MECHANISMS
MICROBIAL DRUG RESISTANCE Volume 00, Number 00, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0176
Distribution of Class 1 Integrons, sul1 and sul2 Genes Among Clinical Isolates of Stenotrophomonas maltophilia from a Tertiary Care Hospital in North India Parvinder Kaur,1 Vikas Gautam,2 and Rupinder Tewari1
Stenotrophomonas maltophilia is an emerging nosocomial pathogen responsible for serious human infections. This study was carried out to determine antibiotic susceptibility, resistance mechanisms (integrons, sul1 and sul2), and genetic relatedness (Enterobacterial Repetitive Intergenic Consensus [ERIC]-PCR) among 106 clinical isolates of S. maltophilia from India. Twenty-four (22.6%) of S. maltophilia isolates exhibited resistance to mainstay antibiotic trimethoprim–sulfamethoxazole (TMP-SMX). Except for 2 isolates which contained both TMP-SMX resistance determinants sul1 and sul2 genes, all other 22 TMP-SMX-resistant isolates carried either sul1 (10 isolates) or sul2 (12 isolates) genes. Class 1 integrons were present in 8.5% (9 out of 106) of S. maltophilia isolates, and only 5 out of these isolates were TMP-SMX resistant and positive for sul1 gene. The same isolates also carried resistance cassettes containing qac/smr gene. Minocycline and levofloxacin exhibited the maximum in vitro activity against S. maltophilia. ERIC-PCR revealed high diversity among S. maltophilia isolates. The present study demonstrated high (22.4%) TMP-SMX resistance in clinical isolates of S. maltophilia from India. TMP-SMXresistant isolates carried relatively higher percentage of sul2 gene than sul1 gene as against the reported literature. Majority (58.3%) of sul1 gene positive were not associated with class 1 integrase gene.
in Latin America, and 9.2% in Asia Pacific regions.16 The resistance to this antibiotic has been attributed to the presence of sul1 and sul2 genes in class 1 integrons or plasmids in clinical isolates of S. maltophilia.2,22,39 In India, various case studies on S. maltophilia infections15,26,29,30,36,38,42 and a few studies on the antibiotic susceptibility pattern of S. maltophilia1,10,27,34 have been reported. However, to our knowledge there is no detailed report on the antibiotic resistance mechanisms and genotypic relatedness of S. maltophilia clinical isolates from India. Therefore, in the present study, we determined the prevalence of TMP-SMX resistance among S. maltophilia isolates and the molecular mechanisms associated with this drug resistance. In addition, the clonality among these isolates was deduced using Enterobacterial Repetitive Intergenic Consensus (ERIC)-polymerase chain reaction (PCR).
Introduction
S
tenotrophomonas maltophilia, a nonfermenting Gramnegative bacillus, is emerging as an opportunistic nosocomial pathogen, responsible for a broad range of serious human infections, including pneumonia, septicemia, wound sepsis, urinary tract infections, endocarditis, and meningitis, especially in immunocompromised patients. The problem is further compounded by the existence of an array of intrinsic and acquired resistance mechanisms to a wide range of commonly used antimicrobials. In acquired mechanisms, S. maltophilia can obtain resistance through integrons, transposons, and plasmids carrying multiple resistance genes.2 Integrons are nonself mobilizable genetic elements, which acquire multiple antibiotic resistance gene cassettes in between highly conserved nucleotide sequences by sitespecific integrase enzyme.21 Although trimethoprim–sulfamethoxazole (TMP-SMX) is a drug of choice for treating S. maltophilia infections in humans, owing to its good in vitro activity and favorable results in treated patients, there are scattered reports on the emergence of resistance to this antibiotic in clinical isolates, ranging from 1.1% in Europe, 2.4% in North America, 4.5% 1 2
Materials and Methods Bacterial isolates
A total of 106 clinical isolates of S. maltophilia were collected consecutively from 93 different patients admitted at the Post Graduate Institute of Medical Education and
Department of Microbial Biotechnology, Panjab University, Chandigarh, India. Department of Medical Microbiology, Postgraduate Institute of Medical Education and Research, Chandigarh, India.
1
2
KAUR ET AL.
Research (PGIMER), Chandigarh, India during a period of 2 years ( January, 2012–December, 2013). In this study, all these isolates were obtained from inpatients after ‡ 48 hr of admission. All the isolates were identified by biochemical tests,17 followed by species-specific PCR for confirmation, based on 23S rRNA conserved sequence, using primers SM15¢CAGCCTGCGAAAAGTA3¢ and SM4-5¢TTAAGCTTGC CACGAACAG3¢.43
electrophoretically using 1% agarose gel containing ethidium bromide in 1· TAE buffer at 100V for 1–2 hr. Images were captured using gel documentation system (Bio-Rad) to observe the amplified bands. Sequencing of purified PCR products was carried out using the 3730XL Sequencer (Eurofins). The gene sequences were analyzed by BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Molecular typing
Antibiotic susceptibility testing
The antimicrobial susceptibility of each isolate was performed by Kirby Bauer disk diffusion method4 and the minimum inhibitory concentrations (MICs) were determined by agar dilution methods13 against six antibiotics: TMP-SMX, minocycline, levofloxacin, ticarcillin–clavulanate, chloramphenicol, and ceftazidime. The zone diameters and the MICs obtained were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.14 The antibiotic discs and salts used for disk diffusion and agar dilution methods respectively were obtained from Himedia, Mumbai, India. Quality control strains were included in each batch of antimicrobial testing to ensure the accuracy of the results. The control strains used in this study were Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, and Staphylococcus aureus ATCC 29213 for antibiotic susceptibility testing. Amplification of integrons and sul genes
The bacterial isolates were screened for the presence of class 1, 2, and 3 integrons associated integrase (intI) genes as well as sul1 and sul2 genes by PCR using primers23,24,28 listed in Table 1. Gene cassettes embedded within class 1 integrons were also amplified with primers specific to 5¢ conserved segment (CS) and 3¢ CS25 (Table 1). All the PCR amplifications were carried out in a total volume of 25 ml containing 1· PCR buffer, 0.4 mM of each primer, 200 mM dNTPs, 1 U Taq DNA polymerase (Hi-fidelity; Fermentas) using Mastercycler nexus gradient (Eppendorf) with initial denaturation at 95C for 5 min, followed by 30 cycles of denaturation at 95C for 30 sec, annealing (Table 1) for 30 sec and extension at 72C for 30 sec–1 min depending on the sequence to be amplified and ended with final extension at 72C for 7 min. Amplicons so obtained were analyzed
ERIC-PCR fingerprint analysis was carried out to determine genetic relatedness among S. maltophilia isolates using the primers ERIC2 5¢-AAGTAAGTGACTGGGGTGAGCG3¢ and ERIC1r 5¢-ATGTAAGCTCCTGGGATTCAC-3¢ as previously described.41 The reaction mixture contained a total volume of 25 ml containing 1· PCR buffer, 3 mM MgCl2, 200 mM dNTPs, 50 pmol each primer and 1 U Taq DNA polymerase (Hi-fidelity; Fermentas). The thermocycling parameters consisted of first denaturation cycle at 95C for 7 min followed by 30 cycles of denaturation at 95C for 30 sec, annealing at 49C for 30 sec, extension at 72C for 8 min, and a final extension cycle at 72C for 8 min. Amplicons were separated on 2% agarose gel stained with ethidium bromide in 1· tris acetate buffer at 100 V for 3 hr. The cluster analysis was performed using the hierarchic Unweighted Pair Group Method with Arithmetic Mean (UPGMA) employing the TREECON software version 1.3b (Yves Van de Peer; University of Anterwerp, Belgium). Results Sample wise distribution of S. maltophilia clinical isolates
Maximum numbers of isolates were from blood (61.32%) followed by respiratory samples (26.41%), body fluid (4.72%), cerebrospinal fluid (2.83%), pus (0.94%), and urine (0.94%). Antibiotic susceptibility of S. maltophilia isolates
The results of antimicrobial susceptibility and (MICs) of S. maltophilia isolates to six antibiotics tested are listed in Table 2. Minocycline and levofloxacin exhibited the highest susceptibility of 95.3% and 94.3%, respectively, whereas susceptibility to mainstay antibiotic TMP-SMX was found
Table 1. Oligonucleotides Used for Integrons and sul Genes Polymerase Chain Reaction Primer
Sequence (5¢-3¢)
Target
Annealing temperature (C)
Product size (bp)
Reference
5¢ CS 3¢ CS Int1-F Int1-R Int2-F Int2-R Int3-F Int3-R sul1-F sul1-R sul2-F sul2-R
GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA CAGTGGACATAAGCCTGTTC CCCGAGGCATAGACTGTA GTAGCAAACGAGTGACGAAATG CACGGATATGCGACAAAAAGGT GCCTCCGGCAGCGACTTTCAG ACGGATCTGCCAAACCTGACT CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG GCGCTCAAGGCAGATGGCATT GCGTTTGATACCGGCACCCGT
Class 1 integron
55
Variable
25
Class 1 integrase
48
160
24
Class 2 integrase
55
788
28
Class 3 integrase
52
979
28
sul1
56
433
23
sul2
56
293
23
bp, base pair; CS, conserved segment; F, forward; R, reverse.
