ANALYTICAL
198,86-91
BIOCHEMISTRY
(1991)
Direct Analysis of Polymerase Chain Reaction Products Using Enzyme-Linked lmmunosorbent Assay Techniques Axe1 Landgraf,*
Bernd
Reckmann,?
and Alfred
Pingoud*
*Abteilung Biophysiha1isch.e Chemie, Zentrum Biochemie, Medizinische Hochschule Hannover, D-3000 Hannover 61, Germany; and TDiagrwstica Forschung, E. Merck, D-6100 Darmstadt 1, Germany
Received
March
11, 1991
PCR products obtained using primers carrying at their 6’ends biotin and an antigenic group (e.g., fluorescein) can be quantitatively analyzed by immunological techniques. The procedure described here does not require electrophoretic separation and/or hybridization with radioactive probes. It takes advantage of the fact that biotinylated DNA can be immobilized on avidin- or streptavidin-coated microtiter plates and then can be quantitated by an ELISA specific for the antigenic group. The PCR/ELISA procedure is suitable for routine diagnostic purposes and lends itself to automation. The sensitivity of the immunological detection system that employs horseradish peroxidase linked to antifluorescein antibodies is high: 1 ~1 of the PCR mixture obtained after approximately 26 cycles of amplification of 1 ng/pl genomic template DNA is sufficient for the detection of human single-copy genes. The usefulness of the procedure for the quantitative analysis of the amount of DNA present in a blood or tissue sample is discussed. 0 1991 Academic Press, Inc.
The polymerase chain reaction (PCR)’ was described in detail in 1985 by Saiki et al. (1) as a new method for the analysis of specific DNA sequences. The simplicity and power of this method has led to its fast spread, it is now one of the most popular methods in molecular biology. In general, PCR reaction mixtures are analyzed by gel electrophoresis, which allows the product of interest to be unequivocally identified by its size. Electrophoretie separation, however, is time consuming and cannot easily be included in an automatic process. This has 1 Abbreviations used: ELISA, enzyme-linked immunosorbent assay; FITC, fluorescein isothiocyanate; HRPO, horseradish peroxidase; PBS, phosphate-buffered saline; PCR, polymerase chain reaction.
prevented the PCR-based DNA diagnosis from becoming a routine procedure in the clinical laboratory. Several attempts have been undertaken, therefore, to circumvent electrophoretic separations to identify specific PCR products. SyvHnen et al. (2) have employed hybridization between the biotinylated PCR products and an oligonucleotide probe followed by immobilization of the complex on avidin-coated latex beads. Saiki et al. (3) have demonstrated that the biotinylated PCR product can be detected specifically by hybridization to an oligonucleotide probe immobilized on a nylon membrane. Inouye and Hondo (4) have bound PCR products to microtiter plates and, after hybridization with a biotinylated oligonucleotide probe, detected the specific PCR product by an enzyme-linked immunosorbent assay (ELISA). A similar approach was used by Keller et al. (5), who have bound the PCR products to DNA immobilized on a microtiter plate and identified the specific product with a biotinylated oligonucleotide employing an immunological technique. While these procedures are dependent on hybridization to identify the specific PCR product, it was shown recently that by a careful selection of the primer pair and the PCR conditions the specific PCR product can be quantitated directly without the use of electrophoretic separation and/or hybridization to identify the desired product (6). In this work biotinylated and fluorescent primers were used, the PCR product was immobilized on avidin-coated beads; and the fluorescence was measured after denaturation of the double-stranded PCR product. In the present work we have used an immunological technique that allows us to quantitate the PCR product directly after immobilization of the biotinylated DNA. The advantage of this approach is that it makes use of standard equipment and reagents that are widely used for the automatic processing of ELISA series and, therefore, should allow us to carry out PCR-based DNA diagnosis for routine purposes in the clinical laboratory.
86 All
Copyright 0 1991 rights of reproduction
0003-2697/91$3.00 by Academic Press, Inc. in any form reserved.
