Peptides 61 (2014) 98–106

Contents lists available at ScienceDirect

Peptides journal homepage: www.elsevier.com/locate/peptides

Differential stress response in rats subjected to chronic mild stress is accompanied by changes in CRH-family gene expression at the pituitary level Magdalena Kolasa, Agata Faron-Górecka ∗ , Maciej Ku´smider, Kinga Szafran-Pilch, ˙ Joanna Solich, Dariusz Zurawek, Piotr Gruca, Mariusz Papp, Marta Dziedzicka-Wasylewska Department of Pharmacology, Institute of Pharmacology, Polish Academy of Sciences, Kraków, Poland

a r t i c l e

i n f o

Article history: Received 23 July 2014 Received in revised form 4 September 2014 Accepted 8 September 2014 Available online 16 September 2014 Keywords: Chronic mild stress Pituitary ACTH CRH Urocortins Stress resilience Correlation

a b s t r a c t The purpose of this study was to examine molecular markers of the stress response at the pituitary and peripheral levels in animals that responded differently to chronic mild stress (CMS). Rats were subjected to 2-weeks CMS and symptoms of anhedonia was measured by the consumption of 1% sucrose solution. mRNA levels of CRH-family neuropeptides (Crh—corticotropin-releasing hormone, Ucn1—urocortin 1, Ucn2—urocortin 2, Ucn3—urocortin 3), CRH receptors (Crhr1—corticotropin-releasing hormone receptor 1, Crhr2—corticotropin-releasing hormone receptor 2) and Crhbp (corticotropin-releasing factor binding protein) in the pituitaries of rats were determined with real-time PCR. Plasma levels of ACTH (adrenocorticotropin), CRH and urocortins were measured with ELISA assays. CMS procedure led to the development of anhedonia manifested by the decreased sucrose consumption (stress-reactive, SR, stress-susceptible group). Additionally, the group of animals not exhibiting any signs of anhedonia (stress non-reactive, SNR, stress-resilient group) and the group characterized by the increased sucrose consumption (stress invert-reactive group SIR) were selected. The significant increases in ACTH plasma level accompanied by the decreases in the pituitary gene expression of the Crh, Ucn2 and Ucn3 in both stress non-reactive and stress invert-reactive groups were observed. The only molecular change observed in stress-reactive group was the increase in UCN2 plasma level. The differentiated behavioral stress responses were reflected by gene expression changes in the pituitary. Alterations in the mRNA levels of Crh, Ucn2 and Ucn3 in the pituitary might confirm the paracrine and/or autocrine effects of these peptides in stress response. The opposite behavioral effect between SNR vs. SIR groups and the surprising similarity at gene expression and plasma ACTH levels in these two groups may suggest the discrepancy between molecular and behavioral stress responses; however, there results might indicate to similarity underlying different ways to cope with stress conditions. © 2014 Elsevier Inc. All rights reserved.

Introduction The pituitary, as a part of the hypothalamic–pituitary–adrenal (HPA) axis, plays a significant role in the stress response. The main regulator of the HPA axis under basal and stress conditions is corticotropin-releasing hormone (CRH) [43,53] and its related peptides, the urocortins, i.e., UCN1, UCN2 and UCN3 [20,24,42,55].

∗ Corresponding author at: Institute of Pharmacology Polish Academy of Sciences, ˛ Street 12, Kraków 31-343, Poland. Department of Pharmacology, Smetna Tel.: +48 12 662 33 1; fax: +48 12 637 45 00. E-mail addresses: [email protected], [email protected] (A. Faron-Górecka). http://dx.doi.org/10.1016/j.peptides.2014.09.008 0196-9781/© 2014 Elsevier Inc. All rights reserved.

