1521-009X/42/2/264–273$25.00 DRUG METABOLISM AND DISPOSITION Copyright ª 2013 by The American Society for Pharmacology and Experimental Therapeutics

http://dx.doi.org/10.1124/dmd.113.054551 Drug Metab Dispos 42:264–273, February 2014

Distinct Patterns of Aging Effects on the Expression and Activity of Carboxylesterases in Rat Liver and Intestine Kayoko Ohura, Katsumi Tasaka, Mitsuru Hashimoto, and Teruko Imai Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto, Japan (K.O., K.T., T.I.) and Faculty of Pharmaceutical Science, Matsuyama University, Ehime, Japan (M.H.) Received August 27, 2013; accepted November 21, 2013

ABSTRACT decreased in an age-dependent manner, accompanied by downregulation of Hydrolase B/C mRNA, while age-independent hydrolysis of propranolol derivatives was observed in rat liver, due to the contribution of Egasyn. Rat small intestine expresses one major CES2 (RL4) and four minor CESs (Hydrolase B, Hydrolase C, Egasyn, and AY034877). Interestingly, the expression of RL4 was age-dependently increased in both jejunum and ileum, while minor isozymes showed a constant expression across a wide age range. The up-regulation of RL4 expression with aging led to an increase of intestinal hydrolase activities for temocapril and propranolol derivatives. Consequently, age-dependent changes in the expression of CES isozymes affect the hydrolysis of xenobiotics in both rat liver and small intestine.

Introduction

AY034877, have been identified. The amino acid sequence homology of these rat CES isozymes is shown in Fig. 1. All CES1 and CES2 isozymes exhibit similar subunit molecular weights (58–61 kDa) and are present as monomers or trimers (Satoh and Hosokawa, 1998). As with many other metabolizing enzymes, the expression of CES is regulated by hormones, disease mediators, and xenobiotics. For example, phenobarbital moderately induces Hydrolase A and Hydrolase B in rat liver (Morgan et al., 1994). In contrast, dexamethasone suppresses Hydrolase A, Hydrolase B, and Hydrolase S (also known as ES-1, a plasma CES1 isozyme; Shi et al., 2008), while it induces RL4 (Furihata et al., 2005). It has also been reported that hydrolase activity changes in an agedependent manner. For example, the hepatic intrinsic clearance of the pyrethroid deltamethrin through hydrolysis is increased with age; 10and 40-day-old rats show only 3% and 21% of the activity of 90-dayold rats, while its intrinsic clearance from plasma reaches maximum activity at 40 days (Anand et al., 2006). In the same rats, the hepatic intrinsic clearance of the pyrethroid deltamethrin, through oxidation by cytochrome P450 (P450), reaches maximum activity in 40-day-old rats. Karanth and Pope (2000) reported that hepatic activity against p-nitrophenyl acetate (PNPA) increases with age in rats and reaches maximum activity at 90 days, maintaining this level of activity up to 24 months, while maximal activity in plasma is reached at 90 days and has decreased by 24 months. These alterations of hydrolase activity are dependent on the expression of esterases. However, there are only limited data on the age-dependent variation of expression of rat CES isozymes. While 1- to 2-week-old rats express very low levels of Hydrolase A and

Carboxylesterase (CES, EC 3.1.1.1) is a member of the family of serine esterases, which play important roles in drug metabolism in various mammalian tissues (Satoh and Hosokawa, 1998; Satoh et al., 2002). Mammalian CESs comprise a multigene family, and their isozymes are classified into five groups based on the homology of their amino acid sequences (Satoh and Hosokawa, 2006). CES1 and CES2 families are responsible for the activation of ester and amide prodrugs and the detoxification of xenobiotics (Takai et al., 1997; Imai, 2006). Mammalian CES1 isozymes are highly expressed in most organs, while CES2 enzymes are present in a limited number of organs, such as gastrointestinal tract, kidney, and liver (Hosokawa, 2008). The hepatic and intestinal CES isozymes are principally responsible for the metabolism of ester compounds and affect the disposition of prodrugs after oral administration (Imai and Hosokawa, 2010; Imai and Ohura, 2010). Although the tissue distribution of CES1 and CES2 isozymes differs among mammals (Taketani et al., 2007), human and rat isozymes show similar expression patterns in the liver and intestine. In both human and rat, the majority of CES family enzymes in the liver and intestine are CES1 and CES2 isozymes, respectively. In man, hCE1 and hCE2 are CES1 and CES2 isozymes, respectively. In contrast, four CES1 isozymes are present in rat: Hydrolase A (also known as RH1, ES-10), Hydrolase B (also known as RL1, ES-4), Hydrolase C, and Egasyn (also known as RL2, ES-3). For rat CES2 isozymes, one major CES2 isozyme, RL4, and two minor CES2 isozymes, D50580 and dx.doi.org/10.1124/dmd.113.054551.

ABBREVIATIONS: BNPP, bis-p-nitrophenyl phosphate; CES, carboxylesterase; DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HPLC, high-performance liquid chromatography; P450, cytochrome P450; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; PL, propranolol; PNPA, p-nitrophenyl acetate. 264

Downloaded from dmd.aspetjournals.org at Univ of Illinois at Chicago Library on February 4, 2014

The age-associated alteration in expression levels of carboxylesterases (CESs) can affect both intestinal and hepatic first-pass metabolism after oral administration of xenobiotic esters such as prodrugs. In this study, the age-related expression of CES isozymes and hydrolase activities were simultaneously investigated in liver, jejunum, and ileum from 8-, 46-, and 90-week-old rats. Rat liver expresses three major CES1 isozymes, Hydrolase A, Hydrolase B, and Hydrolase C, as well as one minor CES1 (Egasyn) and three minor CES2 isozymes (RL4, AY034877, and D50580). The mRNA and protein levels of major hepatic CES1 isozymes were decreased in an age-dependent manner, while those of minor CESs were maintained in all age groups. The hepatic hydrolase activity for temocapril was

Age-Related Rat Hepatic and Intestinal CES Expression

Fig. 1. Phylogenetic tree for rat CES isozymes. A phylogenetic tree was created for rat CES isozymes using CLUSTALW. The percentage in parentheses indicates the amino acid sequence homology compared with Hydrolase A. a), GenBank accession number.

Hydrolase B in the liver, these levels abruptly increase at 3 weeks in both male and female rats (Morgan et al., 1994). In contrast, it has been reported that the hepatic mRNA levels of Hydrolase A and Hydrolase C are significantly decreased in 84-week-old rats compared with 32-week-old rats (Mori et al., 2007). Differences in regulation of mouse hepatic CES isozymes between neonatal (10-day-old) and adult (70-day-old) mice have also been reported. Mouse Ces1d activity was preserved, Ces1e and Ces2c were upregulated, and Ces2e was downregulated by aging (Xiao et al., 2012). Alteration of enzyme expression level by aging in not only liver but also intestine results in variations in the pharmacokinetics and pharmacodynamics of drugs. However, the age dependence of the regulation of CES expression in the intestine is rarely reported, and the age dependence of tissue hydrolase activity and CES expression is seldom evaluated simultaneously in the same rats. In the present study, we focused on age-dependent expression of CES1 and CES2 isozymes in the liver and intestine of 8- to 90-week-old rats. The mRNA levels were measured by real-time polymerase chain reaction (PCR) and tissue hydrolase activities in the same rats were measured using PNPA, a-naphthyl acetate, temocapril, and propranolol (PL) derivatives as substrates.