ENZYME-LINKED
MATERIALS
AND
IMMUNOSORBENT
METHODS
PCR DNA was extracted from human blood by standard procedures. The following primers complementary to a 108bp target sequence of the human abl proto-oncogene exon II (7) were synthesized using P-cyanoethylphosphoramidites (Milligen) and aminolink II (Applied Biosystems) on a Biosearch Model 8600 DNA synthesizer: A: d(aminolink GCATCTGACTTTGAGCCTCAG) B: d(aminolink CAGTGCAACGAAAAGGTTGGGGTC). Primers A and B were chemically modified using biotinylamidocaproat-N-hydroxysuccinimidester (Sigma) and fluorescein isothiocyanate (FITC) (Sigma), respectively, as described previously (6). The PCR was carried out in a volume of 30 to 100 ~1, with 1 ng/pl template DNA (human genomic DNA prepared from white blood cells), 1 pM of each primer, 200 pM of each dNTP, 2U/lOO ~1 Taq polymerase (BRL), in 10 mM Tris/HCl, pH 8.5, 50 mM KCl, 1.5 mM MgCl,, 0.01% (w/v) gelatin, if not otherwise stated. For the PCR, 16 to 36 cycles (1 min at 92”C, 2 min at 6O”C, 1 min at 74“C; i.e., in a cycle time of 4 min, including the time needed to reach the desired temperatures) were carried out in a Peltier element-based thermocycler (TPS 5 * 4, Fa. Landgraf, Hannover). ELISA The ELISA was carried out in microtiter plates (Maxisorp F96 and Covalink, Nunc) that had been coated with 1 pg/ml affinity-purified avidin (13 U/mg, Sigma) by incubation at room temperature overnight in 100 pi/well with subsequent washing. Some experiments were carried out with microtiter plates that had been incubated after the coating with 1 pg/ml bovine serum albumin or gelatin (both from Sigma) in PBSTween (140 mM NaCl, 2.7 mM KCl, 4.3 mM N%HPO,, 1.4 mM K,HPO,, 0.05% (w/v) Tween 50, pH 7.2). Coated microtiter plates were stored up to 3 days at 4°C. In order to examine the result of the coating process and to check the stability of the coating upon storage, the amount of avidin or streptavidin bound to the microtiter plates was determined by an ELISA using anti-avidin- (Dakopatts) or anti-streptavidin-antibody-horseradish peroxidase (HRPO) conjugates (Dianova), both at a 1:3000 dilution in PBS-Tween (details of the ELISA are given below). One microliter of the PCR product mixture was diluted with 50 ~1 PBS-Tween and incubated for 30 min at room temperature in the well of a coated microtiter plate that was then washed 6 times with PBS-Tween to remove nonincorporated fluorescent primers. The
ASSAY
TECHNIQUE
87
amount of the specific PCR product bound via its biotin residue to the avidin- or streptavidin-coated microtiter plate was determined by incubating the plates for 30 min at room temperature with 50 cLl/well anti-FITC-antibody-HRPO conjugate (Dakopatts) at a 1:500 dilution in PBS-Tween. The plate was subsequently washed six times with PBS-Tween. For the ELISA, 1 mg of 3,3’,5,5’-tetramethylbenzidin (Sigma) was dissolved in 1 ml dimethyl sulfoxide and then diluted 1:lO with 50 mM Na-acetate:citric acid, pH 4.9. After addition of 3 ~1 of 30% (v/v) H,O,, 80 ~1 of this solution was pipeted into each well. The reaction was allowed to proceed for 2-5 min and was then stopped by 80 ~1 of 2 M H,SO,. The optical density of the solution was determined at 450 nm (Immunoreader, Nunc). All experimental data reported here are the results of assays carried out in triplicate and represent mean values. RESULTS Principle
of the
PCRIELISA
Procedure
It has been our goal to develop a procedure to identify and quantitate specific PCR products that does not include electrophoretic separation and/or hybridization, as well as avoids radioactive labeling. To be useful for the routine laboratory such a procedure should employ standard equipment and reagents and should in principle allow automation. The procedure described here fulfills these requirements. It makes use of the fact that the PCR can be carried out with primers carrying bulky substituents at their 5’ end. It should thus be possible to immobilize the PCR product via a functional group present at the 5’ end of one primer and identify and quantitate the product by another functional group present at the 5’ end of the other primer. This approach was used by us in the past with primers carrying a biotin and fluorescein group. The PCR product that contains the biotinylated primer as well as excess biotinylated primers was bound to avidin or streptavidin agarose, while the fluorescent primer was washed off. The amount of PCR product could be quantitated by determining the amount of fluorescent primer incorporated into double-stranded DNA simply by denaturing the immobilized double-stranded DNA by alkali, eluting the fluorescent single-stranded DNA, and measuring the fluorescence in the supernatant. In an effort to make this procedure more convenient for the routine laboratory we have now introduced the following modifications: the biotinylated DNA is immobilized on avidincoated microtiter plates and directly quantitated by an ELISA. The principle of the procedure is shown in Fig. 1. Optimization of the Avidin
Coating of Microtiter
Plates
The coating of microtiter plates with avidin or streptavidin was carried out according to standard proce-
88
LANDGRAF,
RECKMANN,
PCR I abl-lla
PCR product
I
(108 bp)
abl-lib
immobilisation,
AND
PINGOUD
Several attempts were undertaken to increase the amount of avidin bound to the microtiter plate and, thereby, to increase its capacity to bind biotinylated DNA. Neither exposure of the microtiter plates to synchrotron radiation nor mechanical grinding of the microtiter plates to activate or increase the surface resulted in better coating yields. Microtiter plates from suppliers other than Nunc gave the same or almost the same result. Derivatized microtiter plates with aliphatic amino groups (Covalink, Nunc) that can be biotinylated with biotinsuccinimid ester did not lead to a better binding capacity for avidin (data not shown). of PCR Products
Identification
addition of antibody-HRPO conjugate
ELISA
by ELISA
To demonstrate the principal feasibility of the procedure a 10%bp sequence within the abl exon II was amplified by the PCR using biotinylated and fluoresceinlabeled primers. It had been established before by an electrophoretic analysis that with the primers chosen and under the PCR conditions employed the 10%bp target sequence is the only one that is amplified [for details cf. (S)]. This is a prerequisite for the direct analysis of PCR products without electrophoretic separation and/ or hybridization as carried out here with an ELISA. For this purpose aliquots of the reaction mixture obtained after 16 to 36 cycles were pipeted into the wells of an avidin-coated microtiter plate. After adsorption and washing, the amount of biotinylated PCR product was determined by an ELISA using an anti-FITC-antibodyHRPO conjugate. Figure 3 shows that increasing number of cycles increases the signal. Control experiments demonstrate that without template in the PCR only a very weak signal is obtained and that denaturation of
FIG. 1. Scheme of the PCR/ELISA procedure. The PCR is carried out with biotinylated and fluorescein-labeled primers (a). The PCR product as well as nonincorporated biotinylated primers are bound to avidin-coated microtiter plates; nonincorporated fluorescein-labeled primers are washed off (b). The PCR product is quantitated by means of an ELISA using an anti-FITC-antibody-HRPO conjugate (c).
dures developed for the adsorption of proteins on polystyrene surfaces (8). Figure 2 shows that under the conditions employed, saturation is obtained at a concentration of 0.5 pg/ml avidin or streptavidin. This value is typical for protein binding to microtiter plates (9). The binding of avidin and streptavidin to the polystyrene surface of the microtiter plates is stable toward incubation with 100 mM NaOH and all wash procedures used here. For subsequent analyses the coating was carried out with 50 ~1 of a 1-pg/ml avidin or streptavidin solution. The accessible 80-mm2 surface of each well binds 20 ng (400 fmol) avidin. Thus, with a nominal specific activity of 13 U/mg avidin, 1.5 pmol biotin can be bound per coated well.
