G has no added A tract. (The lengths of the fragments in E, G, and H were held constant within 1 bp.) Since an A tract bends the helix by about 18°, we could, by extrapolating the nearly linear relationship between the three calibration points, assign a change in the CAP-induced bend angle to each of the mutants. The variation ranged from increased bending of about 10° to decreased bending by about 30°, the latter representing a substantial

134

DNA BINDINGAND BENDING

[9]

fraction of the total estimated bend angle of 101° for the CAP-DNA complex in solution. Relative binding constants (Kre0 can be measured with high accuracy using a competition method and gel electrophoresis analysis. 33,34A comparison sequence (usually the wild type) is incorporated in a shorter (80%of site E mutantmobilities fall betweentheselines

CT\

AT.., /

/

AT

~

/TA--AA-AT

CA--AA--AT AA

/

GT

GA AA

GC GG

0.90 0.91 0.92 0.93 0.94 0.95 0.96 0.97 0.98 0.99 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07

1.08 1.09 1.10 1.11 1.12 1.13 1.14 1,15 1~16 1.17

AA

CC

\/ GC

1.18 1,19 1.20 1.21 1,22 1.23 124 1.25 1.26 1.27 1.28 129 130

[9]

D N A BENDING IN P R O T E I N - D N A COMPLEXES

137

method, which involves competitive reconstitution of different DNA sequences into nucleosomal core particles, using a labeled DNA fragment to compete against a standard unlabeled sample. The extent of incorporation is determined from the percentage of a labeled DNA fragment that is converted to nucleosomal complex, which is separated from free DNA by electrophoresis on a polyacrylamide gel. Methods

The artificial nucleosome positioning sequences used in this study are constructed by cloning multiple copies of synthesized oligonucleotides into a modified pGEM2 vector (Promega Biotech, Madison, WI). A unique, nonsymmetric AvaI restriction site is introduced into the original vector; AvaI cleavage of the site produces four-nucleotide, 5'-overhanging ends 36 that are complementary to each other but not self-complementary. Synthetic duplex oligonucleotides must have corresponding unique ends, each designed to hybridize with only one end of the cleaved vector, thus ensuring that all copies of the monomer assemble in a head-to-tail orientation rather than in a random manner. In addition to forcing direct repeats on ligation, the oligonucleotides are constructed with a complete AoaI recognition site at only one end; incomplete ends contain the proper four-nucleotide overhang but not the terminal recognition base pair. Direct repeat of these sequences produces a single AvaI site at one end of the multimer. As a result of recreation of a single endonuclease site, different types of oligonucleotides may be combined in a defined order by successive cloning steps. Oligonucleotides were synthesized on an Applied Biosystems (Foster City, CA) DNA synthesizer and purified by gel electrophoresis on 12% polyacrylamide gels in TBE buffer (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8.3) containing 50% (w/v) urea. This procedure removes most 3~ j. L. Hartley and T. J. Gregori, Gene 13, 347 (1981).

FIG. 11. S e q u e n c e d e p e n d e n c e of the mobility of C A P - D N A complexes. The dinucleotide estimated to confer the largest (bottom of the graph) and smallest (top of the graph) mobility on the C A P - D N A complex. The high-mobility s e q u e n c e s s h o w e x t r e m e s at positions - 10, - 11, and again at - 16, sites where the D N A minor and major grooves, respectively, face the protein. This observation implies m a x i m u m sensitivity of bending to s e q u e n c e at the positions where the D N A b e n d s alternately by roll into the minor and major grooves. Note that at positions - 10, - 11, the worst benders (greatest mobility) are the G/C-rich dinucleotides GC and CC, w h e r e a s the best b e n d e r s are A T and AT. At the - 16 locus A A is the worst bender a n d GC is the best. The wild-type s e q u e n c e is s h o w n near the middle line in the figure.