Materials and Methods PNPA, p-nitrophenol, a-naphthyl acetate, and bis-p-nitrophenyl phosphate (BNPP) were purchased from Nacalai Tesque, Inc. (Kyoto, Japan). Temocapril and temocaprilat were provided by Daiichi Sankyo Company, Ltd. (Tokyo, Japan). Anti-Egasyn antibody was a kind gift from Dr. M. Hosokawa (Chiba Institute of Science, Chosi, Chiba, Japan). PL ester hydrochloride derivatives were synthesized from PL hydrochloride (Wako Pure Chemical Industries, Ltd., Osaka, Japan) as described previously (Shameem et al., 1993). The identities and purities of the synthesized chemicals were confirmed by infrared spectroscopy, nuclear magnetic resonance spectroscopy, atomic analysis, and high-performance liquid chromatography (HPLC). All other chemicals and reagents were of analytical grade. Animals. Male Wistar (7-week-old) rats were supplied by Kyudo Co., Ltd. (Saga, Japan). All rats (7- to 90-week-old) were maintained under standard conditions with a 12-hour dark/light cycle. Commercial chow and water were available ad libitum. Animals were fasted (with free access to water) for 15 hours before the experiments. All animal experimental protocols were approved by the Ethics Review Committee for Animal Experimentation of Kumamoto University. Preparation of Rat Tissue Homogenate 9000g Supernatant and Microsomal Fraction. The tissue homogenate 9000g supernatant (S9) and microsomal fractions were prepared according to a previously described procedure (Taketani et al., 2007). All rats (8-week-old, 240–250 g; 46-weekold, 720–850 g; 90-week-old, 740–900 g) were sacrificed by exsanguination

265

from the abdominal aorta under deep ether anesthesia. The jejunal and ileal segments were removed and cut open. After washing the luminal side with icecold 0.15 M KCl, the intestinal mucosa was stripped from the muscle layer. The inferior vena cava was cannulated, and the liver perfused with ice-cold 0.15 M KCl. The stripped intestinal mucosa and liver were finely minced and homogenized with three volumes of 50 mM HEPES buffer (pH 7.4) containing 0.15 M KCl in a Potter-Elvehjem glass homogenizer. The homogenates were centrifuged at 9000g for 20 minutes at 4°C to obtain the S9 fraction. The S9 fraction was further centrifuged at 100,000g for 1 hour at 4°C. To prepare microsomes, the resulting pellets were resuspended in 50 mM HEPES buffer containing 0.15 M KCl. Protein contents were determined with bovine serum albumin (BSA) as the standard (Bradford, 1976). These preparations were stored at –80°C until use. RNA Extraction and Quantification of mRNA Expression. Total RNA was isolated from rat liver and intestinal mucosa using TRIzol reagent (Life Technologies Japan Ltd., Tokyo, Japan), according to the manufacturer’s specifications. First-strand cDNA was synthesized using Oligo(dT) or random primer with ReverTraAce (Toyobo, Osaka, Japan). The endogenous control and CES isozymes analyzed by relative real-time quantitative PCR are listed in Table 1. Their protein names, UniProt accession numbers, gene symbols, and GenBank accession numbers are also given in Fig. 1 and Table 1. Real-time quantitative PCR was performed using the Bio-Rad iCycler iQ real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA) with SYBR Premix Ex Taq II (Takara Bio Inc., Shiga, Japan) and the specific primers listed in Table 1. As Hydrolase B is very similar to Hydrolase C (amino acid sequence homology 93%), Hydrolase B/C mRNA was measured using primers with identical nucleotide sequences. Similarly, RL4/AB010632 mRNA was measured as the same enzyme, since AB010632 identified from rat intestine by Sone et al. (unpublished data) is almost identical to the RL4 purified from the liver (homology 95%). Thermal cycling conditions were 95°C for 3 minutes, followed by 40 cycles of 95°C for 10 seconds, 55°C for 30 seconds. Reactions were carried out in triplicate. Relative mRNA levels were calculated by the 2–DCt method (Livak and Schmittgen, 2001). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was commonly used as a reference gene in the liver and small intestine. The stable expression level of GAPDH in the three different age groups was confirmed using normalization of GAPDH levels by b-actin and 18S ribosomal RNA levels (unpublished data). Staining for Esterase Activity. Staining for esterase activity followed native polyacrylamide gel electrophoresis (PAGE) as previously described (Taketani et al., 2007). Briefly, liver microsomal protein and intestinal S9 protein were loaded onto a 7.5% gel. After electrophoresis at 200 V for 1 hour, the bands containing esterase were stained by complex formulation between Fast Red TR hemi(zinc chloride) salt, a dyeing agent, and a-naphthol produced by hydrolysis of a-naphthyl acetate, a substrate of esterase. Measurement of Hydrolase Activity. The chemical structure of PNPA, temocapril, and the PL derivatives used as substrates in the hydrolysis experiments are shown in Fig. 2. Liver microsomes or small intestinal S9 were diluted with 50 mM HEPES buffer (pH 7.4) at an appropriate protein concentration. After preincubation of the microsomes or S9 solution for 5 minutes at 37°C, the reaction was started by adding the substrate dissolved in dimethyl sulfoxide (DMSO). The final concentration of DMSO was maintained at ,1.0%, which had no effect on the hydrolase activity. The initial hydrolytic activity was measured under reaction conditions in which less than 25% of substrate was hydrolyzed. For the hydrolysis of PNPA, the reaction was initiated by the addition of PNPA (final concentration 15–500 mM), and the formation of p-nitrophenol was spectrophotometrically determined by the initial linear increase in absorbance at 405 nm (V-530; Jasco International Co. Ltd., Tokyo, Japan). For the hydrolysis of temocapril, the reaction was terminated by adding an equal volume of ice-cold methanol. After centrifugation of the reaction mixture at 1600g for 10 minutes, H3PO4 (final concentration 0.5 M) was added to the supernatant, and its solution was analyzed by HPLC. For the hydrolysis of PL derivatives, the reaction was terminated by adding 6 ml ethyl acetate and 1 ml saturated NaCl solution adjusted to pH 4.0 with phosphoric acid. After the samples had been shaken for 10 minutes, the ethyl acetate phase was isolated and evaporated. The residue was redissolved in HPLC mobile phase and analyzed by HPLC. In the inhibition experiments of hydrolase activity, microsomes or S9 solution were preincubated for 5 minutes at 37°C with BNPP dissolved in