INTEGRONS AND
SUL
GENES IN S. MALTOPHILIA
3
Table 2. Antibiotic Susceptibility Pattern and Minimum Inhibitory Concentrations of Stenotrophomonas maltophilia Isolates Against Six Antibiotics Antibiotic TMP-SMX MIN LEVO TIC CHL CAZ
Sensitive n (%) 85 101 100 75 55 27
Resistant n (%)
(77.4) (95.3) (94.3) (70.8) (51.9) (25.5)
Intermediate n (%)
24 (22.6) 0 2 (1.9) 14 (13.2) 26 (24.5) 75 (70.7)
5 4 17 25 4
MIC50 (mg/L)
MIC90 (mg/L)
Range (mg/L)
1/19 0.5 1 8 8 64
‡ 32/608 2 2 128 ‡ 256 ‡ 256
£ 0.5/9.5 £ 0.125–8 £ 0.125–8 1–128 1– ‡ 256 2– ‡ 256
0 (4.7) (3.8) (16.0) (23.6) (3.8)
CAZ, ceftazidime; CHL, chloramphenicol; LEVO, levofloxacin; MIC, minimum inhibitory concentration; MIC50/90, MIC for 50% and 90% of the isolates, respectively; MINO, minocycline; n, number of isolates; TIC, ticarcillin–clavulanate; TMP-SMX, trimethoprim– sulfamethoxazole.
to be 77.4%. Ticarcillin–clavulanate, the second drug of choice, demonstrated susceptibility of 70.8% whereas chloramphenicol showed susceptibility of 51.9%. Ceftazidime exhibited the minimum susceptibility of 25.5%.
contained resistance gene cassettes of similar sizes and sequencing of PCR products of these gene cassettes revealed the presence of quaternary ammonium compound (QAC) resistance gene qac/smr.
Prevalence of integrons and sul genes
Molecular typing
In the present study, 24 out of 106 isolates were resistant to TMP-SMX with MIC ‡ 32/608 mg/L, except for 1 isolate which had MIC of 16/304 mg/L. The presence of sul1 gene (433 bp) and sul2 gene (293 bp) was detected by PCR in 12 (50%) and 14 (58.3%) of TMP-SMX-resistant isolates, respectively. Except for 2 isolates (50 and 54), which contained both the genes, all other 22 TMP-SMX-resistant isolates carried either sul1 or sul2 gene (Table 3). TMP-SMX-sensitive isolates were not found to carry sul1 and sul2 genes. The presence of class 1, 2, and 3 integrons was detected by PCR with class-specific primers to integrase (intI) genes. IntI1 gene (160 bp) was detected in 9 (8.5%) of the 106 S. maltophilia isolates, thereby suggesting the presence of class 1 integrons in S. maltophilia. However, intI1 gene was present in only 5 of 12 sul1 gene-positive isolates resistant to TMP-SMX. The remaining four class 1 integrase-positive isolates were sensitive to TMP-SMX. None of the isolates were found positive for class 2 and 3 integrons by PCR specific to intI2 and intI3 genes, respectively. Of the nine class 1 integrase-positive isolates, resistance gene cassettes were found in five of S. maltophilia isolates, which were also resistant to TMP-SMX (Table 3). All five
In the present study, genetic relatedness among the isolates was determined by ERIC-PCR. One hundred and six clinical isolates of S. maltophilia generated 96 different ERIC-PCR patterns, revealing high diversity among the isolates (Fig. 1). The isolates from the same patients either from the same specimens (i.e., 29, 32, and 45; 7, and 34; 41, and 106; 48, 54, 76, and 80) or from different specimens (i.e., 17 and 18) but taken at different intervals of time had similar ERIC-PCR pattern, except in three cases. In a patient admitted in the cardiothoracic and vascular surgery intensive care unit (CTVS-ICU), among three isolates (i.e., 10, 44, and 47) isolates 44 and 47, which were isolated with a difference of 5 days had similar ERIC-PCR pattern. But the pattern was different from isolate 10, which was isolated 22 days before the latter isolate. Isolate 10 also had a different susceptibility pattern as it was resistant to TMP-SMX, whereas other 2 isolates were sensitive to TMP-SMX. In another patient admitted in the main ICU suffering from sepsis, three isolates (i.e., 23, 40, and 53) were isolated from the patient. Two of these isolates (i.e., 40 and 53) had similar ERIC-PCR pattern isolated at a difference of 9 days, whereas isolate 23 had different ERIC-PCR pattern, which was isolated
Table 3. Distribution of intI1, Gene Cassettes, and sul Genes Among Trimethoprim–Sulfamethoxazole-Resistant S. maltophilia Isolates S. No. 1 2 3 4 5 6 7 8 9 10 11 12
Isolates No.
MIC of TMP-SMX (mg/L)
intI1
Gene cassette
sul1
sul2
5, 9, 46 6 10, 23, 48 37, 40, 51, 53, 86, 96, 99 50 54, 76, 80 62 63 64 67 95 100
‡ 32/608 16/304 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608
+ + + -
+ + + -
+ + + + + + + + -
+ + + + + +
( + ), presence; ( - ), absence.
Resistance profile CAZ, TMP-SMX CAZ, TMP-SMX CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, TMP-SMX, CHL CAZ, TMP-SMX, TMP-SMX
CHL CHL, TIC LEVO, CHL CHL CHL, TIC LEVO, CHL CHL CHL, TIC
4
KAUR ET AL.
1 month before the latter isolate. The isolates (i.e., 19 and 103) from the same patient, but isolated from different specimens (respiratory and pus) also had different ERIC-PCR pattern. Multiple isolates from different wards presented unique ERICPCR pattern at different intervals of time. Discussion
FIG. 1. Dendrogram generated based on the ERIC-PCR fingerprints of clinical isolates of Stenotrophomonas maltophilia (n = 106). ERIC, Enterobacterial Repetitive Intergenic Consensus.