138

DNA BINDINGAND BENDING

[9]

of the longer and shorter oligonucleotides that represent - 1 0 % of a crude DNA synthesis. Approximately 10 OD26o units of oligonucleotide is loaded per gel lane. The correct oligonucleotide band is identified by its UV shadow, excised from the gel, and isolated by soaking the crushed gel slice 8 hr at 65 °. Acrylamide gel fragments are removed by two rounds of spinning the sample in an Eppendorf microfuge to pellet insoluble material. No further purification is required to anneal the single-stranded oligonucleotides and ligate the resulting duplexes into multimers. Ten micrograms of the purified single strands is phosphorylated using 2-5 U of T4 polynucleotide kinase in T4 ligase buffer (25 mM Tris, pH 7.8, 10 mM MgC12, 4 mM 2-mercaptoethanol, 0.4 mM ATP). The strands are then mixed and annealed by slow cooling from 90 to 4 °. Approximately 10/zg of the double-stranded oligonucleotide is polymerized by ligation for 15 min at room temperature (18-30 °) and the ligation mixture is separated on a 6% polyacrylamide TBE gel. The correct multimer bands are visualized by staining in a 1/zg/ml ethidium bromide solution (exposure to ethidium bromide is kept as short as possible, - 5 min) and purified as above. Multimers are cloned into the dephosphorylated asymmetric AvaI site of the pGEM2-Ava vector. One-half of the DNA isolated from each multimer band is used in the cloning step. Clones are screened first by restriction mapping and finally by dideoxy sequencing of DNA samples purified by the alkaline lysis method. 32 From the DNA isolated from 3 ml of an overnight growth of DH1 E. coli cells, 10% is required to restriction map and 40-50% is required for dideoxy sequencing. The sequences of the clones revealed that errors in the body of the multimer are extremely rare, while errors at the junction between the oligonucleotide multimer and the phosphatased vector occurred in 5-10% of the clones. For the clones to be used for nucleosome reconstitution, DNA from 0.5 liter of cells grown 12-24 hr is isolated by an expanded alkaline lysis procedure (technical manual, Promega Biotech). The average yield from this procedure was about 1 mg plasmid DNA/liter of cells. To purify a fragment for reconstitution, several different pairs of restriction enzymes are used. These enzymes remove the oligonucleotidecontaining section surrounded by enough flanking vector DNA to create a fragment of the overall correct size. The EcoRI and HindlII sites are separated by 62 bp in pGEM2/Ava. Excision of a fragment constructed of five repeats of a 20-bp oligonucleotide with these enzymes would produce a 162-bp fragment, suitable for mononucleosome reconstitution, which could be labeled at both ends by the Klenow fragment o f D N A polymerase I. To isolate fragments for footprinting studies, the pairs of enzymes EcoRI + PvulI or SacI + HindlII are used. These pairs of enzymes

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

139

generate fragments that can be singly end labeled by Klenow fragment of DNA polymerase I and an appropriate choice of 32p-labeled deoxynucleotide triphosphates. Digestions are made on - 5 0 / ~ g of plasmid DNA. A 5% polyacrylamide TBE gel is used to separate the insert from the vector. Inserts are visualized by their UV shadows and purified as above. Nucleosome reconstitution has recently been extensively rev i e w e d . 7'3°'37The competitive reconstitution procedure that we and others have used is similar to previous salt exchange procedures with the addition of bulk competitor DNA to lower the total protein-to-DNA ratio. 38 The general approach (Fig. 12) is to mix chromatin (lacking its linker histones) or core nucleosomes with a labeled DNA fragment at a high salt concentration, where the histone octamers are free to exchange. After a suitable incubation time the exchange is stopped by lowering the ionic strength to a level where the histones are locked in place. Our recipe involves mixing - 5 /xg of stripped chromatin 39 with 20 p~g of bulk DNA and 0.1 /xg of the labeled DNA fragment whose reconstitution is being tested. These components are incubated 30-45 min in 70/xl of buffer containing 1 M NaC1, 100/~g/ml albumin, and 0.1% Nonidet P-40. The ionic strength is lowered by three 210-/zl additions of low salt buffer [1 mM Tris (pH 8.0), 0.1 mM EDTA] to bring the final NaCI concentration to 0.1 M. The fraction of a DNA fragment that has been reconstituted into nucleosomes is determined by measuring the amount of radioactivity in the free and complexed band of a native polyacrylamide gel. This approach provides more information concerning possible degeneracy in the position of the histone octamer on the DNA fragment than agarose gels. We use a 5% gel [75 : 1 (w/w), acrylamide : N,N'-methylenebisacrylamide] to separate free from complexed DNA. In this system, as in others we have examined, a high acrylamide-to-bisacrylamide ratio produces the sharpest bands. The fraction of DNA reconstituted can be measured by using an autoradiogram of the dried gel to locate and excise the desired bands, which are then counted in a scintillation counter. Alternatively, the appropriate regions of the dried gels are counted directly on a Betascope 603 blot analyzer. Control experiments from several laboratories suggest that the fraction of nucleosomes that are reconstituted reflects the equilibrium binding ratios at 1 M NaC1. First, neither lengthening the time of incubation in high salt buffer, nor the rate at which the ionic strength is lowered, changes the ratio of labeled fragment that is reconstituted into nucleosomes.7 Sec37 S. D. Jayasena and M. J. Behe, J. Mol. Biol. 208, 320 (1986). 38 N. Ramsay, J. Mol. Biol. 189, 179 (1986). 39 L. C. Lutter, J. Mol. Biol. 124, 391 (1978).