266

Ohura et al. TABLE 1 Sequences of oligonucleotide primers used in PCR analysis

Protein Name

UniProt Accession Number

Gene Symbol

Primer Sequence (59–39)

Forward ACCACAGTCCATGCCATCAC Reverse TCCACCACCCTGTTGCTGTA Forward TGGAATCCTGTGGCATCCATGAAACC Reverse TAAAACGCAGCTCAGTAACAGTCCG Forward ACGAACCAGAGCGAAAGCAT Reverse TGTCAATCCTGTCCGTGTCC

453

Forward CTGGACTTACTTGGAAACCC Reverse TGCAACCAAGTCCTGGAACA Forward ACACAGATGACCCAGACAGA Reverse CAGTGGCTTCATAGCCAGAA Forward CCAAAGACCCAAGGATGTAG Reverse TGAGGTTGTCTCTTAGCCAG Forward AGCAAGCCCAGAAACTGAAA Reverse ATAGCCCCATCTTTGCTCCT

348

GAPDH

P04797

Gapdh

NM_017008

b-actin

P60711

Actb

BC063166

18S ribosomal RNA

NR_046237

—————a CES1 family Hydrolase A

—————a P16303

CES1B4 b, Ces3, Ces1d c b

c

X51974

Egasyn

Q63108

CES1D2 , Ces1, Ces1e

Hydrolase B / Hydrolase C Hydrolase S

Q64753/Q63010

CES1H3b, Ces1fc/CES1H2b

P10959

CES1G1b, Es2, Ces1cc

X81825 /U10698 X78489

O70631/O70177 Q8K3RO

CES2A10 b, Ces2I, Ces2cc/CES2A9 b CES2A12b, Ces6, Ces2ac

AB010635 /AB010632 AY034877

O35535

Ces5, Ces2ec

D50580

CES2 family RL4 / ————a ————a ————a

Product Size (bp)

GenBank Accession Number

X81395

Forward ACGGTCTCCACTACAGTGGC Reverse AATAGCTGGGTGCATGTTGG Forward AATCTGAGGTGGTCTACAAG Reverse TGCTTGATGAAGCTGGGCAG Forward TATCGTCAGGACCATCTCTG Reverse AGGAAGTTGGACTGATGCTG

349 311

452 297 142 529 544 417

a

There are not Protein name and UniProt Accession Number corresponding to 18S ribosomal RNA. Protein names have not been determined. CES gene symbols named by Satoh and Hosokawa (2006). d CES gene symbols named by Holmes et al. (2010). b c

DMSO. The reaction was started by addition of the substrates. The total concentration of DMSO in the reaction mixture was ,1.0%. Hydrolysates were measured by the same procedure as in the hydrolysis experiment. HPLC Analysis. The HPLC system comprised a pump (JASCO PU-980), autosampler (JASCO AS-950), UV detector (UV-2075), fluorescence detector (JASCO FP-1520S), column oven (JASCO CO-965), and data application apparatus (ChromNAV chromatography data system; Jasco International Co. Ltd., Tokyo, Japan). The temperature of the column was maintained at 40°C. For detection of temocaprilat, Inertsil ODS-2 column (5 mm, 4.6  250 mm i.d.; GL Sciences Inc., Tokyo, Japan) was used at a flow rate of 0.8 ml/min with a mobile phase of acetonitrile/10 mM H3PO4, 70:30 (v/v) (solvent A) and 10 mM H3PO4 (solvent B) according to the following gradient schedule: 45% solvent A (0–10 minutes), a linear gradient from 45 to 100% solvent A (10–20 minutes),

100% solvent A (20–25 minutes), and a linear gradient from 100 to 45% solvent A (25–26 minutes). Temocaprilat was detected at a wavelength of 258 nm. For determination of PL enantiomers, a CHIRALCEL OD column (10 mm, 4.6  250 mm i.d.; Daicel Chemical Industries, Ltd., Tokyo, Japan) was used with a mobile phase of hexane/isopropanol/diethylamine, 90:10:1.0 (v/v/v) at a flow rate of 1.0 ml/min. PL was detected at excitation and emission wavelengths of 285 and 340 nm, respectively. All substrates and metabolites were clearly separated, and were measured in a quantitatively linear range. Data Analysis. Experimental reaction velocity measurements were combined to provide mean 6 S.D. values. The Km and Vmax were estimated by fitting the Michaelis-Menten equation to the data using nonlinear regression analysis with MULTI program written in BASIC by Yamaoka et al. (1981). The statistical differences were assessed by the independent t test.

Fig. 2. Chemical structures of carboxylesterase substrates.

267

Age-Related Rat Hepatic and Intestinal CES Expression TABLE 2 Kinetic parameters for hydrolysis of PNPA in liver microsomes and jejunal and ileal S9 fractions from rats of different ages PNPA (15–500 mM) was incubated with liver microsomes (20 mg/ml), jejunal S9 fraction (25–45 mg/ml), and ileal S9 fraction (30–60 mg/ml). Each value represents the mean 6 S.D. (n = 3/4). *P , 0.05 indicates statistically significant differences compared with the 8-week-old age group. 8 Weeks

46 Weeks

90 Weeks

Liver

Km (mM) Vmax (mmol/min per mg protein)

49.6 6 1.80 4.93 6 0.437

31.4 6 5.07* 4.58 6 0.637

47.7 6 12.7 3.86 6 1.60

Jejunum

Km (mM) Vmax (mmol/min per mg protein)

338 6 67.4 2.65 6 0.310

319 6 70.8 2.34 6 0.276

420 6 51.4 4.85 6 1.51

Ileum

Km (mM) Vmax (mmol/min per mg protein)

414 6 54.0 1.45 6 0.400

316 6 44.8 1.78 6 0.403

401 6 49.6 2.16 6 1.05

Results Hydrolysis of PNPA in Rat Liver and Small Intestine from Different Age Groups. Hydrolase activity in liver and small intestine from 8-, 46-, and 90-week-old rats was estimated using PNPA, which is a substrate for several esterases including CES. CES is retained in the endoplasmic reticulum membrane through binding with the KDEL receptor. Therefore, hepatic hydrolase activity was measured using the microsomal fraction. Treatment with BNPP, a specific inhibitor of CES, demonstrated a 65% contribution of CES to hepatic microsomal hydrolysis of PNPA (unpublished data). The S9 fraction was used for the estimation of intestinal activity. The intestinal S9 fraction showed less interindividual variation in CES content than the microsomal fraction. In the intestine, microsomal CES may partly leak out into the cytosolic fraction by dissociation from the KDEL receptor during homogenization of the mucosal membrane. It has been found that CES contributes approximately 90% of hydrolase activity for PNPA, even in the intestinal S9 fraction (unpublished data). Table 2 shows the kinetic parameters for the enzymatic hydrolysis of PNPA. Hepatic Km values were maintained in the range 30–50 mM in 8- to 90-week-old rats, while Km values in the jejunum and ileum were 7- to10-fold higher but also remained almost constant during this period. On the other hand, hepatic and intestinal Vmax values tended to decrease and increase with age, respectively, although the variation between the three age groups was not statistically significant in any tissue, due presumably to the large interindividual variation in the