The emergence of S. maltophilia as nosocomial pathogen in hospitals is a cause of concern. In the current study, the majority of the isolates obtained were from blood followed by respiratory samples. S. maltophilia is the fourth most common nonfermenting Gram-negative bacilli obtained from blood cultures at PGIMER and the same has been reported previously.1,34 This is in contrast to the majority of literature available, wherein most of the S. maltophilia isolates have been reported from respiratory samples and less percentage from blood.19,22,31 With respect to antibiotic susceptibility pattern, minocycline exhibited the highest susceptibility as also reported by other workers.12,31,44 However, the scarcity of the clinical studies with minocycline limits its use in treating S. maltophilia infections. Levofloxacin also showed good in vitro activity and this antibiotic has been suggested by Cho et al.11 to be a suitable option for treating S. maltophilia infections. With regard to the antibiotic ticarcillin–clavulanate, a worldwide study across North America, Europe, Asia Pacific, and Latin America reported 27.0% to 46.1% S. maltophilia isolates susceptible to this antibiotic.16 However, present data showed S. maltophilia susceptibility of 70.8% to ticarcillin–clavulanate, which is in agreement with previous findings.32 In literature,32 the susceptibility profile of S. maltophilia against chloramphenicol varied from 11.5% to 81.4% and in the current study 51.9% of S. maltophilia isolates were found susceptible to this antibiotic. Ceftazidime exhibited the least susceptibility, a finding that was in agreement with previous literature, where studies reported a high rate of resistance to this antibiotic because of inducible b lactamases.32 Currently, TMP-SMX is a drug of choice for the treatment of S. maltophilia infections as the organism is highly susceptible to this antibiotic.5 However, reports have started pouring in from various countries on the development of TMP-SMX resistance in S. maltophilia. The results from SENTRY Antimicrobial Surveillance Program in 2009– 2012 showed that 3.7% and 2.3% of S. maltophilia strains were resistant to TMP-SMX across USA and European regions, respectively.33 Reports from Argentina and Malaysia showed less than 1% resistance to TMP-SMX.2,31 However, studies from Taiwan and China demonstrated 25% and 30.4% resistance to TMP-SMX in S. maltophilia isolates, respectively.8,22 In India a 13.4% resistance to TMP-SMX in S. maltophilia had been reported from a tertiary care centre in Karnataka10 and an increasing trend of TMP-SMX resistance (9–30%) was observed in a study from tertiary care centre in Chandigarh.1 In the present study, TMP-SMX resistance was found to be 22.6% among S. maltophilia isolates. Since TMP-SMX is the drug of choice for treating S. maltophilia infections, development of resistance to this antibiotic is a cause of concern. In S. maltophilia resistance to TMP-SMX has been associated with two allelic forms, sul1 and sul2 genes, located independently either on a chromosome or plasmid. They
INTEGRONS AND
SUL
GENES IN S. MALTOPHILIA
often reside on a nonself mobilizable genetic element called integron and are transferred between bacterial cells through transposons and plasmids.6,21,22,39 As per literature, the prevalence of sul2 gene in S. maltophilia isolates has been reported to be less than sul1 gene.22,39 Interestingly, our results are contrary to this observation as we found higher percentage of sul2 (58.3%) than sul1 (50%) in TMP-SMXresistant S. maltophilia isolates. In S. maltophilia, the majority of studies have reported that sul1 gene in TMP-SMX-resistant isolates is associated with class 1 integrons.2,8,22,35,39 In the present study class 1 integrase gene was found absent in the majority of sul1 positive TMP-SMX-resistant isolates. These outcomes suggest that either class 1 integron have lost sul1 gene region in strains used in this study or these genes are present on other genetic elements as previously reported by Gundogdu et al.20 None of the isolates was found positive for class 2 and 3 integrons. These findings were in agreement with previous studies, which also reported the absence of class 2 and class 3 integrons in S. maltophilia isolates.8,22 Furthermore, resistance gene cassettes embedded within class 1 integrons were found only in five of nine class 1 integrase-positive S. maltophilia isolates and contained QAC resistance genes qac/smr, these isolates were also resistant to TMP-SMX. It has been reported that, in natural environments, resistance to antibiotics is coselected with resistance to QAC.18 In S. maltophilia, the presence of QAC resistance genes such as qac/smr on integrons have been significantly found associated with TMP-SMX resistance.8 Therefore, the use of biocides containing QACs might increase the risk of TMP-SMX resistance in hospital settings. Molecular typing by ERIC-PCR showed high diversity among the S. maltophilia isolates. These findings are in agreement with previous studies revealing high diversity among clinical isolates when the same typing technique ERIC-PCR was used7,9,19 or when pulse field gel electrophoresis (PFGE) was used.3,19,37,40 In one of the studies, where both of these techniques were used, PFGE was found to be more discriminatory as compared with ERIC-PCR, but ERIC-PCR is rapid, easy, less labor intensive and economical method of typing.19 In conclusion, the findings of the current study demonstrated high resistance to TMP-SMX among genetically diverse S. maltophilia isolates in India, which reinforces the need for ongoing resistance surveillance in the hospital settings. These resistant isolates carry relatively higher percentage of sul2 gene than sul1 gene as against previously reported. Moreover, majority of sul1-gene positive TMPSMX-resistant isolates did not carry class 1 integrase gene, thus indicating the location of sul1 gene on other genetic elements. Minocycline and levofloxacin exhibited good in vitro activity and they can be suitable alternatives for treating S. maltophilia infections in the Indian settings. Acknowledgment
This research was funded in the form of research fellowship to the first author by the Department of Science and Technology, Ministry of India, through the INSPIRE scheme. Disclosure Statement
No competing financial interests exist.
5 References
1. Arora, S., V. Gautam, and P. Ray. 2012. Changing susceptibility patterns of nonfermenting Gram negative bacilli. Indian J. Med. Microbiol. 30:485–486. 2. Barbolla, R., M. Catalano, B.E. Orman, A. Famiglietti, C. Vay, J. Smayevsky, D. Centron, and S.A. Pineiro. 2004. Class 1 integrons increases trimethoprim-sulphamethaxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 48:666–669. 3. Barchitta, M., R. Cipresso, L. Giaquinta, M.A. Romeo, C. Denaro, C. Penaisi, and A. Agodi. 2009. Acquisition and spread of Acinetobacter baumannii and Stenotrophomonas maltophilia in intensive care patients. Int. J. Hyg. Environ. Health 212:330–337. 4. Bauer, A.W., W.M. Kirby, J.C. Sherries, and M. Turck. 1966. Antimicrobial susceptibility testing by a standarized single disc method. Am. J. Clin. Pathol. 45:493–496. 5. Brooke, J.S. 2012. Stenotrophomonas maltophilia: an emerging global opportunistic pathogen. Clin. Microbiol. Rev. 25:2–41. 6. Carattoli, A. 2003. Plasmid mediated antimicrobial resistance in Salmonella enteric. Curr. Issues Mol. Biol. 5:113– 122. 7. Caylan, R., N. Kaklikkaya, K. Aydin, F. Aydin, G. Yilmaz, B. Ozgumus, and I. Koksal. 2004. An epidemiological analysis of Stenotrophomonas maltophilia Strains in a University Hospital. Jpn. J. Infect. Dis. 57:37–40. 8. Chang, L.L., H.H. Lin, C.Y. Chang, and P.L. Lu. 2007. Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole resistant clinical isolates of Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 59:1038–1039. 9. Chatelut, M., J.L. Dournes, G. Chabanon, and N. Marty. 1995. Epidemiological typing of Stenotrophomonas (Xanthomonas) maltophilia by PCR. J. Clin. Microbiol. 33:912–914. 10. Chawla, K., S. Vishwanath, and F.C. Munim. 2013. Nonfermenting Gram-negative Bacilli other than Pseudomonas aeruginosa and Acinetobacter Spp. Causing Respiratory Tract infections in a Tertiary Care Center. J. Glob. Infect. Dis. 5:144–148. 11. Cho, S.Y., C.I. Kang, J. Kim, Y.E. Ha, D.R. Chung, N.Y. Lee, K.R. Peck, and J.H. Song. 2014. Can levofloxacin be a useful alternative to trimethoprim-sulphamethaxazole for treating Stenotrophomonas maltophilia bacteremia? Antimicrob. Agents Chemother. 58:581–583. 12. Chung, H.S., S.G. Hong, and Y. Chong. 2013. Antimicrobial susceptibilities of Stenotrophomonas maltophilia isolates from Korea, and the activity of antimicrobial combinations against the isolates. J. Korean Med. Sci. 28: 62–66. 13. [CLSI] Clinical and Laboratory Standards Institute. 2012. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically: Approved Standards. Ninth Edition. Clinical and Laboratory Standards Institute, Wayne, PA, M07-A9. 14. [CLSI] Clinical and Laboratory Standards Institute. 2014. Performance Standards for Antimicrobial Susceptibility Testing. Twenty fourth Information Supplement. Clinical and Laboratory Standards Institute, Wayne, PA, M100-S24. 15. Das, T., H.S. Deshmukh, A. Mathai, and A.K. Reddy. 2009. Stenotrophomonas maltophilia endogenous endophthalmitis: clinical presentation, sensitivity spectrum and management. J. Med. Microbiol. 58:837–838. 16. Farrell, D.J., H.S. Sader, and R.N. Jones. 2010. Antimicrobial susceptibilities of a worldwide collection of
6
17.