-
I
0
I
0,2
a4
I
I
I
0,s
0.8
1
12
c bglmll
FIG. 2. Binding of avidin and streptavidin to microtiter plates. The wells of microtiter plates were filled with 100 pl of avidin or streptavidin solution and incubated overnight at room temperature. The amount of avidin or streptavidin bound was determined by an ELISA employing anti-avidinor anti-streptavidin-antibody-HRPO conjugates.
ENZYME-LINKED
IMMUNOSORBENT
the immobilized DNA by alkali and removal of the fluorescein-labeled single strand from the microtiter plate led to disappearance of the signal. Binding of the PCR product to the microtiter plate is via avidin, because the ELISA with uncoated microtiter plates does not give a signal. Fluorescein-labeled single-stranded DNA or the anti-biotin-antibody-HRPO conjugate by themselves are not significantly bound to the avidin-coated microtiter plate as shown by the ELISA. To find out how much of the PCR product can be bound to the microtiter plate, increasing amounts of a PCR product were incubated in the wells of an avidincoated microtiter plate. Figure 4 shows that approximately 1.5 pmol biotinylated DNA can be bound per well, which corresponds to the value calculated on the basis of the nominal specific activity of avidin and the experimentally determined number of avidin molecules bound to the well of a microtiter plate. The capacity of the avidin-coated microtiter plate is approximately a factor of 10 too low to allow detection of the PCR product by fluorescence, as described recently for PCR products immobilized on avidin agarose beads. The advantage of the ELISA, therefore, is its higher sensitivity, which allows one to use microtiter plates to immobilize the PCR product and to separate it from reactants interfering with signal detection. ELISA-based detection procedures frequently are made more sensitive by reducing nonspecific binding of
A 450
12 l-
w
-
W-
Cycles:
16
20
24
26
32
36
a
b
c
d
e
FIG. 3. ELISA-mediated detection of the human cab1 proto-oncogene following amplification by the PCR. A 108-bp sequence of exon II of the human c-abl proto-oncogene was amplified for 16-36 cycles by the PCR. Four microliters of the reaction mixture was incubated with an avidin-coated microtiter plate. After washing, the immobilized PCR product was detected by an ELISA employing an antiFITC-antibody-HRPO conjugate. (a-e) Control experiments: (a) The PCR reaction was carried out for 36 cycles without a template present. (b) The immobilized PCR product was incubated with 100 mM NaOH for 10 min to denature the double-stranded DNA, thereby removing the fluorescein-labeled strand, i.e., the antigen for the subsequent ELISA. (c) The PCR product was incubated with an uncoated microtiter plate. (d) The coated microtiter plate was incubated with the Auorescein-labeled primer. (e) No PCR product was present.
ASSAY
89
TECHNIQUE
A 450 04 i
O-6 -I
0
If
I 0
1
I
I
I
I
2 biotin
3
4
5
primer
I
[pMol]
FIG. 4. The capacity of avidin-coated microtiter plates to bind biotinylated DNA. The binding of biotinylated DNA to avidin-coated microtiter plates was determined by incubating the microtiter plates with varying amounts of a PCR product mixture. The ELISA was carried out with an anti-FITC-antibody-HRPO conjugate.
the antibody to the microtiter plate. A preincubation of the avidin-coated microtiter plate with gelatin or bovine serum albumin and the addition of these proteins to the incubation buffers did not improve the signal-to-noise ratio. With bovine serum albumin even a reduction of the signal was observed, presumably because the antiFITC antibody had been obtained by immunization with an FITC-albumin conjugate. With 2.5 mg/ml bovine serum albumine in the incubation buffer a substantial amount of even weakly cross-reacting anti-FITCantibody-HRPO conjugates would be prevented from interacting with the fluorescein-labeled DNA. On the basis of these experiments a blocking reaction and the addition of blocking reagents to the incubation buffer seemed to be unnecessary, or even detrimental. The ELISA-based detection of PCR products requires association of the biotinylated fluorescein-labeled DNA to the immobilized avidin as well as association of the anti-FITC-antibody-HRPO conjugate to the biotinylated fluorescein-labeled DNA. To optimize the ELISA we have measured the kinetics of these two processes. A 30-min incubation is optimal for both reactions; it is sufficient to obtain a near-maximal specific signal. A longer incubation leads mainly to an increase of the background signal. For the quantitative determination of template concentration in a given sample that makes use of the PCR it must be considered that only in the exponential phase of the amplification process is there a correlation between template concentration and product formed. Figure 5 shows that an optimal range is 27 to 29 cycles, in which a sufficiently large signal is obtained and the plateau phase is not yet reached. When the PCR is stopped in the exponential phase, only a small fraction
90
LANDGRAF,
RECKMANN,
FIG. 5. Quantitative estimate of template concentration by PCR/ ELISA. One, ten, and one hundred nanograms of genomic DNA were amplified for 22 to 35 cycles by the PCR. One microliter of the PCR product mixture was immobilized on avidin-coated microtiter plates and quantitated by an ELISA employing an anti-FITC-antibodyHRPO conjugate. The height of the columns represents the ELISA signal A, obtained with the PCR products. The data shown are the means of three independent experiments, the average deviation being less than lo%, mainly due to inaccuracy in pipeting microliter volumes.