The biological actions of the CRH family of neuropeptides are mediated by two types of receptors, CRHR1 and CRHR2 [9]. CRH is relatively selective for CRHR1 over CRHR2 (10-fold higher Ki) [41], while UCN1 binds to both CRHR1 and CRHR2 with high affinity [9,26]. UCN2 and UCN3 are considered endogenous ligands for the CRHR2 receptor [20,24,42]. Additionally, CRH and UCN1 bind to CRHBP [34], which presumably constrains the biological activities of CRH and UCN1 [45]. In addition to their different pharmacological properties, CRHR1 and CRHR2 are also unique in their expression patterns within the brain and peripheral tissues. Considering the pituitary gland, CRHR1 is the predominant CRH receptor subtype [17]. Crhr1 mRNA has been detected in the intermediate lobe of the pituitary and in a subset of corticotropes, lactotropes and gonadotropes in the anterior lobe of the murine

M. Kolasa et al. / Peptides 61 (2014) 98–106

pituitary [9,27,38,54,60]. Within the pituitary, CRHR2 is expressed predominantly in the posterior lobe [9]; however, a very low but detectable level of Crhr2 mRNA is also detected in the anterior lobe in a subset of rat gonadotropes by in situ hybridization [5,54]. In the rat, CRHBP is present in both the brain and the pituitary [1,8,39] and is highly expressed in rodent anterior pituitary [1,46]. Regarding the expression patterns of CRH and the urocortins, all are expressed in the brain and in various peripheral tissues [20,21,24,55], although they exhibit unique neuroanatomical distributions with little overlap [41]. In the pituitary gland, UCN1 protein and mRNA are detected in abundance [33,62] primarily in somatotrophs [21]. UCN2 is biosynthesized in proopiomelanocortin (POMC) cells and is secreted from the anterior and intermediate lobe cells of the rat pituitary [29,65]. Ucn3 mRNA was not detected in the mouse pituitary by the RNase protection assay [24], but its presence was confirmed in the human pituitary by RT-PCR [50]. Crh mRNA was found in the whole rat pituitary gland [52] and the group of cells responsible for Crh expression and secretion in the pituitary appears to be the corticotropes [37]. Furthermore, experimental corticotrope adenomas have also been shown to express Crh mRNA transcripts [63]. The involvement of the CRH/CRHR1 system in regulating the activation of the HPA axis and stress-linked behaviors is well established [41], but the role of the urocortins/CRHR2 system is less understood. According to studies conducted in knock-out mouse models [31,58], it is believed that the CRH/CRHR1 system is involved in initiating stress responses, while the urocortins/CRHR2 system is suggested to terminate the stress response or to restore allostasis. The aim of our study was to identify markers of inter-individual differences in the stress response by examining molecular changes in the pituitary and at peripheral levels. Therefore, we decided to examine the expression of the CRH-family genes in the pituitary and the levels of the CRH-related neuropeptides in the plasma of animals that responded differently to 2-weeks of treatment in a chronic mild stress (CMS) paradigm. CMS is a well-characterized model used to study molecular mechanisms underlying the depressive state. Two weeks of treatment with this procedure leads to the development of anhedonia in rats, which can be measured by the consumption of a palatable 1% sucrose solution [36]. However, some animals subjected to CMS do not develop any behavioral signs of anhedonia. The occurrence of resistance or susceptibility to stress in animals subjected to a CMS has recently gained the interest of researchers [2,10,11,14,51,66], but the molecular signature underlying the observed differences in the behavioral responses to stress still remains unresolved. Experimental procedure Animals Experiments were conducted on adult male Wistar-HAN rats. Rats weighing 250–300 g at the start of the experiment were obtained from Charles River (Germany). Except as described in the chronic mild stress protocol, the animals were housed singly, with food and water freely available. All of the procedures were performed with the approval of the local Bioethics Commission, as compliant with Polish law. Sucrose consumption test A sucrose consumption test was performed according to methods described previously [36]. All of the animals were first trained to consume a palatable weak sucrose solution (1%). Training consisted of an initial 48 h exposure to sucrose, in the place of water, followed