18.
19.
20.
21. 22.
23.
24.
25.
26.
27. 28.
29.
30.
31.
KAUR ET AL.
Stenotrophomonas maltophilia isolates tested against tigecycline and agents commonly used for S. maltophilia infections. Antimicrob. Agents Chemother. 54:2735–2737. Gautam, V., P. Ray, P. Vandamme, S.S. Chatterjee, A. Das, K. Sharma, S. Rana, K. Garg, S.K. Madhup, M. Mahajan, and M. Sharma. 2009. Identification of lysine positive non-fermenting Gram negative bacilli (Stenotrophomonas maltophilia and Burkholderia cepacia complex). Indian J. Med. Microbiol. 27:128–133. Gaze, W.H., N. Abdouslam, P.M. Hawkey, and E.M.H. Wellington. 2005. Incidence of class 1 integrons in quaternary ammonium compound-polluted environment. Antimicrob. Agents Chemother. 49:1802–1807. Gulmez, D., and G. Hascelik. 2005. Stenotrophomonas maltophilia: antimicrobial resistance and molecular typing of an emerging pathogen in a Turkish university hospital. Clin. Microbiol. Infect. 11:880–886. Gundogdu, A., Y.B. Long, T.L. Vollmerhausen, and M. Katouli. 2011. Antimicrobial resistance and distribution of sul genes and integron associated intl genes among uropathogenic Escherichia coli in Queensland, Australia. J. Med. Microbiol. 60:1633–1642. Hall, R.M., and C.M. Collis. 1998. Antibiotic resistance in Gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist. 1:109–119. Hu, L. F., X. Chang, Y. Ye, Z.X. Wang, Y.B. Shao, W. Shi, X. Li, and J.B. Li. 2011. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents 37:230–234. Kerrn, M.B., T. Klemmensen, N. Frimodt-Moller, and F. Espersen. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50:513–516. Koeleman, J.G., J. Stoof, M.W. Van Der Bijl, C.M. Vandenbroucke-Grauls, and P.H. Savelkoul. 2001. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol. 39:8–13. Levesque, C., L. Piche, C. Larose, and P.H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191. Mahendradas, P., K. Avadhani, V. Anandula, and R. Shetty. 2012. Unilateral conjunctival ulcer due to Stenotrophomonas maltophilia infection. Indian J. Ophthalmol. 60:134–136. Malini, A., E.K. Deepa, and S.R. Prasad. 2009. Nonfermenting Gram-Negative Bacilli infections in a Tertiary Care Hospital in Kolar, Karnataka. J. Lab. Physicians 1:62–66. Mazel, D., B. Dychinco, V.A. Webb, and J. Davies. 2000. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 44:1568–1574. Mukhopadhyay, C., A. Bhargava, and A. Ayyagari. 2003. Novel nosocomial infections by Stenotrophomonas maltophilia: first reported case from Lucknow, North India. J. Clin. Microbiol. 41:3989–3990. Nag, F., A. De, K. Banerjee, and G. Chatterjee. 2013. Non healing leg ulcer infected with Stenotrophomonas maltophilia: first reported case from India. Int. Wound J. 10:356–358. Neela, V., S.Z. Rankouhi, A. van Belkum, R.V. Goering, and R. Awang. 2012. Stenotrophomonas maltophilia in
32. 33.
34.
35.
36. 37.
38. 39.
40.
41.
42. 43.
44.
Malaysia: molecular epidemiology and trimethoprim-sulfamethoxazole resistance. Int. J. Infect. Dis. 16:603–607. Nicodemo, A.C., and J. I. Paez. 2007. Antimicrobial therapy for Stenotrophomonas maltophilia infections. Eur. J. Clin. Microbiol. Infect. Dis. 26:229–237. Sader, H.S., D.J. Farrel, R.K. Flamm, and R.N. Jones. 2014. Antimicrobial susceptibilities of Gram negative organisms isolated from patients hospitalized with pneumonia in US and European hospital: results from the SENTRY Antimicrobial Surveillance Program, 2009–2012. Int. J. Antimicrob. Agents 43:328–334. Samanta, P., V. Gautam, R. Thapar, and P. Ray. 2011. Emerging resistance of non fermenting Gram-negative Bacilli in a tertiary care centre. Indian J. Pathol. Microbiol. 54:666–667. Song, J. H., J.Y. Sung, K.C. Kwon, J.W. Park, H.H. Cho, S.Y. Shin, Y.H. Ko, J.M. Kim, K.S. Shin, and S.H. Koo. 2010. Analysis of acquired resistance genes in Stenotrophomonas maltophilia. Korean J. Lab. Med. 30:295–300. Sood, S., V.K. Vaid, and H. Bhartiya. 2013. Meningitis due to Stenotrophomonas maltophilia after a neurosurgical procedure. J. Clin. Diagn. Res. 7:1696–1697. Tan, C.K., S.J. Liaw, C.J. Yu, L.J. Teng, and P.R. Hsueh. 2008. Extensively drug resistant Stenotrophomonas maltophilia in a tertiary care hospital in Taiwan: microbiologic characteristics, clinical features, and outcomes. Diagn. Microbiol. Infect. Dis. 60:205–210. Thomas, J., V.N. Prabhu, I. R. Varaprasad, S. Agarwal, and G. Narsimulu. 2010. Stenotrophomonas maltophilia: a very rare cause of tropical pyomyositis. Int. J. Rheum. Dis. 13:89–90. Toleman, M.A., P.M. Bennett, D.M. Bennett, R.N. Jones, and T.R. Walsh. 2007. Global emergence of trimethoprim/ sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg. Infect. Dis. 13:559–565. Valdezate, S., A. Vindel, P. Martin-Davila, B.S. Del Saz, F. Baquero, and R. Canton. 2004. High genetic diversity among Stenotrophomonas maltophilia strains despite their originating at a single hospital. J. Clin. Microbiol. 42:693–699. Versalovic, J., T. Koeuth, and R.J. Lupski. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genome. Nucleic Acids Res. 19:6823–6831. Viswanathan, R., A.K. Singh, C. Ghosh, and S. Basu. 2011. Stenotrophomonas maltophilia causing early onset neonatal sepsis. Indian Pediatr. 48:397–399. Whitby, P.W., K.B. Carter, J.L. Burns, J.A. Royall, J.J. LiPuma, and T.L. Stull. 2000. Identification and detection of Stenotrophomonas maltophilia by rRNA-directed PCR. J. Clin. Microbiol. 38:4305–4309. Wu, H., J. T. Wang, Y. R. Shiau, H.Y. Wang, T.L. Lauderdale, and S.C. Chang. 2012. A multicenter surveillance of antimicrobial resistance on Stenotrophomonas maltophilia in Taiwan. J. Microbiol. Immunol. Infect. 45:120–126.