of the primers has been incorporated into product. We have verified that excess biotinylated primers do not affect the sensitivity of the procedure by adding more biotinyl primers and demonstrate a lack of effect. DISCUSSION
The results presented here and elsewhere (6,lO) demonstrate that specific DNA sequences can be detected by employing modified primers, without recourse to additional size or sequence information, as is done when PCR products are identified by gel electrophoresis or hybridization (2,4). The procedure described in the present paper takes advantage of the fact that the doublestranded DNA produced in the PCR carries at its ends a biotin and a fluorescein group, respectively. This means that all PCR products that have this feature give a positive signal. It is mandatory, therefore, that the PCR be conducted such that only specific products are obtained. This can be done by designing appropriate primers and choosing highly selective amplification conditions. There are numerous examples in the literature where it was shown that the desired product is the only detectable one; e.g., the absence of even minor contaminants was demonstrated by on-line fluorescence detection of electrophoretically separated PCR products (11). While the procedure described here allows the quantification of PCR products, it must be emphasized that for the reliable determination of template concentration in a given sample by PCR the reaction must be
AND
PINGOUD
stopped in the exponential phase and requires standardization, e.g., by carrying out differential PCR (12). In principle, reaction products can also be analyzed in the plateau phase. This, however, requires competitive amplification with very similar template DNA and primer pairs (13,14). Standardization by differential or competitive PCR can be easily implemented in our protocol by using primers with different haptens (e.g., digoxigenin) and carrying out a double ELBA. The reliability of the procedure is determined mainly by the PCR (quality of the DNA sample and the polymerase preparation) and the accuracy in pipeting small volumes. The sensitivity of the procedure described here is not limited by the ELISA detection system but rather by the residual nonspecific binding of the FITC-labeled oligodeoxynucleotides to the microtiter plates. Using other detection systems, such as those employing alkaline phosphatase or luciferase, therefore, would not make the procedure more sensitive. We are currently trying to reduce nonspecific binding of the primer oligodeoxynucleotides by exchanging the antigenic group, which might be responsible for the nonspecific binding. The main advantage of the procedure presented here is given by the possibility of processing many samples in parallel, e.g., 96 samples on one microtiter plate, using instrumentation developed for the processing of ELISA series. In addition, the procedure is very fast: less than 2 h are needed to carry out the analysis after the PCR product is obtained. In combination with novel fast PCR techniques (15) a complete assay can be carried out in 2 h, including the PCR. This is a promising aspect for several clinical applications in which a fast DNAbased diagnosis is needed, e.g., for tumor and tissue typing, or identification of pathogenic microorganisms and viruses in patients.
ACKNOWLEDGMENTS We thank Dr. Anja FlieP and Dr. Heiner Wolfes for synthesizing the oligodeoxynucleotides. The assistance of Thomas Nitsche, Juliane Warnke, and Elke Thedinga in the development of the PCR/ ELISA procedure is gratefully acknowledged. Thanks are due to Ms. Andrea Meyer for typing the manuscript. This work was funded in part by a grant from the Fonds der Chemischen Industrie.
REFERENCES 1. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Science 230,1350-1354. 2. Syvlinen, A. C., Bengtstriim, M., Tenhunen, J., and Siiderlund, H. (1988) Nucleic Acids Res. 16, 11,327-11,338. 3. Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989) Proc. Natl. Acad. Sci. USA 86,6230-6234. 4. Inouye, S., and Hondo, R. (1990) J. Clin. Micrabiul. 28, 14691472.
ENZYME-LINKED 5. Keller, (1990)
G. H., Huang, D.-P., Shih, J. W.-K., J. Clin. Microbial. 28, 1411-1416.
6. Landgraf, A., Reckmann, them. 193,231-235. 7. Heisterkamp, N., Stam, 758-761.
B., and Pingoud, K., and Groffen,
IMMUNOSORBENT and Manak, A. (1991)
J. (1985)
Anal. Nature
M. M. Bio315,
8. Ausubel, F. M., Brent, R., and Moore, 0. D. (1989) Current Protocols in Molecular Biology, Wiley, New York. 9. Tijssen, P. (1985) Practice and Theory of Enzyme Immunoassays, Elsevier, Amsterdam. 10. Sauvaigo, S., Fouque, B., Roget, A., Livache, T., Bazin, H.,
ASSAY Chypre, 3183. 11. Silver,
91
TECHNIQUE
C., and Teoule, J., and Keerikatte,
R. (1990) V. (1989)
Nucleic J. Virol.
Acids
Res. 18,
63,
1924-1928.
3175-
12. Frye, R. A., Benz, C. C., and Liu, E. (1989) Oncogene 4, 11531157. 13. Becker-Andre, M., and Hahlbrock, K. (1989) Nucleic Acids Res. 17,9437-9446. 14. Gilliland, G., Perrin, S., Blanchard, K., and Bunn, H. F. (1990) Proc. Natl. Acad. Sci. USA 87, 2725-2729. 15. Wittwer, C. T., Fillmore, G. C., and Garling, D. J. (1990) Anal. Biochem. 186, 328-331.