older group. In contrast to the gradual decrease of hepatic Vmax values with age, jejunal Vmax values were constant up to 46 weeks but doubled by 90 weeks, while ileal Vmax values increased only fractionally with aging. It is interesting that the age-dependent alterations in intestinal Vmax values are in the opposite direction to the changes observed in the liver. Therefore, the intestinal Vmax was larger than the hepatic Vmax in 90-week-old rats. Although PNPA is hydrolyzed by several esterases, CES is the major esterase in the present experimental conditions. These data suggest that age-dependent alteration of hepatic and intestinal hydrolase activities for PNPA may be related to the regulation of CES expression. mRNA Level of CES Isozymes in Liver and Small Intestine from 8-Week-old Rats. Prior to the examination of age-related expression of CES isozymes in rat liver and intestine, the expression of CES isozymes in 8-week-old rats was determined by investigating mRNA levels. As shown in Table 1 and Fig. 1, the naming of individual CES genes and proteins has not been unified among different research groups. In the present study, we have used the names Hydrolase A, Hydrolase B, Hydrolase C, Egasyn, and Hydrolase S for CES1 isozymes, and RL4, AB010632, AY034877, and D50580 for CES2 isozymes. The hepatic and intestinal CES mRNA levels in 8-week-old rats are shown in Fig. 3, A and B, respectively. In the liver, mRNA levels of Hydrolase A, Hydrolase B/C, and Hydrolase S were markedly higher than those of Egasyn and the three CES2 isozymes. In the jejunum and

Fig. 3. Relative mRNA expression of CES isozymes in liver (A) and small intestine (B) from 8-week-old rats. The mRNA expression levels were determined by real-time quantitative PCR and normalized to GAPDH mRNA expression. (B) Open and closed columns represent CES isozyme expression in rat jejunum and ileum, respectively. Each column shows the mean 6 S.D. (n = 4/5).

268

Ohura et al.

Fig. 4. Age-related changes in the protein expression of CES isozymes in rat liver (A), jejunum (B), and ileum (C). Expression levels of CES proteins in rat liver microsomes and S9 fraction of jejunum and ileum were analyzed by native PAGE, followed by esterase activity staining with a-naphthyl acetate. The protein amounts loaded in each lane for liver microsomes, jejunal S9 and ileal S9 were 15, 50, and 70 mg, respectively. Arrows indicate bands corresponding to each CES isozyme. *, unknown esterases.

ileum, the highest expression level was observed for RL4 mRNA, followed by Hydrolase B/C, Egasyn, and AY034877. Hydrolase A, Hydrolase S, and D50580 showed negligible expression. Native PAGE Analysis of CES Isozymes in Liver and Small Intestine from 8-Week-old Rats. The protein levels of rat hepatic and intestinal CES isozymes were analyzed by native PAGE gel stained for hydrolysis of a-naphthyl acetate. As shown in Fig. 4A, two strong bands corresponding to CES1 isozymes were detected in 8-week-old rat liver. The upper band was assigned to Hydrolase A and Hydrolase C because of their similar molecular weights as trimers (180 kDa) and similar pI values (Hydrolase A: pI 6.0; Hydrolase B/C: pI 6.5), and the lower band to Hydrolase B, a monomeric 60-kDa protein (Satoh and Hosokawa, 1998). In addition, two weak bands of Egasyn (monomer, pI 5.5) and RL4 (monomer, pI 4.6) were observed. Hydrolase S,

expressed at the highest mRNA levels, was not detected as an active protein in native PAGE, because it is secreted from the liver into the plasma (Alexson et al., 1994; Yan et al., 1995). AY034877 and D50580 were also not detected in native PAGE, in spite of having higher mRNA levels than RL4; this may be due to their low affinity for a-naphthyl acetate. Apart from Hydrolase S, AY034877 and D50580, the protein levels of the CES isozymes in native PAGE matched their mRNA levels. Since the intestinal CES mRNA levels were significantly lower than hepatic levels, a larger quantity of intestinal S9 was loaded onto the native PAGE gel. As shown in Fig. 4, B and C, only the strong band of RL4 was detected in both jejunum (50 mg) and ileum (70 mg); two weak bands corresponding to Hydrolase B and Hydrolase C were detectable in jejunum, while only Hydrolase C was weakly stained in

TABLE 3 Age-dependent changes in mRNA expression of CES isozymes in liver from rats of different ages Each value shows the mean 6 S.D. (n = 4). *P , 0.05 and **P , 0.01 indicate statistically significant differences compared with the 8-week-old age group. Fold Changea CES isozymes 8 Weeks

6 6 6 6

CES1 family

Hydrolase A Egasyn Hydrolase B/C Hydrolase S

1.03 0.0811 1.41 2.50

CES2 family

RL4/AB010632 AY034877 D50580

0.0311 6 0.0103 0.110 6 0.0242 0.0629 6 0.0244

a

0.100 0.349 0.407 0.352

46 Weeks

1.10 0.0837 0.561 1.43

6 6 6 6

0.304 0.0231 0.141* 0.433*

0.0705 6 0.0256 0.0843 6 0.00160 0.0197 6 0.0220

Fold change: the change in expression of the CES mRNA relative to GAPDH mRNA.

90 Weeks

0.418 0.0613 0.325 0.756

6 6 6 6

0.115** 0.0148 0.0657** 0.216**

0.0528 6 0.0142 0.0869 6 0.0406 0.0134 6 0.0229*

269

Age-Related Rat Hepatic and Intestinal CES Expression TABLE 4 Age-dependent changes in mRNA expression of CES isozymes in rat small intestine from animals of different ages Each value shows the mean 6 S.D. (n = 4/5). **P , 0.01 indicates statistically significant differences compared with the 8-week-old age group. Fold Changea CES Isozymes 8 Weeks

46 Weeks

90 Weeks

0.0687 6 0.0139** 0.128 6 0.0650

CES1 family

Egasyn Hydrolase B/C

0.0347 6 0.0140 0.0933 6 0.0173

Jejunum 0.0530 6 0.00914 0.122 6 0.0563

CES2 family

RL4/AB010632 AY034877

0.251 6 0.113 0.0243 6 0.00712

0.354 6 0.203 0.0456 6 0.0272

0.444 6 0.140 0.0849 6 0.0599

CES1 family

Egasyn Hydrolase B/C

0.0163 6 0.0104 0.0462 6 0.0285

Ileum 0.0143 6 0.0120 0.0808 6 0.0785

0.0249 6 0.0224 0.0515 6 0.0198

CES2 family

RL4/AB010632 AY034877

0.183 6 0.111 0.0369 6 0.00776

0.409 6 0.229 0.0508 6 0.0122

0.432 6 0.0859** 0.0679 6 0.0290

a

Fold change: the change in expression of the CES mRNA relative to GAPDH mRNA.