99

by a series of two 60-min sucrose consumption tests that were performed following 12 h of food and water deprivation. Sucrose consumption was measured by weighing pre-weighed bottles. Subsequently, sucrose consumption was monitored at weekly intervals throughout the experiment, using the same procedure. Chronic mild stress protocol The procedure consisted of several mild stressors (such as: periods of food and water deprivation, small temperature reductions, changes of cage mates, and other similar individually mild manipulations) that were applied to the animals for two weeks of stress. A detailed description of the chronic mild stress methodology has been previously published [36,66,67]. During the experiment, the animals develop a behavioral response that is considered to be an anhedonia-like model of depression. This response was measured once a week by a 1% sucrose water solution consumption test. Of the group of animals subjected to the CMS procedure, 70% responded to stress by reduced consumption of sucrose, and 30% of the animals did not developed anhedonia, what was characterized by an unchanged or an excessive consumption of sucrose solution. On that basis, after 2 weeks of CMS, the stressed animals were divided into three groups: the stressreactive group (n = 10), in which animals drank significantly less of the sucrose solution, the non-reactive group (n = 10), in which animals drank the same amount of the solution, and the inversereactive group (n = 10), in which animals drank significantly more of the sucrose solution. Out of these animals 8 in each group were taken for biochemical analyses. Tissue collection and RNA isolation The rats were decapitated 24 h after the second sucrose consumption test at the end of the 2-week CMS treatment. Tissue was collected and stored immediately at −70 ◦ C until measurement. The pituitaries from the experimental animals were homogenized using a TissueLyser (Qiagen, USA), and total RNA was isolated with TRI-reagent (Sigma-Aldrich, Germany). The total RNA concentration was measured using a NanoDrop ND-1000 Spectrometer (ThermoScientific Inc., USA). The quality of the isolated RNA was checked using a microcapillary electrophoresis system (BioRad, USA) according to the manufacturer’s instructions, and the samples that passed the quality threshold (RIN > 8.0) were used for further experiments. Quantitative PCR (qPCR) RNA was reverse-transcribed with random hexamers to cDNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). Real-time PCRs were performed in a Chromo4 Real-Time Detector System (Bio-Rad Laboratories, Inc., USA) and Opticon Monitor Software v.3 (Bio-Rad, USA). The primer concentrations and annealing temperatures were checked and optimized experimentally. Real-time PCR amplification was performed in a total reaction volume of 20 ␮l, consisting of 10 ␮l Fast SYBR Green Master Mix (Applied Biosystems, USA), 0.5 ␮M forward primer, 0.5 ␮M reverse primer, and 5 ␮l cDNA template (ca. 5–10 ng reverse-transcribed total RNA per well). The primers used for the real-time polymerase amplifications were used as previously described for Crh [16], Crhr1, Crhr2, Ucn1 [6], Ucn2 [12], Ppia [64] and Rpl32 [57]. Primers for Ucn3 were designed and checked for specificity with BLAST (NCBI). The sequences of the primers and the annealing temperatures for each target are given in Table 1. The thermal cycling profile consisted of an initial incubation at 95 ◦ C for 10 s, followed by 40 cycles of denaturation at 95 ◦ C for 15 s, annealing at a primer-specific temperature (Table 1) for 1 min and ending

100

M. Kolasa et al. / Peptides 61 (2014) 98–106

Table 1 Primers used for qPCR amplifications and annealing temperatures used for each pairs of primers. Accesion no.

Symbol

Forward primer (5 -3 )

Reverse primer (5 -3 )

Tann (◦ C)

NM NM NM NM NM NM NM NM NM

Crh Crhr1 Crhr2 Crhbp Ucn Ucn2 Ucn3 Rpl32 Ppia

GGAGCCGCCCATCTCTCT AAGGCGGGATCCAGGCAGTAGAGA CTGGTGGCTGCTTTCCTGCTTTTC TACGACCCTTTCCTGCTTTTCAGC TATAGATCTGGCACCATGAGGCAGAGGGGA CCTGGATGTCCCCATTGG CTTACAGGGAGCGATGCTGATGC GTGAAGCCCAAGATCGTC TGACTTCACACGCCATAAT

TCCTGTTGCTGTGAGCTTGCT TCCCGGTAGCCATTGTTTGTCGTG ATGGGGCCCTGGTAGATGTAGTCC CTCCAGCTGACGATACTCAAA CGCGAATTCCGATCACTTGCCCACCGAATC GATTCCTGGCAGCCTTGTTC TGGGAGAGGCTTGTCCTTGGGC GAACACAAAACAGGCACAC AGATGCCAGGACCTGTATGC

55 58.2 63 60 67 53.5 60 60 60

a

031019 030999 022714 139183 019150 133385 001080208 013226a 017101a

Reference genes used for normalization.

with 1 cycle of final elongation at 72 ◦ C for 7 min. For the qPCR reactions, cDNA was taken from 8 individuals from each group. The samples were run in duplicates, with no template controls in each experiment. A melting curve analysis was performed to confirm the amplification specificity of the PCR products. The results were calculated using qbasePLUS 2.0 software (Biogazelle) and Ct method [19]. The results were normalized to the means of two reference genes, i.e., peptidylprolyl isomerase A (Ppia) and ribosomal protein L32 (Rpl32). Reference genes stability was determined by calculating their M value (M) and their coefficient of variation on the normalized relative quantities (CV). For selected reference genes the obtained average M = 0.680 and CV = 23.6%, what are values accepted for heterogeneous samples [19].