140

D N A BINDING AND BENDING I~

I~

10bp

10bp

wl~

[9]

w I

10bp

~l

TCGGTGTTAGAGCCTGTAAC ACAATCTCGGACATTGAGCC G/C

A/T

G/C

A/T

Polymerize a n d clone p e n t a m e r into pGEM2-Ava.

EcoRI

PstI

32p Mix with stripped chromatin a n d free DNA. 1M ~ 0.25M - - 0.14 M 0.1M (NaCI)

5% Polyacrylamide gel.

J

FIG. 12. Design and testing of anisotropically flexible DNA sequences for favorable incorporation into nucleosomes. 7 The anisotropically flexible sequence TG is shown at the top, with emphasis on its alternation of A/T and G/C-rich regions every 5 bp. Head-to-tail clones of this sequence are excised as restriction fragments of - 1 7 0 bp, and subjected to a competitive salt gradient procedure for chromatin reconstitution, followed by analysis of the extent of nucleosome formation on a polyacrylamide gel.

[9l

D N A BENDING IN PROTEIN-DNA COMPLEXES

GT DNA

GT NUC

TR-5 DNA

TR-5 NUC

TG I

141

TR-5 I

I i

-- W E L L

~] COMPLEX

~FREE

Fl~. 13. Nucleosome reconstitution reflects equilibrium histone DNA binding. Fragments containing five copies of the GT (5'-TCGGGTTTAGAGCCTGTAAC-3') or the TR oligonucleotide (5'-TCGGAAGACTTGTCAACTGT-3')were reconstituted starting from free DNA on nucleosomal complexes. The fraction of a labeled fragment in the final nucleosomal complex is independent of its addition as free DNA (GT-DNA and TR-DNA) or as nearly completely complexed with histories (GT-NUC and TR-5-nuc). The nucleosomes used to add labeled fragments as preexisting complexes are shown in the two rightmost lanes. Additionally, it is clear that a very small fraction (3-5%) of the labeled DNA fragment exists in aggregrated forms that do not enter the gel. o n d , t h e s a m e final l a b e l e d n u c l e o s o m e - t o - l a b e l e d f r e e D N A r a t i o is r e a c h e d r e g a r d l e s s o f w h e t h e r t h e l a b e l e d f r a g m e n t is i n t r o d u c e d to t h e high salt i n c u b a t i o n as f r e e D N A o r in n u c l e o s o m a l c o m p l e x e s (Fig. 13). Finally, when a trace amount of labeled free nucleosomal DNA was incub a t e d in high salt w i t h o t h e r w i s e i d e n t i c a l u n l a b e l e d D N A a n d u n l a b e l e d n u c l e o s o m e s at s e v e r a l p r o t e i n to D N A r a t i o s , t h e final f r a c t i o n o f l a b e l e d

DNA

142

DNA BINDINGAND BENDING

[9]

nucleosomes, after the ionic strength was lowered, reflected the percentage of free DNA in the original mixture. 37 Results