ileum. Egasyn and AY034877 were not observed as active proteins in either jejunum and ileum. Age-Related Expression of CES Isozymes in Rat Liver and Small Intestine. Table 3 and Fig. 4A show the age-dependent expression of hepatic CES isozymes as mRNA and protein levels, respectively. With respect to hepatic mRNA levels, Hydrolase A mRNA did not alter from 8 to 46 weeks and was downregulated by 90 weeks; Hydrolase B/C and Hydrolase S decreased to about 40–60% by 46 weeks and had decreased further at 90 weeks; mRNA levels of Egasyn and three CES2 isozymes were nearly constant or decreased slightly with age. In accordance with mRNA levels, the band intensity of Hydrolase A/C and Hydrolase B on native PAGE became weaker with aging, while those of Egasyn and RL4 protein were at nearly the same level in all age groups, although interindividual differences were observed. In the jejunum and ileum, both RL4 mRNA and its protein band intensity increased with age, as shown in Table 4 and Fig. 4, B and C. Three minor CES isozymes also tended to increase their mRNA expression, although the band intensity visualized for Hydrolase C and/or Hydrolase B in native PAGE was almost the same in the three age groups, and bands relating to Egasyn and ileal Hydrolase B were not detected even in the oldest group of rats. Age-Related Hydrolysis of Temocapril in Rat Liver and Small Intestine. To examine the effect of age-related changes in the expression of CES isozymes on hepatic and intestinal hydrolase

activities, we selected two substrates, temocapril and PL derivatives. Temocapril is a typical substrate for hCE1 (Imai et al., 2005; Vistoli et al., 2009), and PL derivatives are hydrolyzed by hCE1 and hCE2 (Imai et al., 2006). Although the rat CES isozyme responsible for hydrolysis of temocapril is unknown, BNPP almost completely inhibited the hydrolysis of temocapril in rat liver and jejunum and was associated with 85% inhibition in rat ileum (unpublished data), suggesting that rat CES is the dominant enzyme for hepatic and intestinal hydrolysis of temocapril. Table 5 shows the kinetic parameters of the enzymatic hydrolysis of temocapril in rat liver and intestine. The hepatic Km value in 8-weekold rats was slightly larger than jejunal and ileal values, while the hepatic Vmax value was about 20- and 210-fold greater than that of jejunum and ileum, respectively. In the liver, the Km values in 8- and 90-week-old rats were not significantly different. However, the Vmax value was approximately 50% lower in 46-week-old rats compared with 8-week-old rats, while the values in 46- and 90-week-old rats were nearly identical. The decrease of hepatic hydrolase activities with age is similar to the agedependent downregulation of Hydrolase B/C mRNA levels (Table 3). In fact, the Vmax values correlated well with mRNA levels of Hydrolase B/C (r = 0.882), as shown in Fig. 5 and Table 6. In the jejunum and ileum, Km values did not differ significantly in the three age groups. Unlike the liver, jejunal Vmax increased in an

TABLE 5 Kinetic parameters for hydrolysis of temocapril in rat liver microsomes and in jejunal and ileal S9 from rats of different ages Temocapril (10–500 mM) was incubated with liver microsomes (10 mg/ml), jejunal S9 fraction (200 mg/ml), and ileal S9 fraction (400 mg/ml). Each value represents the mean 6 S.D. (n = 3/4). *P , 0.05 and **P , 0.01 indicate statistically significant differences compared with the 8-week-old age group. 8 Weeks

46 Weeks

90 Weeks

Liver

Km (mM) Vmax (nmol/min per mg protein)

63.3 6 16.4 97.6 6 18.9

65.9 6 22.2 47.5 6 7.49**

45.2 6 12.4 40.2 6 28.1*

Jejunum

Km (mM) Vmax (nmol/min per mg protein)

47.3 6 1.16 5.11 6 0.406

31.2 6 6.77 7.54 6 1.66

36.8 6 9.96 8.91 6 3.44

Km (mM) Vmax (nmol/min per mg protein)

39.4 6 1.21 0.470 6 0.0288

51.1 6 7.49 1.10 6 0.363

45.5 6 1.58 1.05 6 0.315

Ileum

270

Ohura et al.

Fig. 5. Relationships between relative mRNA levels of CES isozymes and Vmax values for temocapril hydrolysis in rat liver. The relationships between relative mRNA levels of CES1 isozymes and Vmax values for temocapril hydrolysis in rat liver were evaluated using the correlation coefficient (r). A P value , 0.05 was considered statistically significant for all comparisons.

As shown in Fig. 6A, the hepatic hydrolase activities for PL derivatives were maintained over the period of 8–90 weeks. In comparison with changes in mRNA and protein levels of CES isozymes with age (Table 3 and Fig. 4A, respectively), Egasyn shows an age-independent expression and may therefore contribute to the hepatic hydrolysis of PL derivatives. Indeed, in our preliminary experiments, only anti-Egasyn IgG inhibited hepatic hydrolase activities for both R- and S-isomers of butyryl PL (unpublished data). In the jejunum and ileum, hydrolase activities for PL derivatives tended to increase with age, although there were no statistically significant differences between the three age groups, due primarily to large interindividual differences in the older group as shown in Fig. 6, B and C. Interestingly, the increases were not linear and the patterns of increase varied between the jejunum and ileum. The jejunal hydrolase activities for both R- and S-isomers were constant up to 46 weeks and increased at 90 weeks, while ileal hydrolase activities for the R-isomer were increased at 46 weeks and nearly constant between 46 and 90 weeks; for the S-isomer ileal hydrolase activities gradually increased with age. The jejunal hydrolysis of valeryl PL (compound 3) showed a relatively high correlation with the mRNA level of RL4 in both jejunum and ileum (Table 6). In the multiple regression analysis, the correlation parameter was not improved by combining the mRNA level of RL4 with any other CES isozymes in the jejunum and ileum. Similar results have also been obtained with other PL derivatives (unpublished data). These results suggest that RL4 is a major enzyme involved in the intestinal hydrolysis of PL derivatives.