Results

Peptide concentration in plasma

Gene expression of the CRH family in the pituitary

Upon decapitation, blood was collected into tubes containing EDTA and the plasma was then separated via centrifugation (1500 × g for 15 min at 4 ◦ C) and stored at −80 ◦ C for further analyses. The concentrations of the peptides in the plasma were determined in duplicates by an enzyme-linked immunosorbent assays (ELISA) using commercially available kits for rat CRH, UCN1, UCN2, UCN3, CRHBP and ACTH (manufactured by Uscn, Life Science Inc., China). The plasma samples were diluted 500- and 50-fold in 0.01 M PBS (pH 7,0) for CRHBP and UCN2 assays, respectively, to fall within the range of the standard curves. According to the manufacturers’ literature supplied with the ELISA kits, the assay sensitivities were 5.6 pg/ml for CRH; 5.9 pg/ml for CRHBP; 6.5 pg/ml for UCN1; 7.4 pg/ml for UCN2; 0.056 ng/ml for UCN3 and 4.6 pg/ml for ACTH. The ELISA procedures were performed as described by the manufacturers. Results were analyzed with the use of the standard curves.

Using the qPCR method, we determined the mRNA levels of the CRH-family neuropeptides (Crh, Ucn, Ucn2 and Ucn3), CRH receptors (Crhr1, Crhr2) and Crhbp in the pituitaries of experimental animals from each group. The levels of the expressed genes were measured using a relative quantitative method (efficiencycorrected), with the Ppia and Rpl32 genes used as reference genes and the control group as a calibrator. According to the results

Sucrose intake In the final baseline test after two weeks of stress, sucrose intakes were significantly different between the controls and the stressed animals (F(1,40) = 21.11, p < 0.0001). Sucrose intakes were significantly lower in the stress-reactive group compared to the controls (means ± standard error = 1.71 ± 0.16 vs. 9.74 ± 2.16; p < 0.001). In the stress non-reactive animals, sucrose intakes were comparable to the control group (11.31 ± 1.08 and 9.74 ± 2.16, respectively). Sucrose intakes were significantly higher in the stress invert-reactive group than in the control group (15.62 ± 0.71 vs. 9.74 ± 2.16, respectively; p < 0.001; Fig. 1).

Statistics The results were presented as means ± SEM. The sucrose intake values from the CMS behavioral tests were analyzed with repeated measures ANOVA followed by Bonferroni’s post hoc test. The data from the qPCR experiments were analyzed by one-way ANOVA implemented in qbasePLUS 2.0 software and a Bonferroni post hoc test. The data from the ELISA tests were analyzed using one-way ANOVA (GraphPad Prism 5.0, USA) and a post hoc Dunnett test. A p-value of less than 0.05 indicated statistically significant results. Spearman correlation coefficients between the gene expression values for each pair of genes were calculated in Statistica 10 (StatSoft Inc., USA). The correlations between gene expression or concentrations of peptides in rat plasma and behavioral parameters, i.e., sucrose intake, were calculated in Statistica 10 (StatSoft Inc., USA). Spearman’s correlation coefficients were considered significant at p < 0.05.

Fig. 1. Sucrose intake as a measure of anhedonia in rats subjected to 5 weeks of adaptation and 2 weeks of exposure to chronic mild stress (CMS). On that basis, after 2 weeks of CMS, the stressed animals were divided into three groups: the stressreactive group, in which animals drank significantly less of the sucrose solution, the non-reactive group, in which animals drank the same amount of the solution, and the inverse-reactive group, in which animals drank significantly more of the sucrose solution. The data are presented as the mean ± SEM, n = 10 per group. The data were analyzed by a one-way ANOVA, followed by a post hoc Dunnett test. *p < 0.05, **p < 0.01 vs. control group.