Address correspondence to: Rupinder Tewari, PhD Department of Microbial Biotechnology Panjab University Sector 14 Chandigarh 160014 India E-mail: [email protected]
MICROBIAL DRUG RESISTANCE Volume 00, Number 00, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0176
Distribution of Class 1 Integrons, sul1 and sul2 Genes Among Clinical Isolates of Stenotrophomonas maltophilia from a Tertiary Care Hospital in North India Parvinder Kaur,1 Vikas Gautam,2 and Rupinder Tewari1
Stenotrophomonas maltophilia is an emerging nosocomial pathogen responsible for serious human infections. This study was carried out to determine antibiotic susceptibility, resistance mechanisms (integrons, sul1 and sul2), and genetic relatedness (Enterobacterial Repetitive Intergenic Consensus [ERIC]-PCR) among 106 clinical isolates of S. maltophilia from India. Twenty-four (22.6%) of S. maltophilia isolates exhibited resistance to mainstay antibiotic trimethoprim–sulfamethoxazole (TMP-SMX). Except for 2 isolates which contained both TMP-SMX resistance determinants sul1 and sul2 genes, all other 22 TMP-SMX-resistant isolates carried either sul1 (10 isolates) or sul2 (12 isolates) genes. Class 1 integrons were present in 8.5% (9 out of 106) of S. maltophilia isolates, and only 5 out of these isolates were TMP-SMX resistant and positive for sul1 gene. The same isolates also carried resistance cassettes containing qac/smr gene. Minocycline and levofloxacin exhibited the maximum in vitro activity against S. maltophilia. ERIC-PCR revealed high diversity among S. maltophilia isolates. The present study demonstrated high (22.4%) TMP-SMX resistance in clinical isolates of S. maltophilia from India. TMP-SMXresistant isolates carried relatively higher percentage of sul2 gene than sul1 gene as against the reported literature. Majority (58.3%) of sul1 gene positive were not associated with class 1 integrase gene.
in Latin America, and 9.2% in Asia Pacific regions.16 The resistance to this antibiotic has been attributed to the presence of sul1 and sul2 genes in class 1 integrons or plasmids in clinical isolates of S. maltophilia.2,22,39 In India, various case studies on S. maltophilia infections15,26,29,30,36,38,42 and a few studies on the antibiotic susceptibility pattern of S. maltophilia1,10,27,34 have been reported. However, to our knowledge there is no detailed report on the antibiotic resistance mechanisms and genotypic relatedness of S. maltophilia clinical isolates from India. Therefore, in the present study, we determined the prevalence of TMP-SMX resistance among S. maltophilia isolates and the molecular mechanisms associated with this drug resistance. In addition, the clonality among these isolates was deduced using Enterobacterial Repetitive Intergenic Consensus (ERIC)-polymerase chain reaction (PCR).
Introduction
S
tenotrophomonas maltophilia, a nonfermenting Gramnegative bacillus, is emerging as an opportunistic nosocomial pathogen, responsible for a broad range of serious human infections, including pneumonia, septicemia, wound sepsis, urinary tract infections, endocarditis, and meningitis, especially in immunocompromised patients. The problem is further compounded by the existence of an array of intrinsic and acquired resistance mechanisms to a wide range of commonly used antimicrobials. In acquired mechanisms, S. maltophilia can obtain resistance through integrons, transposons, and plasmids carrying multiple resistance genes.2 Integrons are nonself mobilizable genetic elements, which acquire multiple antibiotic resistance gene cassettes in between highly conserved nucleotide sequences by sitespecific integrase enzyme.21 Although trimethoprim–sulfamethoxazole (TMP-SMX) is a drug of choice for treating S. maltophilia infections in humans, owing to its good in vitro activity and favorable results in treated patients, there are scattered reports on the emergence of resistance to this antibiotic in clinical isolates, ranging from 1.1% in Europe, 2.4% in North America, 4.5% 1 2
Materials and Methods Bacterial isolates
A total of 106 clinical isolates of S. maltophilia were collected consecutively from 93 different patients admitted at the Post Graduate Institute of Medical Education and
Department of Microbial Biotechnology, Panjab University, Chandigarh, India. Department of Medical Microbiology, Postgraduate Institute of Medical Education and Research, Chandigarh, India.
1
2
KAUR ET AL.
Research (PGIMER), Chandigarh, India during a period of 2 years ( January, 2012–December, 2013). In this study, all these isolates were obtained from inpatients after ‡ 48 hr of admission. All the isolates were identified by biochemical tests,17 followed by species-specific PCR for confirmation, based on 23S rRNA conserved sequence, using primers SM15¢CAGCCTGCGAAAAGTA3¢ and SM4-5¢TTAAGCTTGC CACGAACAG3¢.43
electrophoretically using 1% agarose gel containing ethidium bromide in 1· TAE buffer at 100V for 1–2 hr. Images were captured using gel documentation system (Bio-Rad) to observe the amplified bands. Sequencing of purified PCR products was carried out using the 3730XL Sequencer (Eurofins). The gene sequences were analyzed by BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Molecular typing
Antibiotic susceptibility testing
The antimicrobial susceptibility of each isolate was performed by Kirby Bauer disk diffusion method4 and the minimum inhibitory concentrations (MICs) were determined by agar dilution methods13 against six antibiotics: TMP-SMX, minocycline, levofloxacin, ticarcillin–clavulanate, chloramphenicol, and ceftazidime. The zone diameters and the MICs obtained were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.14 The antibiotic discs and salts used for disk diffusion and agar dilution methods respectively were obtained from Himedia, Mumbai, India. Quality control strains were included in each batch of antimicrobial testing to ensure the accuracy of the results. The control strains used in this study were Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, and Staphylococcus aureus ATCC 29213 for antibiotic susceptibility testing. Amplification of integrons and sul genes
The bacterial isolates were screened for the presence of class 1, 2, and 3 integrons associated integrase (intI) genes as well as sul1 and sul2 genes by PCR using primers23,24,28 listed in Table 1. Gene cassettes embedded within class 1 integrons were also amplified with primers specific to 5¢ conserved segment (CS) and 3¢ CS25 (Table 1). All the PCR amplifications were carried out in a total volume of 25 ml containing 1· PCR buffer, 0.4 mM of each primer, 200 mM dNTPs, 1 U Taq DNA polymerase (Hi-fidelity; Fermentas) using Mastercycler nexus gradient (Eppendorf) with initial denaturation at 95C for 5 min, followed by 30 cycles of denaturation at 95C for 30 sec, annealing (Table 1) for 30 sec and extension at 72C for 30 sec–1 min depending on the sequence to be amplified and ended with final extension at 72C for 7 min. Amplicons so obtained were analyzed
ERIC-PCR fingerprint analysis was carried out to determine genetic relatedness among S. maltophilia isolates using the primers ERIC2 5¢-AAGTAAGTGACTGGGGTGAGCG3¢ and ERIC1r 5¢-ATGTAAGCTCCTGGGATTCAC-3¢ as previously described.41 The reaction mixture contained a total volume of 25 ml containing 1· PCR buffer, 3 mM MgCl2, 200 mM dNTPs, 50 pmol each primer and 1 U Taq DNA polymerase (Hi-fidelity; Fermentas). The thermocycling parameters consisted of first denaturation cycle at 95C for 7 min followed by 30 cycles of denaturation at 95C for 30 sec, annealing at 49C for 30 sec, extension at 72C for 8 min, and a final extension cycle at 72C for 8 min. Amplicons were separated on 2% agarose gel stained with ethidium bromide in 1· tris acetate buffer at 100 V for 3 hr. The cluster analysis was performed using the hierarchic Unweighted Pair Group Method with Arithmetic Mean (UPGMA) employing the TREECON software version 1.3b (Yves Van de Peer; University of Anterwerp, Belgium). Results Sample wise distribution of S. maltophilia clinical isolates
Maximum numbers of isolates were from blood (61.32%) followed by respiratory samples (26.41%), body fluid (4.72%), cerebrospinal fluid (2.83%), pus (0.94%), and urine (0.94%). Antibiotic susceptibility of S. maltophilia isolates
The results of antimicrobial susceptibility and (MICs) of S. maltophilia isolates to six antibiotics tested are listed in Table 2. Minocycline and levofloxacin exhibited the highest susceptibility of 95.3% and 94.3%, respectively, whereas susceptibility to mainstay antibiotic TMP-SMX was found
Table 1. Oligonucleotides Used for Integrons and sul Genes Polymerase Chain Reaction Primer
Sequence (5¢-3¢)
Target
Annealing temperature (C)
Product size (bp)
Reference
5¢ CS 3¢ CS Int1-F Int1-R Int2-F Int2-R Int3-F Int3-R sul1-F sul1-R sul2-F sul2-R
GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA CAGTGGACATAAGCCTGTTC CCCGAGGCATAGACTGTA GTAGCAAACGAGTGACGAAATG CACGGATATGCGACAAAAAGGT GCCTCCGGCAGCGACTTTCAG ACGGATCTGCCAAACCTGACT CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG GCGCTCAAGGCAGATGGCATT GCGTTTGATACCGGCACCCGT
Class 1 integron
55
Variable
25
Class 1 integrase
48
160
24
Class 2 integrase
55
788
28
Class 3 integrase
52
979
28
sul1
56
433
23
sul2
56
293
23
bp, base pair; CS, conserved segment; F, forward; R, reverse.