To calibrate the size of the nucleosome positioning signal of our synthetic sequences, we determined the amount of anisotropically flexible DNA needed to mimic the histone binding affinities of some natural nucleosome positioning sequences. The fragments studied (Fig. 14) contain increasing amounts of artificial sequences roughly centered in fragments of nearly constant overall length. The molecule derived from two repeats of the 20-bp TG oligonucleotide in a 176-bp fragment binds histones as tightly as do the natural 5S RNA-encoding nucleosome-positioning DNA sequences. 4°'41 Interestingly, the required 40-bp synthetic region is approximately the size of the region identified as essential for positioning in some natural fragments. 39'42 In a second series of experiments we determined the optimal repeat of flexible A/T- and G/C-rich regions for histone binding. 3°'43 We reasoned that this optimum should coincide with the most favored helical repeat of DNA on the nucleosome, whose value remains a point of controversy. Based on nuclease cleavage patterns and periodicities extracted from sequencing data, nucleosomal DNA has long been argued to be overwound. 4,5,44 However, more recent experiments involving the reconstitution on nucleosomes on small DNA circles argue for an unaltered value of the DNA twist. 45'46 Our system of repeated oligonucleotides, for which precisely defined changes of the phasing of flexible regions can be made, offered a new approach to this problem. Figure 15 shows the series of oligonucleotides of differing lengths that were synthesized to study this problem. Nucleosomes were reconstituted onto DNA fragments containing five tandem repeats of each sequence; Fig. 15 shows the reconstitution energies, relative to a standard flexible sequence. The free energy minimum near a sequence repeat of 10.1 bp clearly supports the idea of DNA overwinding on the histone surface, 4o R. T. Simpson and D. W. Stafford, Proc. Natl. Acad. Sci. U.S.A. 80, 51 (1983). 41 D. Rhodes, EMBO J. 4, 3473 (1985). 42 p. C. Fitzgerald and R. T. Simpson, J. Biol. Chem. 260, 15318 (1985). 43 T. E. Shrader, Ph.D. Thesis, Yale University, New Haven, Connecticut (1990). 44 j. T. Finch, L. C. Lutter, D. Rhodes, R. S. Brown, B. Rushton, M. Levitt, and A. Klug, Nature (London) 269, 29 (1977). 45 I. Goulet, Y. Zivanovic, and A. Prunell, J. Mol. Biol. 200, 253 (1988). 46 Y. Zivanovic, I. Goulet, -. Revet, M. Le Bret, and A. Prunell, J. Mol. Biol. 200, 267 (1988).

[9]

DNA BENDING IN PROTEIN-DNA COMPLEXES

143

GT multimers (total length) l

I 520

Hexamer 183 bp

330

Pentamer 163 bp Tetramer 190 bp

660

280 [ 460

Trimer 170 bp Dimer 176 bp

1 kcal/mol

I

Monomer 43O

Lyt. var. 5S RNA Gene (SIM)

157 bp 2 kcal/mol ~

I

Somatic 5S RNA Gene (XLS) Trace Oocyte 5S RNA Gene (XLT)

Vector 136 bp

Mononucleosomal DNA (-165 bp)

3 kcal/mol FIG. 14. Nucleosome binding as a function of the length of anisotropically flexible DNA. 7 The free energies of reconstitution of three natural nucleosome-positioning sequences compared with designed sequences containing various lengths of flexible DNA. Sequences that reconstitute most favorably are at the top of the diagram. The binding of the best natural sequences can be mimicked with approximately 40 bp of repetitive DNA. Additionally, the binding free energy increment for each additional flexible region is quite constant. The total length of each multimer (vector DNA plus the indicated number of 20-bp GT oligonucleotides) is given below the multimer name. The difference in binding free energy between fragments is given at the extreme left. These free energies are all relative to the GT pentamer, which binds histones with essentially the same affinity as the TG pentamer. s i n c e the o p t i m a l r e p e a t is significantly s h o r t e r t h a n the 10.5- to 10.6-bp helical r e p e a t o f B - D N A in s o l u t i o n . 47'48 T h i s d i f f e r e n c e b e t w e e n o p t i m a l p h a s i n g for n u c l e o s o m e f o r m a t i o n a n d s o l u t i o n helical r e p e a t is too large to b e e x p l a i n e d solely o n the b a s i s o f the helical p a t h o f the D N A o n the n u c l e o s o m e surface. C o n s e q u e n t l y w e b e l i e v e that t h e r e is a t r u e c h a n g e 47 D. Rhodes and A. Klug, Nature (London) 292, 378 (1981). 48 L. J. Peck and J. C. Wang, Nature (London) 292, 375 (1981).

144

DNA BINDINGAND BENDING G/C

A

19 TG Fin

22

~,o ...... - & 0

A/T

[9] G/C

A/T

(9.5) : (10.0) :

TCGGTTTAGAGCCTGTAAC TCGGTGTTAGAGCCTGTAAC ( 1 0 . 5 ) : TCGGCTGTTAGAGCCTGTAAC (1 i.0) : TCGGCTGATTAGAGCCTGTAAC

B

E

t o

o

a C

~_

Z

u

U-

~

-

~_ E 0

0 o 0-

0 O-

i

9.5

?