age-dependent manner and was 1.5-fold and 1.7-fold higher in 46- and 90week-old rats, respectively, than in 8-week-old rats. The ileal Vmax value was approximately doubled in 46-week-old rats but remained constant between the 46- and 90-week-old groups. As shown in Table 6, both jejunal and ileal Vmax values showed relatively high correlations with mRNA levels of Hydrolase B/C and RL4. The age-dependent hydrolysis of temocapril in the intestine may therefore be primarily due to RL4 and partially to Hydrolase B/C. In fact, further multiple linear regression analyses showed a high correlation between Vmax values and a combination of the mRNA levels of RL4 and Hydrolase B/C in jejunum (r = 0.916) and ileum (r = 0.832) (unpublished data). Age-Related Hydrolysis of Racemic PL Derivatives in Rat Liver and Small Intestine. Racemic PL derivatives were used as secondary CES substrates. It has been reported previously that PL derivatives are hydrolyzed by rat CESs, which are responsible for 80% of hepatic hydrolysis (Yoshigae et al., 1999) and 100% of jejunal and ileal hydrolysis in 8-week-old rats (Masaki et al., 2007). However, it is unclear which rat CES isozyme is primarily involved in their hydrolysis. The structure of PL derivatives (compounds 1–6) is shown in Fig. 2. Compounds 1–3 and 4–6 are PL-substituted with straight and branched acyl chains, respectively. Figure 6 shows the hydrolase activities for racemic PL derivatives in liver and intestine from 8- to 90-week-old rats. In contrast to the hydrolysis of temocapril, both liver and intestine showed similar hydrolase activities for all PL derivatives, although the ileal activities were about 1.5-fold lower than those in jejunum. In the liver, the S-isomers of compounds 1–3 were preferentially hydrolyzed, while slightly higher activities were observed for R-isomers of compounds 4–6. On the other hand, R- and S-isomers were hydrolyzed at nearly the same rates in the intestine. These data suggest that the CES isozymes responsible for rat intestinal hydrolysis of PL derivatives are different from those in rat liver.

Discussion It is important to study age-related changes in the expression of metabolizing enzymes in the small intestine and liver, as they affect the first-pass metabolism of orally administered xenobiotics, such as

TABLE 6 Correlation coefficients for mRNA levels of CES isozymes and hydrolase activities in rat liver and small intestine Correlation coefficients for mRNA levels of CES isozymes and hydrolase activities were calculated using Vmax values for temocapril and activity values at 50 mM concentration of valeryl PL. *P , 0.05, **P , 0.01 and ***P , 0.001 indicate statistically significant. Temocapril

Sample size (n) Isomer Hydrolase A Egasyn Hydrolase B/C RL4/AB010632 AY034877 D50580

Valeryl PL (compound 3)

Liver

Jejunum

Ileum

11

9

9

0.499 0.110 0.882*** 20.464 0.288 0.714*

0.690* 0.857** 0.832** 0.115

0.393 0.785** 0.709* 0.220

Jejunum

Ileum

9

9

R

S

R

S

0.585 0.611 0.768** 0.637

0.594 0.549 0.797** 0.637

0.342 0.492 0.795** 0.367

0.570 0.196 0.709* 0.242

Age-Related Rat Hepatic and Intestinal CES Expression drugs and environmental chemicals. It has been reported that the expression of several metabolizing enzymes, e.g., P450 and UDPglucuronosyltransferase (UGT), is altered with aging in both rat liver and intestine. The rat hepatic expression of P450 decreases with aging (Warrington et al., 2003, 2004; Yun et al., 2010), while ageindependent P450 expression has been shown in rat intestine (Warrington et al., 2004; Pałasz et al., 2012). With respect to UGT activity, no change or an age-dependent increase has been observed in rat liver and intestine, respectively (Lee et al., 2008; Bolling et al., 2011). However, the age-related expression of CES isozymes has been investigated only in rat liver, and has focused primarily on early developmental stages. In the present study, the effect of aging on rat hepatic and intestinal expression of CES isozymes was evaluated in rats aged between 8 and 90 weeks using both mRNA expression and enzymatic activity. The expression of the major rat hepatic CES1 isozymes, Hydrolase A and Hydrolase B/C, decreased with age up to 90 weeks as evidenced by both mRNA and protein levels (Table 3 and Fig. 4A); this agrees with the results of Mori et al. (2007) using microarray data analysis. In contrast, minor CES1, Egasyn, and three CES2 isozymes showed age-independent expression in the liver. Therefore, hepatic hydrolysis may decrease or remain constant with age, according to the expression property of the responsible CES isozyme. In fact, the hydrolysis of temocapril, catalyzed by Hydrolase B/C, decreased with age, while the hydrolysis of PL derivatives remained constant over a wide age range due to the contribution of Egasyn. PNPA hydrolysis

271

also decreased with age (Table 2), due presumably to downregulation of CES1 isozyme levels, although CESs are responsible for only 65% of the total hepatic microsomal hydrolysis of PNPA. Karanth and Pope (2000) reported that the hydrolase activity for PNPA was identical at 90 days (13 weeks) and 24 months (96 weeks) in the hepatic S9 fraction of Sprague-Dawley rats. In the present experiments, we used hepatic microsomal fractions from Wistar rats. The discrepancy in the findings on the effect of aging on PNPA hydrolysis may therefore be caused by the use of different rat strains and/or tissue fractions in the hydrolysis experiment. PNPA is a good substrate for not only microsomal esterases but also cytosolic esterases, such as neutral cytosolic cholesteryl ester hydrolase (Milad-Kodsi et al., 2005). The activity of some cytosolic esterases may even be enhanced by aging. Interestingly, Hydrolase A, which poorly hydrolyzed both temocapril and PL derivatives, exhibits the highest amino acid sequence homology with hCE1, which recognizes both compounds (homology to hCE1: Hydrolase A, 77%; Egasyn, 73%; Hydrolase B/C, 67%). It has been reported that Hydrolase A catalyzes the hydrolysis of endogenous compounds. For example, Sanghani et al. (2002) have demonstrated the Hydrolase A-mediated hydrolysis of retinyl palmitate, a major endogenous storage source of vitamin A. This suggests that the hepatic metabolism of endogenous compounds by Hydrolase A may slow down in aged rats in comparison with younger rats. The expression of P450s, which are involved in the metabolism of endogenous compounds such as vitamins, lipids, and steroidal hormones, is also decreased in an age-dependent manner in rat liver

Fig. 6. Hydrolysis of PL derivatives in liver (A), jejunum (B), and ileum (C) from 8- to 90-week-old rats. Left and right sides of the figure show hydrolase activities for R- and S-isomers of PL derivatives, respectively. Numbers of horizontal axis on each graph correspond to PL derivatives shown in Fig. 2. PL derivatives (50 mM) were incubated with rat liver microsomes (10 mg/ml), jejunal S9 fraction (10–50 mg/ml), and ileal S9 fraction (20–90 mg/ml). Each column represents the means 6 S. D. (n = 3–4).

272

Ohura et al.