198,86-91
BIOCHEMISTRY
(1991)
Direct Analysis of Polymerase Chain Reaction Products Using Enzyme-Linked lmmunosorbent Assay Techniques Axe1 Landgraf,*
Bernd
Reckmann,?
and Alfred
Pingoud*
*Abteilung Biophysiha1isch.e Chemie, Zentrum Biochemie, Medizinische Hochschule Hannover, D-3000 Hannover 61, Germany; and TDiagrwstica Forschung, E. Merck, D-6100 Darmstadt 1, Germany
Received
March
11, 1991
PCR products obtained using primers carrying at their 6’ends biotin and an antigenic group (e.g., fluorescein) can be quantitatively analyzed by immunological techniques. The procedure described here does not require electrophoretic separation and/or hybridization with radioactive probes. It takes advantage of the fact that biotinylated DNA can be immobilized on avidin- or streptavidin-coated microtiter plates and then can be quantitated by an ELISA specific for the antigenic group. The PCR/ELISA procedure is suitable for routine diagnostic purposes and lends itself to automation. The sensitivity of the immunological detection system that employs horseradish peroxidase linked to antifluorescein antibodies is high: 1 ~1 of the PCR mixture obtained after approximately 26 cycles of amplification of 1 ng/pl genomic template DNA is sufficient for the detection of human single-copy genes. The usefulness of the procedure for the quantitative analysis of the amount of DNA present in a blood or tissue sample is discussed. 0 1991 Academic Press, Inc.
The polymerase chain reaction (PCR)’ was described in detail in 1985 by Saiki et al. (1) as a new method for the analysis of specific DNA sequences. The simplicity and power of this method has led to its fast spread, it is now one of the most popular methods in molecular biology. In general, PCR reaction mixtures are analyzed by gel electrophoresis, which allows the product of interest to be unequivocally identified by its size. Electrophoretie separation, however, is time consuming and cannot easily be included in an automatic process. This has 1 Abbreviations used: ELISA, enzyme-linked immunosorbent assay; FITC, fluorescein isothiocyanate; HRPO, horseradish peroxidase; PBS, phosphate-buffered saline; PCR, polymerase chain reaction.
prevented the PCR-based DNA diagnosis from becoming a routine procedure in the clinical laboratory. Several attempts have been undertaken, therefore, to circumvent electrophoretic separations to identify specific PCR products. SyvHnen et al. (2) have employed hybridization between the biotinylated PCR products and an oligonucleotide probe followed by immobilization of the complex on avidin-coated latex beads. Saiki et al. (3) have demonstrated that the biotinylated PCR product can be detected specifically by hybridization to an oligonucleotide probe immobilized on a nylon membrane. Inouye and Hondo (4) have bound PCR products to microtiter plates and, after hybridization with a biotinylated oligonucleotide probe, detected the specific PCR product by an enzyme-linked immunosorbent assay (ELISA). A similar approach was used by Keller et al. (5), who have bound the PCR products to DNA immobilized on a microtiter plate and identified the specific product with a biotinylated oligonucleotide employing an immunological technique. While these procedures are dependent on hybridization to identify the specific PCR product, it was shown recently that by a careful selection of the primer pair and the PCR conditions the specific PCR product can be quantitated directly without the use of electrophoretic separation and/or hybridization to identify the desired product (6). In this work biotinylated and fluorescent primers were used, the PCR product was immobilized on avidin-coated beads; and the fluorescence was measured after denaturation of the double-stranded PCR product. In the present work we have used an immunological technique that allows us to quantitate the PCR product directly after immobilization of the biotinylated DNA. The advantage of this approach is that it makes use of standard equipment and reagents that are widely used for the automatic processing of ELISA series and, therefore, should allow us to carry out PCR-based DNA diagnosis for routine purposes in the clinical laboratory.
86 All
Copyright 0 1991 rights of reproduction
0003-2697/91$3.00 by Academic Press, Inc. in any form reserved.