M. Kolasa et al. / Peptides 61 (2014) 98–106

101

Fig. 2. A graph representing the relative quantities of gene expression (RQ) ± SEM. The data were analyzed by a one-way ANOVA, followed by a post hoc Bonferroni test. *p < 0.05, **p < 0.01, ***p < 0.001 vs. control group; #p < 0.05, ##p < 0.01 vs. stress-sensitive group. C = Control; S-R = stress reactive; S-NR = stress non-reactive; S-IR = stress invert-reactive. Crh—Corticotropin-releasing hormone, Ucn1—urocortin 1, Ucn2—urocortin 2, Ucn3—urocortin 3, Crhbp—corticotropin-releasing factor binding protein, Crhr1—corticotropin-releasing hormone receptor 1, Crhr2—corticotropin-releasing hormone receptor 2.

of a one-way ANOVA, there were significant differences in the expression of the Crh (p = 0.0002), Ucn2 (p = 0.016) and Ucn3 (p = 0.038) genes. In all of these cases, there were significant decreases in the stress non-reactive group compared to the stressreactive group. When compared to the control group, statistical significance was reached for Crh and Ucn2. For the Crh gene, there was also a statistically significant difference in the expression level between the stress-reactive and stress invert-reactive groups (Fig. 2).

Peptide concentrations in the plasma UCN3 plasma concentration was below the limit of detection of the assay in all samples. No significant differences in the plasma levels of CRH, CRHBP and UCN1 were observed. The increases in UCN2 plasma level in stress-reactive vs. control group and in ACTH plasma level in stress-non reactive and stress invert-reactive groups vs. control group were obtained (Fig. 3).

Spearman’s rank correlation Correlation between gene expression levels in pituitary Statistically significant positive correlations were observed in the control group between the following pairs of genes: Crh and Crhr1 (Spearman’s rank coefficient, rS = 0.9642, p < 0.05), Crh and Crhr2 (rS = 0.9285, p < 0.05), Crh and Ucn2 (rS = 1.000, p < 0.05), Crh and Ucn3 (rS = 0.9285, p < 0.05), Crhr1 and Crhr2 (rS = 0.9642, p < 0.05), Crhr1 and Ucn3 (rS = 0.9642, p < 0.05), Crhr2 and Ucn2 (rS = 0.9285, p < 0.05), Crhr2 and Ucn3 (rS = 0.9285, p < 0.05), and Ucn2 and Ucn3 (rS = was 0.9285, p < 0.05). Statistically significant positive correlations were observed in the stress-reactive group for the following pairs of genes: Crh and Crhr1 (rS = 0.9285, p < 0.05), Crh and Ucn2 (rS = 0.9047, p < 0.05), Crh and Ucn3 (rS = 0.8095, p < 0.05), Crhr1 and Ucn2 (rS = 0.9761, p < 0.05), Crhr1 and Ucn3 (rS = 0.9285, p < 0.05), and Ucn2 and Ucn3 (rS = 0.9523, p < 0.05). In both the stress non-reactive and stress invert-reactive groups, fewer significant correlations were detected. In the stress non-reactive group, positive correlations between Crh and Ucn2 (rS = 0.7619, p < 0.05), Crh

M. Kolasa et al. / Peptides 61 (2014) 98–106

ACTH

*

*

1000 750 500 250 0

C

S-R

S-NR

S-IR

concentration of CRH (pg/ml)

CRH

1250

40

concentration of UCN2 (pg/ml)

concentration of ACTH (pg/ml)

102

300

30 20 10 0

C

S-R

S-NR

S-IR

10

5

0

C

S-R

S-NR

concentration of CRHbp (ng/ml)

concentration of UCN1 (pg/ml)

UCN2 UCN 1

15

S-IR

*

250 200 150 100 50 0

C

S-R

S-NR

S-IR

CRHbp

50 40 30 20 10 0

C

S-R

S-NR

S-IR

Fig. 3. A graph representing the plasma peptide concentration ± SEM. The data were analyzed by a one-way ANOVA, followed by a Dunnett post hoc test. *p < 0.05, vs. control group. C = Control; S-R = stress reactive; S-NR = stress non-reactive; S-IR = stress invert-reactive. ACTH—Adrenocorticotropin, CRH—corticotropin-releasing hormone, Ucn1—urocortin 1, Ucn2—urocortin 2, CRHbp—corticotropin-releasing factor binding protein.