(Warrington et al., 2003, 2004; Yun et al., 2010), suggesting that CES and P450s can be simultaneously downregulated according to the homeostasis of endogenous compounds in aged rats. Several researchers have reported on the age-related expression of CES isozymes in human liver. The human adult liver ($18 years of age) expresses hCE1 at significantly higher levels than that of children (0 days to 10 years old; Zhu et al., 2009; Shi et al., 2011), in whom levels are higher than in fetuses (82–224 days gestation; Yang et al., 2009). The increase of hCE1 expression during human development is similar to the upregulation of Hydrolase A and Hydrolase B in young rat liver (Morgan et al., 1994). In rats, hepatic CES1 isozymes increase during early developmental stages and decrease with aging, after reaching maximal expression in young adulthood. The mRNA level of Hydrolase S, a plasma CES1 isozyme, also showed an age-dependent decrease. Unfortunately, we did not collect plasma samples in aged rats, but our result agrees with previous reports on hydrolase activity in rat plasma. Karanth and Pope (2000) have demonstrated the reduced hydrolysis of PNPA in the plasma of 24-month-old rats compared with 90-day-old rats. Since temocapril and PL derivatives are also hydrolyzed by Hydrolase S (Bahar et al., 2012), it is predicted that their in vivo metabolism in plasma after oral absorption decreases in an age-dependent manner. In rat jejunum and ileum, the expression of the major CES2 isozyme, RL4, increased with age as judged from mRNA and protein levels (Table 4 and Fig. 4). On the other hand, protein levels of the minor CES isozymes, Egasyn, Hydrolase B/C, and AY034877, were maintained over a wide age range, although their mRNA levels tended to increase with age. It is interesting that the age-dependency of the expression of CES isozymes moves in opposite directions in rat intestine and liver. The upregulation of intestinal CES by aging might be in compensation for the decrease of hepatic CESs, resulting in the maintenance of first-pass hydrolysis over a wide age range. Indeed, the intestinal hydrolysis of both temocapril and PL derivatives was increased in an age-dependent manner (Table 5 and Fig. 6). The high intestinal ability for detoxification in aged rats is also supported by the age-independent expression of P450s and age-dependent increase of UGT activity in rat intestine (Warrington et al., 2004; Bolling et al., 2011; Pałasz et al., 2012). Regarding the expression of CES along the proximal to distal intestine, RL4, a major CES2 isozyme, showed about 1.5-fold higher expression in the jejunum than in the ileum (Fig. 3B and Table 4); this result agrees with the findings of our previous study using semiquantitative reverse transcription (RT)-PCR (Masaki et al., 2007). The difference is reflected in the rates of hydrolysis of PL derivatives in 8-week-old rats; the jejunal hydrolysis of PL derivatives was about 1.5-fold greater than that in the ileum (Fig. 6). In contrast, the hydrolysis of temocapril differed 10-fold between jejunum and ileum. The relationship between the mRNA levels for each CES isozyme and hydrolase activities for temocapril suggests the involvement of Hydrolase B/C in addition to RL4 (Table 6). The significantly lower level of hydrolysis of temocapril in the ileum compared with the jejunum is due to the low expression levels of Hydrolase B and Hydrolase C in the ileum (Fig. 4, B and C). In many previous studies, it has been concluded that only CES2 isozymes are present in rat intestine. Serendipitously, we were able to demonstrate a contribution of CES1 isozymes to intestinal hydrolysis, as well as differences in the expression of Hydrolase B/C between jejunum and ileum. This is significantly different from the situation in the human intestinal hydrolysis which is contributed by only hCE2 in both jejunum and ileum. The mechanisms underlying age-regulated expression of CES isozymes are not yet completely understood. However, since hydrolase

activities for temocapril and PL derivatives correlate well with the mRNA levels of CES isozymes (Table 6), age-related CES expression may be regulated at the transcription level rather than at downstream stages such as translation and protein degradation. With the exception of the RL4 gene, which is located on chromosome 1, rat CES1 and CES2 genes are located within their respective clusters on chromosome 19, suggesting that chromosome-specific regulation of CES expression is unlikely. Transcription-factor–mediated regulation may be different for the age-related regulatory pathways of hepatic and intestinal CES isozymes in rats. In this study, we have demonstrated that the levels of rat hepatic and intestinal CES expression change in an age-dependent manner but in opposite directions, and that these changes in expression affect the hydrolase activities of the respective tissues. The factors involved in the changes of CES expression with age are unclear, although agerelated alterations in the levels of endogenous molecules, such as hormones and/or transcription regulatory factors, may be involved. These results may therefore stimulate our interest in the age-dependent expression of CES in other species, including humans. Further studies will allow us to better understand the mechanism of age-related regulation of CES expression. Acknowledgments The authors thank Dr. M. Hosokawa (Chiba Institute of Science, Chosi, Chiba, Japan) for his kind gift of anti-Egasyn antibody. Authorship Contributions Participated in research design: Ohura, Imai. Conducted experiments: Ohura, Tasaka, Hashimoto. Contributed new reagents or analytic tools: Ohura, Imai. Performed data analysis: Ohura, Imai. Wrote or contributed to the writing of the manuscript: Ohura, Imai. References Alexson SE, Finlay TH, Hellman U, Svensson LT, Diczfalusy U, and Eggertsen G (1994) Molecular cloning and identification of a rat serum carboxylesterase expressed in the liver. J Biol Chem 269:17118–17124. Anand SS, Kim KB, Padilla S, Muralidhara S, Kim HJ, Fisher JW, and Bruckner JV (2006) Ontogeny of hepatic and plasma metabolism of deltamethrin in vitro: role in age-dependent acute neurotoxicity. Drug Metab Dispos 34:389–397. Bahar FG, Ohura K, Ogihara T, and Imai T (2012) Species difference of esterase expression and hydrolase activity in plasma. J Pharm Sci 101:3979–3988. Bolling BW, Court MH, Blumberg JB, and Chen CY (2011) Microsomal quercetin glucuronidation in rat small intestine depends on age and segment. Drug Metab Dispos 39:1406–1414. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. Furihata T, Hosokawa M, Fujii A, Derbel M, Satoh T, and Chiba K (2005) Dexamethasoneinduced methylprednisolone hemisuccinate hydrolase: its identification as a member of the rat carboxylesterase 2 family and its unique existence in plasma. Biochem Pharmacol 69: 1287–1297. Holmes RS, Wright MW, Laulederkind SJ, Cox LA, Hosokawa M, Imai T, Ishibashi S, Lehner R, Miyazaki M, and Perkins EJ, et al. (2010) Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins. Mamm Genome 21: 427–441. Hosokawa M (2008) Structure and catalytic properties of carboxylesterase isozymes involved in metabolic activation of prodrugs. Molecules 13:412–431. Imai T (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug Metab Pharmacokinet 21:173–185. Imai T, Imoto M, Sakamoto H, and Hashimoto M (2005) Identification of esterases expressed in Caco-2 cells and effects of their hydrolyzing activity in predicting human intestinal absorption. Drug Metab Dispos 33:1185–1190. Imai T, Taketani M, Shii M, Hosokawa M, and Chiba K (2006) Substrate specificity of carboxylesterase isozymes and their contribution to hydrolase activity in human liver and small intestine. Drug Metab Dispos 34:1734–1741. Imai T and Hosokawa M (2010) Prodrug approach using carboxylesterase activity: catalytic properties and gene regulation of carboxylesterase in mammalian tissue. J Pestic Sci 35: 229–239. Imai T and Ohura K (2010) The role of intestinal carboxylesterase in the oral absorption of prodrugs. Curr Drug Metab 11:793–805. Karanth S and Pope C (2000) Carboxylesterase and A-esterase activities during maturation and aging: relationship to the toxicity of chlorpyrifos and parathion in rats. Toxicol Sci 58:282–289. Lee JS, Ward WO, Wolf DC, Allen JW, Mills C, DeVito MJ, and Corton JC (2008) Coordinated changes in xenobiotic metabolizing enzyme gene expression in aging male rats. Toxicol Sci 106:263–283.