INTEGRONS AND
SUL
GENES IN S. MALTOPHILIA
3
Table 2. Antibiotic Susceptibility Pattern and Minimum Inhibitory Concentrations of Stenotrophomonas maltophilia Isolates Against Six Antibiotics Antibiotic TMP-SMX MIN LEVO TIC CHL CAZ
Sensitive n (%) 85 101 100 75 55 27
Resistant n (%)
(77.4) (95.3) (94.3) (70.8) (51.9) (25.5)
Intermediate n (%)
24 (22.6) 0 2 (1.9) 14 (13.2) 26 (24.5) 75 (70.7)
5 4 17 25 4
MIC50 (mg/L)
MIC90 (mg/L)
Range (mg/L)
1/19 0.5 1 8 8 64
‡ 32/608 2 2 128 ‡ 256 ‡ 256
£ 0.5/9.5 £ 0.125–8 £ 0.125–8 1–128 1– ‡ 256 2– ‡ 256
0 (4.7) (3.8) (16.0) (23.6) (3.8)
CAZ, ceftazidime; CHL, chloramphenicol; LEVO, levofloxacin; MIC, minimum inhibitory concentration; MIC50/90, MIC for 50% and 90% of the isolates, respectively; MINO, minocycline; n, number of isolates; TIC, ticarcillin–clavulanate; TMP-SMX, trimethoprim– sulfamethoxazole.
to be 77.4%. Ticarcillin–clavulanate, the second drug of choice, demonstrated susceptibility of 70.8% whereas chloramphenicol showed susceptibility of 51.9%. Ceftazidime exhibited the minimum susceptibility of 25.5%.
contained resistance gene cassettes of similar sizes and sequencing of PCR products of these gene cassettes revealed the presence of quaternary ammonium compound (QAC) resistance gene qac/smr.
Prevalence of integrons and sul genes
Molecular typing
In the present study, 24 out of 106 isolates were resistant to TMP-SMX with MIC ‡ 32/608 mg/L, except for 1 isolate which had MIC of 16/304 mg/L. The presence of sul1 gene (433 bp) and sul2 gene (293 bp) was detected by PCR in 12 (50%) and 14 (58.3%) of TMP-SMX-resistant isolates, respectively. Except for 2 isolates (50 and 54), which contained both the genes, all other 22 TMP-SMX-resistant isolates carried either sul1 or sul2 gene (Table 3). TMP-SMX-sensitive isolates were not found to carry sul1 and sul2 genes. The presence of class 1, 2, and 3 integrons was detected by PCR with class-specific primers to integrase (intI) genes. IntI1 gene (160 bp) was detected in 9 (8.5%) of the 106 S. maltophilia isolates, thereby suggesting the presence of class 1 integrons in S. maltophilia. However, intI1 gene was present in only 5 of 12 sul1 gene-positive isolates resistant to TMP-SMX. The remaining four class 1 integrase-positive isolates were sensitive to TMP-SMX. None of the isolates were found positive for class 2 and 3 integrons by PCR specific to intI2 and intI3 genes, respectively. Of the nine class 1 integrase-positive isolates, resistance gene cassettes were found in five of S. maltophilia isolates, which were also resistant to TMP-SMX (Table 3). All five
In the present study, genetic relatedness among the isolates was determined by ERIC-PCR. One hundred and six clinical isolates of S. maltophilia generated 96 different ERIC-PCR patterns, revealing high diversity among the isolates (Fig. 1). The isolates from the same patients either from the same specimens (i.e., 29, 32, and 45; 7, and 34; 41, and 106; 48, 54, 76, and 80) or from different specimens (i.e., 17 and 18) but taken at different intervals of time had similar ERIC-PCR pattern, except in three cases. In a patient admitted in the cardiothoracic and vascular surgery intensive care unit (CTVS-ICU), among three isolates (i.e., 10, 44, and 47) isolates 44 and 47, which were isolated with a difference of 5 days had similar ERIC-PCR pattern. But the pattern was different from isolate 10, which was isolated 22 days before the latter isolate. Isolate 10 also had a different susceptibility pattern as it was resistant to TMP-SMX, whereas other 2 isolates were sensitive to TMP-SMX. In another patient admitted in the main ICU suffering from sepsis, three isolates (i.e., 23, 40, and 53) were isolated from the patient. Two of these isolates (i.e., 40 and 53) had similar ERIC-PCR pattern isolated at a difference of 9 days, whereas isolate 23 had different ERIC-PCR pattern, which was isolated
Table 3. Distribution of intI1, Gene Cassettes, and sul Genes Among Trimethoprim–Sulfamethoxazole-Resistant S. maltophilia Isolates S. No. 1 2 3 4 5 6 7 8 9 10 11 12
Isolates No.
MIC of TMP-SMX (mg/L)
intI1
Gene cassette
sul1
sul2
5, 9, 46 6 10, 23, 48 37, 40, 51, 53, 86, 96, 99 50 54, 76, 80 62 63 64 67 95 100
‡ 32/608 16/304 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608 ‡ 32/608
+ + + -
+ + + -
+ + + + + + + + -
+ + + + + +
( + ), presence; ( - ), absence.
Resistance profile CAZ, TMP-SMX CAZ, TMP-SMX CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, CAZ, TMP-SMX, TMP-SMX, CHL CAZ, TMP-SMX, TMP-SMX
CHL CHL, TIC LEVO, CHL CHL CHL, TIC LEVO, CHL CHL CHL, TIC
4
KAUR ET AL.
1 month before the latter isolate. The isolates (i.e., 19 and 103) from the same patient, but isolated from different specimens (respiratory and pus) also had different ERIC-PCR pattern. Multiple isolates from different wards presented unique ERICPCR pattern at different intervals of time. Discussion
FIG. 1. Dendrogram generated based on the ERIC-PCR fingerprints of clinical isolates of Stenotrophomonas maltophilia (n = 106). ERIC, Enterobacterial Repetitive Intergenic Consensus.