and Ucn3 (rS = 0.7619, p < 0.05), and Ucn1 and Ucn3 (rS = 0.7619, p < 0.05) were observed. In the stress invert-reactive group, positive statistically significant correlations were observed between Crhr1 and Ucn2 (rS = 0.7142, p < 0.05) and Crhr1 and Ucn3 (rS = 0.9047, p < 0.05). All of the data are presented in Table 2. Correlations between gene expression in the pituitary and concentrations of peptides in the plasma The Spearman Rank Correlation was applied for CRHBP, CRH, UCN1 and UCN2, whose blood levels were determined using commercially available ELISA kits. However, no significant correlations were observed in all groups of animals. Correlations between behavioral effects (sucrose intake) and gene expression in the pituitary A statistically significant negative correlation was observed in the control group for Crhbp and Crhr2 (rS = −0.8857 and −0.8285, p < 0.05). However, in the stress-reactive group, the correlation between sucrose intake and Crhr2 expression was significantly positive (rS = 0.8982, p < 0.05). All of the data are presented in Table 3. Correlations between behavioral effects (sucrose intake) and concentrations of peptides in the plasma No significant correlations between sucrose intake and plasma peptide concentration were observed.

Discussion In this study, we analyzed differences in the expression levels of genes that could be involved in the development of anhedonia in rats subjected to two weeks of chronic mild stress (CMS). Although a longer duration (5 weeks) of CMS is usually applied in research concerning the mechanisms of action of antidepressant drugs [2,61], the symptoms of anhedonia can be observed after a shorter time of stress, as shown both in this study and by others [14,28,48,66]. Moreover, the changes on the molecular level are much more pronounced after shorter period of stress (i.e. 2 weeks) than after longer stress duration (i.e. 5 weeks), probably because of adaptive changes occurring after prolonged stress duration [14,66]. The results obtained in our behavioral studies indicated that two weeks of stress were sufficient to select three groups of animals that differentially responded to a sucrose consumption test. Thirty percent of animals exposed to CMS were resistant to the development of anhedonia (stress-resilient, stress non-reactive group), whereas the remaining animals were responsive to stress, which is in agreement with previously published data [2,36]. In this group of animals, two responses to stress were observed, i.e. drinking significantly less sucrose solution vs. control (stress-susceptible, stress-reactive group) and, on the contrary, drinking significantly more sucrose solution vs. control (stress invert-reactive group).

M. Kolasa et al. / Peptides 61 (2014) 98–106

103

Table 2 Spearman’s coefficient for each pair of genes expression in pituitary. Crh