Age-Related Rat Hepatic and Intestinal CES Expression Livak KJ and Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408. Masaki K, Hashimoto M, and Imai T (2007) Intestinal first-pass metabolism via carboxylesterase in rat jejunum and ileum. Drug Metab Dispos 35:1089–1095. Milad-Kodsi E, Langston TB, Gergis MR, and Grogan WM (2005) Acidic residues emulate a phosphorylation switch to enhance the activity of rat hepatic neutral cytosolic cholesterol esterase. Biochim Biophys Acta 1734:62–73. Morgan EW, Yan B, Greenway D, and Parkinson A (1994) Regulation of two rat liver microsomal carboxylesterase isozymes: species differences, tissue distribution, and the effects of age, sex, and xenobiotic treatment of rats. Arch Biochem Biophys 315:513–526. Mori K, Blackshear PE, Lobenhofer EK, Parker JS, Orzech DP, Roycroft JH, Walker KL, Johnson KA, Marsh TA, and Irwin RD, et al. (2007) Hepatic transcript levels for genes coding for enzymes associated with xenobiotic metabolism are altered with age. Toxicol Pathol 35:242–251. Pałasz A, Wiaderkiewicz A, Wiaderkiewicz R, Czekaj P, Czajkowska B, Lebda-Wyborny T, Piwowarczyk A, and Bryzek A (2012) Age-related changes in the mRNA levels of CYP1A1, CYP2B1/2 and CYP3A1 isoforms in rat small intestine. Genes Nutr 7:197–207. Sanghani SP, Davis WI, Dumaual NG, Mahrenholz A, and Bosron WF (2002) Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate. Eur J Biochem 269:4387–4398. Satoh T and Hosokawa M (1998) The mammalian carboxylesterases: from molecules to functions. Annu Rev Pharmacol Toxicol 38:257–288. Satoh T, Taylor P, Bosron WF, Sanghani SP, Hosokawa M, and La Du BN (2002) Current progress on esterases: from molecular structure to function. Drug Metab Dispos 30:488–493. Satoh T and Hosokawa M (2006) Structure, function and regulation of carboxylesterases. Chem Biol Interact 162:195–211. Shameem M, Imai T, and Otagiri M (1993) An in-vitro and in-vivo correlative approach to the evaluation of ester prodrugs to improve oral delivery of propranolol. J Pharm Pharmacol 45:246–252. Shi D, Yang J, Yang D, and Yan B (2008) Dexamethasone suppresses the expression of multiple rat carboxylesterases through transcriptional repression: evidence for an involvement of the glucocorticoid receptor. Toxicology 254:97–105. Shi D, Yang D, Prinssen EP, Davies BE, and Yan B (2011) Surge in expression of carboxylesterase 1 during the post-neonatal stage enables a rapid gain of the capacity to activate the anti-influenza prodrug oseltamivir. J Infect Dis 203:937–942. Takai S, Matsuda A, Usami Y, Adachi T, Sugiyama T, Katagiri Y, Tatematsu M, and Hirano K (1997) Hydrolytic profile for ester- or amide-linkage by carboxylesterases pI 5.3 and 4.5 from human liver. Biol Pharm Bull 20:869–873.

273

Taketani M, Shii M, Ohura K, Ninomiya S, and Imai T (2007) Carboxylesterase in the liver and small intestine of experimental animals and human. Life Sci 81:924–932. Vistoli G, Pedretti A, Mazzolari A, Bolchi C, and Testa B (2009) Influence of ionization state on the activation of temocapril by hCES1: a molecular-dynamics study. Chem Biodivers 6: 2092–2100. Warrington JS, von Moltke LL, Harmatz JS, Shader RI, and Greenblatt DJ (2003) The effect of age on sildenafil biotransformation in rat and mouse liver microsomes. Drug Metab Dispos 31: 1306–1309. Warrington JS, Court MH, Greenblatt DJ, and von Moltke LL (2004) Phenacetin and chlorzoxazone biotransformation in aging male Fischer 344 rats. J Pharm Pharmacol 56:819–825. Xiao D, Chen YT, Yang D, and Yan B (2012) Age-related inducibility of carboxylesterases by the antiepileptic agent phenobarbital and implications in drug metabolism and lipid accumulation. Biochem Pharmacol 84:232–239. Yamaoka K, Tanigawara Y, Nakagawa T, and Uno T (1981) A pharmacokinetic analysis program (multi) for microcomputer. J Pharmacobiodyn 4:879–885. Yan B, Yang D, Bullock P, and Parkinson A (1995) Rat serum carboxylesterase. Cloning, expression, regulation, and evidence of secretion from liver. J Biol Chem 270:19128–19134. Yang D, Pearce RE, Wang X, Gaedigk R, Wan YJ, and Yan B (2009) Human carboxylesterases HCE1 and HCE2: ontogenic expression, inter-individual variability and differential hydrolysis of oseltamivir, aspirin, deltamethrin and permethrin. Biochem Pharmacol 77:238–247. Yoshigae Y, Imai T, Taketani M, and Otagiri M (1999) Characterization of esterases involved in the stereoselective hydrolysis of ester-type prodrugs of propranolol in rat liver and plasma. Chirality 11:10–13. Yun KU, Oh SJ, Oh JM, Kang KW, Myung CS, Song GY, Kim BH, and Kim SK (2010) Agerelated changes in hepatic expression and activity of cytochrome P450 in male rats. Arch Toxicol 84:939–946. Zhu HJ, Appel DI, Jiang Y, and Markowitz JS (2009) Age- and sex-related expression and activity of carboxylesterase 1 and 2 in mouse and human liver. Drug Metab Dispos 37: 1819–1825.

Address Correspondence to: Dr. Teruko Imai, Graduate School of Pharmaceutical Sciences, Kumamoto University, 5-1 Oe-Honmachi, Chuo-ku, Kumamoto, 862-0973, Japan. E-mail: [email protected]