The emergence of S. maltophilia as nosocomial pathogen in hospitals is a cause of concern. In the current study, the majority of the isolates obtained were from blood followed by respiratory samples. S. maltophilia is the fourth most common nonfermenting Gram-negative bacilli obtained from blood cultures at PGIMER and the same has been reported previously.1,34 This is in contrast to the majority of literature available, wherein most of the S. maltophilia isolates have been reported from respiratory samples and less percentage from blood.19,22,31 With respect to antibiotic susceptibility pattern, minocycline exhibited the highest susceptibility as also reported by other workers.12,31,44 However, the scarcity of the clinical studies with minocycline limits its use in treating S. maltophilia infections. Levofloxacin also showed good in vitro activity and this antibiotic has been suggested by Cho et al.11 to be a suitable option for treating S. maltophilia infections. With regard to the antibiotic ticarcillin–clavulanate, a worldwide study across North America, Europe, Asia Pacific, and Latin America reported 27.0% to 46.1% S. maltophilia isolates susceptible to this antibiotic.16 However, present data showed S. maltophilia susceptibility of 70.8% to ticarcillin–clavulanate, which is in agreement with previous findings.32 In literature,32 the susceptibility profile of S. maltophilia against chloramphenicol varied from 11.5% to 81.4% and in the current study 51.9% of S. maltophilia isolates were found susceptible to this antibiotic. Ceftazidime exhibited the least susceptibility, a finding that was in agreement with previous literature, where studies reported a high rate of resistance to this antibiotic because of inducible b lactamases.32 Currently, TMP-SMX is a drug of choice for the treatment of S. maltophilia infections as the organism is highly susceptible to this antibiotic.5 However, reports have started pouring in from various countries on the development of TMP-SMX resistance in S. maltophilia. The results from SENTRY Antimicrobial Surveillance Program in 2009– 2012 showed that 3.7% and 2.3% of S. maltophilia strains were resistant to TMP-SMX across USA and European regions, respectively.33 Reports from Argentina and Malaysia showed less than 1% resistance to TMP-SMX.2,31 However, studies from Taiwan and China demonstrated 25% and 30.4% resistance to TMP-SMX in S. maltophilia isolates, respectively.8,22 In India a 13.4% resistance to TMP-SMX in S. maltophilia had been reported from a tertiary care centre in Karnataka10 and an increasing trend of TMP-SMX resistance (9–30%) was observed in a study from tertiary care centre in Chandigarh.1 In the present study, TMP-SMX resistance was found to be 22.6% among S. maltophilia isolates. Since TMP-SMX is the drug of choice for treating S. maltophilia infections, development of resistance to this antibiotic is a cause of concern. In S. maltophilia resistance to TMP-SMX has been associated with two allelic forms, sul1 and sul2 genes, located independently either on a chromosome or plasmid. They
INTEGRONS AND
SUL
GENES IN S. MALTOPHILIA
often reside on a nonself mobilizable genetic element called integron and are transferred between bacterial cells through transposons and plasmids.6,21,22,39 As per literature, the prevalence of sul2 gene in S. maltophilia isolates has been reported to be less than sul1 gene.22,39 Interestingly, our results are contrary to this observation as we found higher percentage of sul2 (58.3%) than sul1 (50%) in TMP-SMXresistant S. maltophilia isolates. In S. maltophilia, the majority of studies have reported that sul1 gene in TMP-SMX-resistant isolates is associated with class 1 integrons.2,8,22,35,39 In the present study class 1 integrase gene was found absent in the majority of sul1 positive TMP-SMX-resistant isolates. These outcomes suggest that either class 1 integron have lost sul1 gene region in strains used in this study or these genes are present on other genetic elements as previously reported by Gundogdu et al.20 None of the isolates was found positive for class 2 and 3 integrons. These findings were in agreement with previous studies, which also reported the absence of class 2 and class 3 integrons in S. maltophilia isolates.8,22 Furthermore, resistance gene cassettes embedded within class 1 integrons were found only in five of nine class 1 integrase-positive S. maltophilia isolates and contained QAC resistance genes qac/smr, these isolates were also resistant to TMP-SMX. It has been reported that, in natural environments, resistance to antibiotics is coselected with resistance to QAC.18 In S. maltophilia, the presence of QAC resistance genes such as qac/smr on integrons have been significantly found associated with TMP-SMX resistance.8 Therefore, the use of biocides containing QACs might increase the risk of TMP-SMX resistance in hospital settings. Molecular typing by ERIC-PCR showed high diversity among the S. maltophilia isolates. These findings are in agreement with previous studies revealing high diversity among clinical isolates when the same typing technique ERIC-PCR was used7,9,19 or when pulse field gel electrophoresis (PFGE) was used.3,19,37,40 In one of the studies, where both of these techniques were used, PFGE was found to be more discriminatory as compared with ERIC-PCR, but ERIC-PCR is rapid, easy, less labor intensive and economical method of typing.19 In conclusion, the findings of the current study demonstrated high resistance to TMP-SMX among genetically diverse S. maltophilia isolates in India, which reinforces the need for ongoing resistance surveillance in the hospital settings. These resistant isolates carry relatively higher percentage of sul2 gene than sul1 gene as against previously reported. Moreover, majority of sul1-gene positive TMPSMX-resistant isolates did not carry class 1 integrase gene, thus indicating the location of sul1 gene on other genetic elements. Minocycline and levofloxacin exhibited good in vitro activity and they can be suitable alternatives for treating S. maltophilia infections in the Indian settings. Acknowledgment
This research was funded in the form of research fellowship to the first author by the Department of Science and Technology, Ministry of India, through the INSPIRE scheme. Disclosure Statement
No competing financial interests exist.
5 References
1. Arora, S., V. Gautam, and P. Ray. 2012. Changing susceptibility patterns of nonfermenting Gram negative bacilli. Indian J. Med. Microbiol. 30:485–486. 2. Barbolla, R., M. Catalano, B.E. Orman, A. Famiglietti, C. Vay, J. Smayevsky, D. Centron, and S.A. Pineiro. 2004. Class 1 integrons increases trimethoprim-sulphamethaxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 48:666–669. 3. Barchitta, M., R. Cipresso, L. Giaquinta, M.A. Romeo, C. Denaro, C. Penaisi, and A. Agodi. 2009. Acquisition and spread of Acinetobacter baumannii and Stenotrophomonas maltophilia in intensive care patients. Int. J. Hyg. Environ. Health 212:330–337. 4. Bauer, A.W., W.M. Kirby, J.C. Sherries, and M. Turck. 1966. Antimicrobial susceptibility testing by a standarized single disc method. Am. J. Clin. Pathol. 45:493–496. 5. Brooke, J.S. 2012. Stenotrophomonas maltophilia: an emerging global opportunistic pathogen. Clin. Microbiol. Rev. 25:2–41. 6. Carattoli, A. 2003. Plasmid mediated antimicrobial resistance in Salmonella enteric. Curr. Issues Mol. Biol. 5:113– 122. 7. Caylan, R., N. Kaklikkaya, K. Aydin, F. Aydin, G. Yilmaz, B. Ozgumus, and I. Koksal. 2004. An epidemiological analysis of Stenotrophomonas maltophilia Strains in a University Hospital. Jpn. J. Infect. Dis. 57:37–40. 8. Chang, L.L., H.H. Lin, C.Y. Chang, and P.L. Lu. 2007. Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole resistant clinical isolates of Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 59:1038–1039. 9. Chatelut, M., J.L. Dournes, G. Chabanon, and N. Marty. 1995. Epidemiological typing of Stenotrophomonas (Xanthomonas) maltophilia by PCR. J. Clin. Microbiol. 33:912–914. 10. Chawla, K., S. Vishwanath, and F.C. Munim. 2013. Nonfermenting Gram-negative Bacilli other than Pseudomonas aeruginosa and Acinetobacter Spp. Causing Respiratory Tract infections in a Tertiary Care Center. J. Glob. Infect. Dis. 5:144–148. 11. Cho, S.Y., C.I. Kang, J. Kim, Y.E. Ha, D.R. Chung, N.Y. Lee, K.R. Peck, and J.H. Song. 2014. Can levofloxacin be a useful alternative to trimethoprim-sulphamethaxazole for treating Stenotrophomonas maltophilia bacteremia? Antimicrob. Agents Chemother. 58:581–583. 12. Chung, H.S., S.G. Hong, and Y. Chong. 2013. Antimicrobial susceptibilities of Stenotrophomonas maltophilia isolates from Korea, and the activity of antimicrobial combinations against the isolates. J. Korean Med. Sci. 28: 62–66. 13. [CLSI] Clinical and Laboratory Standards Institute. 2012. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically: Approved Standards. Ninth Edition. Clinical and Laboratory Standards Institute, Wayne, PA, M07-A9. 14. [CLSI] Clinical and Laboratory Standards Institute. 2014. Performance Standards for Antimicrobial Susceptibility Testing. Twenty fourth Information Supplement. Clinical and Laboratory Standards Institute, Wayne, PA, M100-S24. 15. Das, T., H.S. Deshmukh, A. Mathai, and A.K. Reddy. 2009. Stenotrophomonas maltophilia endogenous endophthalmitis: clinical presentation, sensitivity spectrum and management. J. Med. Microbiol. 58:837–838. 16. Farrell, D.J., H.S. Sader, and R.N. Jones. 2010. Antimicrobial susceptibilities of a worldwide collection of
6
17.