ENZYME-LINKED
MATERIALS
AND
IMMUNOSORBENT
METHODS
PCR DNA was extracted from human blood by standard procedures. The following primers complementary to a 108bp target sequence of the human abl proto-oncogene exon II (7) were synthesized using P-cyanoethylphosphoramidites (Milligen) and aminolink II (Applied Biosystems) on a Biosearch Model 8600 DNA synthesizer: A: d(aminolink GCATCTGACTTTGAGCCTCAG) B: d(aminolink CAGTGCAACGAAAAGGTTGGGGTC). Primers A and B were chemically modified using biotinylamidocaproat-N-hydroxysuccinimidester (Sigma) and fluorescein isothiocyanate (FITC) (Sigma), respectively, as described previously (6). The PCR was carried out in a volume of 30 to 100 ~1, with 1 ng/pl template DNA (human genomic DNA prepared from white blood cells), 1 pM of each primer, 200 pM of each dNTP, 2U/lOO ~1 Taq polymerase (BRL), in 10 mM Tris/HCl, pH 8.5, 50 mM KCl, 1.5 mM MgCl,, 0.01% (w/v) gelatin, if not otherwise stated. For the PCR, 16 to 36 cycles (1 min at 92”C, 2 min at 6O”C, 1 min at 74“C; i.e., in a cycle time of 4 min, including the time needed to reach the desired temperatures) were carried out in a Peltier element-based thermocycler (TPS 5 * 4, Fa. Landgraf, Hannover). ELISA The ELISA was carried out in microtiter plates (Maxisorp F96 and Covalink, Nunc) that had been coated with 1 pg/ml affinity-purified avidin (13 U/mg, Sigma) by incubation at room temperature overnight in 100 pi/well with subsequent washing. Some experiments were carried out with microtiter plates that had been incubated after the coating with 1 pg/ml bovine serum albumin or gelatin (both from Sigma) in PBSTween (140 mM NaCl, 2.7 mM KCl, 4.3 mM N%HPO,, 1.4 mM K,HPO,, 0.05% (w/v) Tween 50, pH 7.2). Coated microtiter plates were stored up to 3 days at 4°C. In order to examine the result of the coating process and to check the stability of the coating upon storage, the amount of avidin or streptavidin bound to the microtiter plates was determined by an ELISA using anti-avidin- (Dakopatts) or anti-streptavidin-antibody-horseradish peroxidase (HRPO) conjugates (Dianova), both at a 1:3000 dilution in PBS-Tween (details of the ELISA are given below). One microliter of the PCR product mixture was diluted with 50 ~1 PBS-Tween and incubated for 30 min at room temperature in the well of a coated microtiter plate that was then washed 6 times with PBS-Tween to remove nonincorporated fluorescent primers. The
ASSAY
TECHNIQUE
87
amount of the specific PCR product bound via its biotin residue to the avidin- or streptavidin-coated microtiter plate was determined by incubating the plates for 30 min at room temperature with 50 cLl/well anti-FITC-antibody-HRPO conjugate (Dakopatts) at a 1:500 dilution in PBS-Tween. The plate was subsequently washed six times with PBS-Tween. For the ELISA, 1 mg of 3,3’,5,5’-tetramethylbenzidin (Sigma) was dissolved in 1 ml dimethyl sulfoxide and then diluted 1:lO with 50 mM Na-acetate:citric acid, pH 4.9. After addition of 3 ~1 of 30% (v/v) H,O,, 80 ~1 of this solution was pipeted into each well. The reaction was allowed to proceed for 2-5 min and was then stopped by 80 ~1 of 2 M H,SO,. The optical density of the solution was determined at 450 nm (Immunoreader, Nunc). All experimental data reported here are the results of assays carried out in triplicate and represent mean values. RESULTS Principle
of the
PCRIELISA
Procedure
It has been our goal to develop a procedure to identify and quantitate specific PCR products that does not include electrophoretic separation and/or hybridization, as well as avoids radioactive labeling. To be useful for the routine laboratory such a procedure should employ standard equipment and reagents and should in principle allow automation. The procedure described here fulfills these requirements. It makes use of the fact that the PCR can be carried out with primers carrying bulky substituents at their 5’ end. It should thus be possible to immobilize the PCR product via a functional group present at the 5’ end of one primer and identify and quantitate the product by another functional group present at the 5’ end of the other primer. This approach was used by us in the past with primers carrying a biotin and fluorescein group. The PCR product that contains the biotinylated primer as well as excess biotinylated primers was bound to avidin or streptavidin agarose, while the fluorescent primer was washed off. The amount of PCR product could be quantitated by determining the amount of fluorescent primer incorporated into double-stranded DNA simply by denaturing the immobilized double-stranded DNA by alkali, eluting the fluorescent single-stranded DNA, and measuring the fluorescence in the supernatant. In an effort to make this procedure more convenient for the routine laboratory we have now introduced the following modifications: the biotinylated DNA is immobilized on avidincoated microtiter plates and directly quantitated by an ELISA. The principle of the procedure is shown in Fig. 1. Optimization of the Avidin
Coating of Microtiter
Plates
The coating of microtiter plates with avidin or streptavidin was carried out according to standard proce-
88
LANDGRAF,
RECKMANN,
PCR I abl-lla
PCR product
I
(108 bp)
abl-lib
immobilisation,
AND
PINGOUD
Several attempts were undertaken to increase the amount of avidin bound to the microtiter plate and, thereby, to increase its capacity to bind biotinylated DNA. Neither exposure of the microtiter plates to synchrotron radiation nor mechanical grinding of the microtiter plates to activate or increase the surface resulted in better coating yields. Microtiter plates from suppliers other than Nunc gave the same or almost the same result. Derivatized microtiter plates with aliphatic amino groups (Covalink, Nunc) that can be biotinylated with biotinsuccinimid ester did not lead to a better binding capacity for avidin (data not shown). of PCR Products
Identification
addition of antibody-HRPO conjugate
ELISA
by ELISA
To demonstrate the principal feasibility of the procedure a 10%bp sequence within the abl exon II was amplified by the PCR using biotinylated and fluoresceinlabeled primers. It had been established before by an electrophoretic analysis that with the primers chosen and under the PCR conditions employed the 10%bp target sequence is the only one that is amplified [for details cf. (S)]. This is a prerequisite for the direct analysis of PCR products without electrophoretic separation and/ or hybridization as carried out here with an ELISA. For this purpose aliquots of the reaction mixture obtained after 16 to 36 cycles were pipeted into the wells of an avidin-coated microtiter plate. After adsorption and washing, the amount of biotinylated PCR product was determined by an ELISA using an anti-FITC-antibodyHRPO conjugate. Figure 3 shows that increasing number of cycles increases the signal. Control experiments demonstrate that without template in the PCR only a very weak signal is obtained and that denaturation of
FIG. 1. Scheme of the PCR/ELISA procedure. The PCR is carried out with biotinylated and fluorescein-labeled primers (a). The PCR product as well as nonincorporated biotinylated primers are bound to avidin-coated microtiter plates; nonincorporated fluorescein-labeled primers are washed off (b). The PCR product is quantitated by means of an ELISA using an anti-FITC-antibody-HRPO conjugate (c).
dures developed for the adsorption of proteins on polystyrene surfaces (8). Figure 2 shows that under the conditions employed, saturation is obtained at a concentration of 0.5 pg/ml avidin or streptavidin. This value is typical for protein binding to microtiter plates (9). The binding of avidin and streptavidin to the polystyrene surface of the microtiter plates is stable toward incubation with 100 mM NaOH and all wash procedures used here. For subsequent analyses the coating was carried out with 50 ~1 of a 1-pg/ml avidin or streptavidin solution. The accessible 80-mm2 surface of each well binds 20 ng (400 fmol) avidin. Thus, with a nominal specific activity of 13 U/mg avidin, 1.5 pmol biotin can be bound per coated well.