1 0.0

10.5

FLIEX~B?LF:~ I4EP[~qF (bp)

r~'~ . ' ; t o B - q - 15

i

I 1.0

[9]

D N A BENDING IN PROTEIN-DNA COMPLEXES

145

A HindIII

BgllI

I B Central Oligonucleotide Region 18 b p 19 b p 20 b p (TG) 21 b p (FIN) 22 b p

Free Energy (cal/mol) - 150 - 150 - 200 - 750 - 250

FIG. 16. Helical repeat near the nucleosome dyad. 3° (A) Schematic sequence of fragments used to determine the helical repeat near the nucleosome dyad. Each BgFII plus HindIll fragment contains DNA sequences derived from five oligonucleotides. The two TG oligonucleotides and vector DNA at either end of each fragment make up contant regions, common to all sequences. The central region is variable and is derived from one of several oligonucleotides. (B) Central oligonucleotides for the molecules tested. Also given are reconstitution free energies relative to a fragment containing five 20-bp TG oligonucleotides. For the nucleotide sequences of the oligonucleotides, see Fig. l 1. Several of these sequences form nucleosomes more favorably than the reference sequence, including 20(TG), which contains the same oligonucleotide-derived region as the reference sequence. This is presumably due to the use of the pJC vector, rather than pGEMA2/ava, in the construction of these fragments.

F1G. 15. Optimal phasing of flexible regions.3° (A) Oligonucleotides used to determine the optimal phasing of flexible (A/T or G/C rich) regions for nucleosome reconstitution. Only the top strand of each molecule is shown. All oligonucleotides were double-stranded with 4-bp asymmetric AvaT overhangs. (B) Polyacrylamide gel of competitive reconstitution of fragments constructed from five copies of the above oligonucleotides centered in a fragment of -160- to 170-bp total length. From left to right, the fragments contain five copies of the oligonucleotides 19, TG, GT, FIN, and 22. The sequence of GT is identical to that of TG with inversion of the first TpG dinucleotide. These sequences (TG and GT) have essentially the same free energies of nucleosome reconstitution (---0). (C) Free energy of nucleosome reconstitution plotted as a function of flexible repeat. Flexible repeat is defined as one-half the length of the otigonucleotide monomer that makes up the central 95- to ll0-bp of each fragment. The curve represents a least-squares fit of a parabola to the data. Free energies are relative to the free energy for nucleosome reconstitution of a fragment containing five copies of the TG oligonucleotide. The minimum of the curve, at about 10.1 bp of the sequence repeat, should coincide with the preferred helical repeat of bending sites on DNA in nucleosomes.

146

DNA BINDINGAND BENDING

[10]

in average DNA twist as it is packaged into nucleosomes in the correct direction to lessen the "linking number paradox. ,,49,50 The degree of overwinding of DNA on the nucleosome surface determined from our experiments is similar to the values for this parameter measured in other studies. However, the appropriateness of a single average value for twist over the - 145 bp of nucleosomal DNA is unclear. Like the uneven bending of DNA seen in the nucleosomal crystal structure, 1 the overall DNA twist may be the average of disparate values from different regions of the structure. To explore the optimal repeat near the nucleosome dyad, the series of molecules depicted in Fig. 16 was constructed. These molecules all contain common vector sequences and two 40-bp "arms" derived from two copies of the TG oligonucleotide (10.0-bp sequence repeat), flanking a central region of variable length. The fragment containing the 21-bp central region reconstitutes most efficiently. The extra base pair, averaged over the 10 turns of DNA in the oligonucleotidederived region, adjusts the overall helical repeat from 10.0 to 10.1 bp, leading to optimal alignment for the 40-bp arms. The fragments containing 19-, 20-, or 22-bp central regions reconstitute less well. This suggests that the local value for the helical repeat near the nucleosome dyad is not more than 10.5 bp/turn, close to the average of 10.1 bp. White and W. R. Bauer, J. Mol. Biol. 1119, 329 (1986). 5oA. A. Travers and A. Klug, Philos. Trans. R. Soc. London B 317, 537 (1987). 49 j. H.

[10] F o o t p r i n t i n g P r o t e i n - D N A

Complexes in Vivo

B y SELINA SASSE-DWIGHT and JaY D. GRALLA

This chapter describes the use of primer extension procedures to probe nucleoprotein complexes in vivo in E s c h e r i c h i a coli and in vitro. Included are an overview of the procedure (when it is appropriate and what materials are required), a description of the choice and preparation of materials, step-by-step protocols for primer extension probing with dimethyl sulfate and potassium permanganate, and a troubleshooting guide. Overview of Primer Extension Probing The technique of primer extension footprinting analysis ~has been used for footprinting various regulatory regions in vitro on linear and sul j. D. Gralla, Proc. Natl. Acad. Sci. U.S.A. 82, 3078 (1985).