18.
19.
20.
21. 22.
23.
24.
25.
26.
27. 28.
29.
30.
31.
KAUR ET AL.
Stenotrophomonas maltophilia isolates tested against tigecycline and agents commonly used for S. maltophilia infections. Antimicrob. Agents Chemother. 54:2735–2737. Gautam, V., P. Ray, P. Vandamme, S.S. Chatterjee, A. Das, K. Sharma, S. Rana, K. Garg, S.K. Madhup, M. Mahajan, and M. Sharma. 2009. Identification of lysine positive non-fermenting Gram negative bacilli (Stenotrophomonas maltophilia and Burkholderia cepacia complex). Indian J. Med. Microbiol. 27:128–133. Gaze, W.H., N. Abdouslam, P.M. Hawkey, and E.M.H. Wellington. 2005. Incidence of class 1 integrons in quaternary ammonium compound-polluted environment. Antimicrob. Agents Chemother. 49:1802–1807. Gulmez, D., and G. Hascelik. 2005. Stenotrophomonas maltophilia: antimicrobial resistance and molecular typing of an emerging pathogen in a Turkish university hospital. Clin. Microbiol. Infect. 11:880–886. Gundogdu, A., Y.B. Long, T.L. Vollmerhausen, and M. Katouli. 2011. Antimicrobial resistance and distribution of sul genes and integron associated intl genes among uropathogenic Escherichia coli in Queensland, Australia. J. Med. Microbiol. 60:1633–1642. Hall, R.M., and C.M. Collis. 1998. Antibiotic resistance in Gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist. 1:109–119. Hu, L. F., X. Chang, Y. Ye, Z.X. Wang, Y.B. Shao, W. Shi, X. Li, and J.B. Li. 2011. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents 37:230–234. Kerrn, M.B., T. Klemmensen, N. Frimodt-Moller, and F. Espersen. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50:513–516. Koeleman, J.G., J. Stoof, M.W. Van Der Bijl, C.M. Vandenbroucke-Grauls, and P.H. Savelkoul. 2001. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol. 39:8–13. Levesque, C., L. Piche, C. Larose, and P.H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191. Mahendradas, P., K. Avadhani, V. Anandula, and R. Shetty. 2012. Unilateral conjunctival ulcer due to Stenotrophomonas maltophilia infection. Indian J. Ophthalmol. 60:134–136. Malini, A., E.K. Deepa, and S.R. Prasad. 2009. Nonfermenting Gram-Negative Bacilli infections in a Tertiary Care Hospital in Kolar, Karnataka. J. Lab. Physicians 1:62–66. Mazel, D., B. Dychinco, V.A. Webb, and J. Davies. 2000. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 44:1568–1574. Mukhopadhyay, C., A. Bhargava, and A. Ayyagari. 2003. Novel nosocomial infections by Stenotrophomonas maltophilia: first reported case from Lucknow, North India. J. Clin. Microbiol. 41:3989–3990. Nag, F., A. De, K. Banerjee, and G. Chatterjee. 2013. Non healing leg ulcer infected with Stenotrophomonas maltophilia: first reported case from India. Int. Wound J. 10:356–358. Neela, V., S.Z. Rankouhi, A. van Belkum, R.V. Goering, and R. Awang. 2012. Stenotrophomonas maltophilia in
32. 33.
34.
35.
36. 37.
38. 39.
40.
41.
42. 43.
44.
Malaysia: molecular epidemiology and trimethoprim-sulfamethoxazole resistance. Int. J. Infect. Dis. 16:603–607. Nicodemo, A.C., and J. I. Paez. 2007. Antimicrobial therapy for Stenotrophomonas maltophilia infections. Eur. J. Clin. Microbiol. Infect. Dis. 26:229–237. Sader, H.S., D.J. Farrel, R.K. Flamm, and R.N. Jones. 2014. Antimicrobial susceptibilities of Gram negative organisms isolated from patients hospitalized with pneumonia in US and European hospital: results from the SENTRY Antimicrobial Surveillance Program, 2009–2012. Int. J. Antimicrob. Agents 43:328–334. Samanta, P., V. Gautam, R. Thapar, and P. Ray. 2011. Emerging resistance of non fermenting Gram-negative Bacilli in a tertiary care centre. Indian J. Pathol. Microbiol. 54:666–667. Song, J. H., J.Y. Sung, K.C. Kwon, J.W. Park, H.H. Cho, S.Y. Shin, Y.H. Ko, J.M. Kim, K.S. Shin, and S.H. Koo. 2010. Analysis of acquired resistance genes in Stenotrophomonas maltophilia. Korean J. Lab. Med. 30:295–300. Sood, S., V.K. Vaid, and H. Bhartiya. 2013. Meningitis due to Stenotrophomonas maltophilia after a neurosurgical procedure. J. Clin. Diagn. Res. 7:1696–1697. Tan, C.K., S.J. Liaw, C.J. Yu, L.J. Teng, and P.R. Hsueh. 2008. Extensively drug resistant Stenotrophomonas maltophilia in a tertiary care hospital in Taiwan: microbiologic characteristics, clinical features, and outcomes. Diagn. Microbiol. Infect. Dis. 60:205–210. Thomas, J., V.N. Prabhu, I. R. Varaprasad, S. Agarwal, and G. Narsimulu. 2010. Stenotrophomonas maltophilia: a very rare cause of tropical pyomyositis. Int. J. Rheum. Dis. 13:89–90. Toleman, M.A., P.M. Bennett, D.M. Bennett, R.N. Jones, and T.R. Walsh. 2007. Global emergence of trimethoprim/ sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg. Infect. Dis. 13:559–565. Valdezate, S., A. Vindel, P. Martin-Davila, B.S. Del Saz, F. Baquero, and R. Canton. 2004. High genetic diversity among Stenotrophomonas maltophilia strains despite their originating at a single hospital. J. Clin. Microbiol. 42:693–699. Versalovic, J., T. Koeuth, and R.J. Lupski. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genome. Nucleic Acids Res. 19:6823–6831. Viswanathan, R., A.K. Singh, C. Ghosh, and S. Basu. 2011. Stenotrophomonas maltophilia causing early onset neonatal sepsis. Indian Pediatr. 48:397–399. Whitby, P.W., K.B. Carter, J.L. Burns, J.A. Royall, J.J. LiPuma, and T.L. Stull. 2000. Identification and detection of Stenotrophomonas maltophilia by rRNA-directed PCR. J. Clin. Microbiol. 38:4305–4309. Wu, H., J. T. Wang, Y. R. Shiau, H.Y. Wang, T.L. Lauderdale, and S.C. Chang. 2012. A multicenter surveillance of antimicrobial resistance on Stenotrophomonas maltophilia in Taiwan. J. Microbiol. Immunol. Infect. 45:120–126.
Address correspondence to: Rupinder Tewari, PhD Department of Microbial Biotechnology Panjab University Sector 14 Chandigarh 160014 India E-mail: [email protected]