-
I
0
I
0,2
a4
I
I
I
0,s
0.8
1
12
c bglmll
FIG. 2. Binding of avidin and streptavidin to microtiter plates. The wells of microtiter plates were filled with 100 pl of avidin or streptavidin solution and incubated overnight at room temperature. The amount of avidin or streptavidin bound was determined by an ELISA employing anti-avidinor anti-streptavidin-antibody-HRPO conjugates.
ENZYME-LINKED
IMMUNOSORBENT
the immobilized DNA by alkali and removal of the fluorescein-labeled single strand from the microtiter plate led to disappearance of the signal. Binding of the PCR product to the microtiter plate is via avidin, because the ELISA with uncoated microtiter plates does not give a signal. Fluorescein-labeled single-stranded DNA or the anti-biotin-antibody-HRPO conjugate by themselves are not significantly bound to the avidin-coated microtiter plate as shown by the ELISA. To find out how much of the PCR product can be bound to the microtiter plate, increasing amounts of a PCR product were incubated in the wells of an avidincoated microtiter plate. Figure 4 shows that approximately 1.5 pmol biotinylated DNA can be bound per well, which corresponds to the value calculated on the basis of the nominal specific activity of avidin and the experimentally determined number of avidin molecules bound to the well of a microtiter plate. The capacity of the avidin-coated microtiter plate is approximately a factor of 10 too low to allow detection of the PCR product by fluorescence, as described recently for PCR products immobilized on avidin agarose beads. The advantage of the ELISA, therefore, is its higher sensitivity, which allows one to use microtiter plates to immobilize the PCR product and to separate it from reactants interfering with signal detection. ELISA-based detection procedures frequently are made more sensitive by reducing nonspecific binding of
A 450
12 l-
w
-
W-
Cycles:
16
20
24
26
32
36
a
b
c
d
e
FIG. 3. ELISA-mediated detection of the human cab1 proto-oncogene following amplification by the PCR. A 108-bp sequence of exon II of the human c-abl proto-oncogene was amplified for 16-36 cycles by the PCR. Four microliters of the reaction mixture was incubated with an avidin-coated microtiter plate. After washing, the immobilized PCR product was detected by an ELISA employing an antiFITC-antibody-HRPO conjugate. (a-e) Control experiments: (a) The PCR reaction was carried out for 36 cycles without a template present. (b) The immobilized PCR product was incubated with 100 mM NaOH for 10 min to denature the double-stranded DNA, thereby removing the fluorescein-labeled strand, i.e., the antigen for the subsequent ELISA. (c) The PCR product was incubated with an uncoated microtiter plate. (d) The coated microtiter plate was incubated with the Auorescein-labeled primer. (e) No PCR product was present.
ASSAY
89
TECHNIQUE
A 450 04 i
O-6 -I
0
If
I 0
1
I
I
I
I
2 biotin
3
4
5
primer
I
[pMol]
FIG. 4. The capacity of avidin-coated microtiter plates to bind biotinylated DNA. The binding of biotinylated DNA to avidin-coated microtiter plates was determined by incubating the microtiter plates with varying amounts of a PCR product mixture. The ELISA was carried out with an anti-FITC-antibody-HRPO conjugate.
the antibody to the microtiter plate. A preincubation of the avidin-coated microtiter plate with gelatin or bovine serum albumin and the addition of these proteins to the incubation buffers did not improve the signal-to-noise ratio. With bovine serum albumin even a reduction of the signal was observed, presumably because the antiFITC antibody had been obtained by immunization with an FITC-albumin conjugate. With 2.5 mg/ml bovine serum albumine in the incubation buffer a substantial amount of even weakly cross-reacting anti-FITCantibody-HRPO conjugates would be prevented from interacting with the fluorescein-labeled DNA. On the basis of these experiments a blocking reaction and the addition of blocking reagents to the incubation buffer seemed to be unnecessary, or even detrimental. The ELISA-based detection of PCR products requires association of the biotinylated fluorescein-labeled DNA to the immobilized avidin as well as association of the anti-FITC-antibody-HRPO conjugate to the biotinylated fluorescein-labeled DNA. To optimize the ELISA we have measured the kinetics of these two processes. A 30-min incubation is optimal for both reactions; it is sufficient to obtain a near-maximal specific signal. A longer incubation leads mainly to an increase of the background signal. For the quantitative determination of template concentration in a given sample that makes use of the PCR it must be considered that only in the exponential phase of the amplification process is there a correlation between template concentration and product formed. Figure 5 shows that an optimal range is 27 to 29 cycles, in which a sufficiently large signal is obtained and the plateau phase is not yet reached. When the PCR is stopped in the exponential phase, only a small fraction
90
LANDGRAF,
RECKMANN,
FIG. 5. Quantitative estimate of template concentration by PCR/ ELISA. One, ten, and one hundred nanograms of genomic DNA were amplified for 22 to 35 cycles by the PCR. One microliter of the PCR product mixture was immobilized on avidin-coated microtiter plates and quantitated by an ELISA employing an anti-FITC-antibodyHRPO conjugate. The height of the columns represents the ELISA signal A, obtained with the PCR products. The data shown are the means of three independent experiments, the average deviation being less than lo%, mainly due to inaccuracy in pipeting microliter volumes.
of the primers has been incorporated into product. We have verified that excess biotinylated primers do not affect the sensitivity of the procedure by adding more biotinyl primers and demonstrate a lack of effect. DISCUSSION
The results presented here and elsewhere (6,lO) demonstrate that specific DNA sequences can be detected by employing modified primers, without recourse to additional size or sequence information, as is done when PCR products are identified by gel electrophoresis or hybridization (2,4). The procedure described in the present paper takes advantage of the fact that the doublestranded DNA produced in the PCR carries at its ends a biotin and a fluorescein group, respectively. This means that all PCR products that have this feature give a positive signal. It is mandatory, therefore, that the PCR be conducted such that only specific products are obtained. This can be done by designing appropriate primers and choosing highly selective amplification conditions. There are numerous examples in the literature where it was shown that the desired product is the only detectable one; e.g., the absence of even minor contaminants was demonstrated by on-line fluorescence detection of electrophoretically separated PCR products (11). While the procedure described here allows the quantification of PCR products, it must be emphasized that for the reliable determination of template concentration in a given sample by PCR the reaction must be
AND
PINGOUD
stopped in the exponential phase and requires standardization, e.g., by carrying out differential PCR (12). In principle, reaction products can also be analyzed in the plateau phase. This, however, requires competitive amplification with very similar template DNA and primer pairs (13,14). Standardization by differential or competitive PCR can be easily implemented in our protocol by using primers with different haptens (e.g., digoxigenin) and carrying out a double ELBA. The reliability of the procedure is determined mainly by the PCR (quality of the DNA sample and the polymerase preparation) and the accuracy in pipeting small volumes. The sensitivity of the procedure described here is not limited by the ELISA detection system but rather by the residual nonspecific binding of the FITC-labeled oligodeoxynucleotides to the microtiter plates. Using other detection systems, such as those employing alkaline phosphatase or luciferase, therefore, would not make the procedure more sensitive. We are currently trying to reduce nonspecific binding of the primer oligodeoxynucleotides by exchanging the antigenic group, which might be responsible for the nonspecific binding. The main advantage of the procedure presented here is given by the possibility of processing many samples in parallel, e.g., 96 samples on one microtiter plate, using instrumentation developed for the processing of ELISA series. In addition, the procedure is very fast: less than 2 h are needed to carry out the analysis after the PCR product is obtained. In combination with novel fast PCR techniques (15) a complete assay can be carried out in 2 h, including the PCR. This is a promising aspect for several clinical applications in which a fast DNAbased diagnosis is needed, e.g., for tumor and tissue typing, or identification of pathogenic microorganisms and viruses in patients.
ACKNOWLEDGMENTS We thank Dr. Anja FlieP and Dr. Heiner Wolfes for synthesizing the oligodeoxynucleotides. The assistance of Thomas Nitsche, Juliane Warnke, and Elke Thedinga in the development of the PCR/ ELISA procedure is gratefully acknowledged. Thanks are due to Ms. Andrea Meyer for typing the manuscript. This work was funded in part by a grant from the Fonds der Chemischen Industrie.
REFERENCES 1. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Science 230,1350-1354. 2. Syvlinen, A. C., Bengtstriim, M., Tenhunen, J., and Siiderlund, H. (1988) Nucleic Acids Res. 16, 11,327-11,338. 3. Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989) Proc. Natl. Acad. Sci. USA 86,6230-6234. 4. Inouye, S., and Hondo, R. (1990) J. Clin. Micrabiul. 28, 14691472.
ENZYME-LINKED 5. Keller, (1990)
G. H., Huang, D.-P., Shih, J. W.-K., J. Clin. Microbial. 28, 1411-1416.
6. Landgraf, A., Reckmann, them. 193,231-235. 7. Heisterkamp, N., Stam, 758-761.
B., and Pingoud, K., and Groffen,
IMMUNOSORBENT and Manak, A. (1991)
J. (1985)
Anal. Nature
M. M. Bio315,
8. Ausubel, F. M., Brent, R., and Moore, 0. D. (1989) Current Protocols in Molecular Biology, Wiley, New York. 9. Tijssen, P. (1985) Practice and Theory of Enzyme Immunoassays, Elsevier, Amsterdam. 10. Sauvaigo, S., Fouque, B., Roget, A., Livache, T., Bazin, H.,
ASSAY Chypre, 3183. 11. Silver,
91
TECHNIQUE
C., and Teoule, J., and Keerikatte,
R. (1990) V. (1989)
Nucleic J. Virol.
Acids
Res. 18,
63,
1924-1928.
3175-
12. Frye, R. A., Benz, C. C., and Liu, E. (1989) Oncogene 4, 11531157. 13. Becker-Andre, M., and Hahlbrock, K. (1989) Nucleic Acids Res. 17,9437-9446. 14. Gilliland, G., Perrin, S., Blanchard, K., and Bunn, H. F. (1990) Proc. Natl. Acad. Sci. USA 87, 2725-2729. 15. Wittwer, C. T., Fillmore, G. C., and Garling, D. J. (1990) Anal. Biochem. 186, 328-331.