Crhr1

Crhr2

Ucn1

Ucn2

Ucn3

0.4642 1.0000 0.5000 0.5714 0.2857 0.4642 0.3928

0.9642* 0.5000 1.0000 0.9642* −0.1785 0.9642* 0.9642*

0.9285* 0.5714 0.9642* 1.0000 −0.0714 0.9285* 0.9285*

−0.3214 0.2857 −0.1785 −0.0714 1.0000 −0.3214 −0.1428

1.0000* 0.4642 0.9642* 0.9285* −0.3214 1.0000 0.9285*

0.9285* 0.3928 0.9642* 0.9285* −0.1428 0.9285* 1.0000

1.0000 0.6190 0.9285* 0.4523 −0.0476 0.9047* 0.809*

0.6190 1.0000 0.4523 −0.0476 0.5476 0.4285 0.4761

0.9285* 0.4523 1.0000 0.3571 −0.1904 0.9761* 0.9285*

0.4523 −0.0476 0.3571 1.0000 −0.4523 0.3333 0.1428

−0.0476 0.5476 −0.1904 −0.4523 1.0000 −0.0714 −0.0238

0.9047* 0.4285 0.9761* 0.3333 −0.0714 1.0000 0.9523*

0.8095* 0.4761 0.9285* 0.1428 −0.0238 0.9523* 1.0000

1.0000 0.5952 0.4523 0.4523 0.2619 0.7619* 0.7619*

0.5952 1.0000 0.3333 0.6190 0.0476 0.1666 0.4761

0.4523 0.3333 1.0000 −0.0476 0.3809 −0.0238 0.6904

0.4523 0.6190 −0.0476 1.0000 0.1428 0.4523 0.3809

0.7619* 0.1666 −0.0238 0.4523 0.4523 1.0000 0.5952

0.7619* 0.4761 0.6904 0.3809 0.7619* 0.5952 1.0000

0.3095 −0.0952 1.0000 −0.1428 0.1904 0.7142* 0.9047*

0.5714 −0.0952 −0.1428 1.0000 −0.2619 −0.0952 −0.0476

0.4523 0.2857 0.7142* −0.0952 0.1904 1.0000 0.5952

0.4761 −0.4047 0.9047* −0.0476 0.4761 0.5952 1.0000

Control Crh Crhbp Crhr1 Crhr2 Ucn Ucn2 Ucn3

1.0000 0.4642 0.9642* 0.9285* −0.3214 1.0000* 0.9285*

Stress reactive Crh Crhbp Crhr1 Crhr2 Ucn Ucn2 Ucn3 Stress non-reactive Crh Crhbp Crhr1 Crhr2 Ucn Ucn2 Ucn3

Crhbp

Stress invert reactive Crh 1.0000 −0.4285 Crhbp Crhr1 0.3095 Crhr2 0.5714 Ucn 0.0476 Ucn2 0.4523 0.4761 Ucn3

−0.4285 1.0000 −0.0952 −0.0952 −0.2619 0.2857 −0.4047

0.2619 0.0476 0.3809 0.1428 1.0000 0.4523 0.7619*

0.0476 −0.2619 0.1904 −0.2619 1.0000 0.1904 0.4761

Correlations are significant. * p < 0.05.

Interestingly, despite the fact that the behavioral responses of the stress non-reactive and stress invert-reactive groups were different as shown by sucrose consumption, the molecular changes in these two groups were unexpectedly similar at the gene expression level (although the results concerning the S-IR group did not always reach statistical significance they represent very similar trend as in S-NR group). Specifically, we observed the statistically significant increases in the ACTH plasma level in stress-non reactive and stress-invert reactive group. In stress-reactive group ACTH plasma level was slightly elevated, but it did not reach the statistical threshold when compared to control group. According to the literature, ACTH plasma level depends on the type of stress and its duration. CMS procedure conducted on mice for 5 weeks results in the increased plasma level of corticosterone and ACTH [25]. On the other hand, 4 weeks of CMS procedure in rats results in the increased level of corticosterone and no change in ACTH plasma level [56], while 3 weeks of CMS does not affect corticosterone nor ACTH serum level [13,49]. Some reports show the increased

corticotrophin-releasing hormone (CRH) plasma level after 4 or 5 weeks of CMS [25,35,56]. We did not observe any change in CRH plasma level, what may suggest that 2-week CMS procedure was sufficient to produce behavioral effects manifested by anhedonia and stress response linked with increased ACTH plasma level. However, it was too short to induce the up-regulation of CRH plasma level observed in longer period of chronic unpredictable stress [25,35,56] or in depressive disorders [4,15]. Moreover, the dissociation between CRH and ACTH plasma level has been also observed by many other authors [4,23,38], and the origin of plasma CRH is a confounding factor difficult to interpret, as CRH may be released to blood centrally from the hypothalamus as well as from multiple peripheral tissues. In our study, the urocortin 2 (UCN2) plasma level was elevated in stress-reactive group. According to the literature, CMS results not only in anhedonia, but also cardiovascular changes [18]. UCN2 is proved to have beneficial and hemodynamic and renal effects [40]. The elevated UCN2 plasma level observed in animals which developed anhedonia may be secondary to

Table 3 Spearman’s coefficient between behavioral effect (sucrose intake) and gene expression in rats pituitary. Sucrose intake (g)

Gene expression Crh

Crhbp

Crhr1

Crhr2

Ucn1

Ucn2

Ucn3

Control Stress reactive Stress non-reactive Stress invert reactive

−0.6571 0.4670 0.4285 0.0585

−0.8857* 0.0479 0.4642 0.2928

−0.6571 0.3592 0.6071 0.2845

−0.8285* 0.8982* 0.0714 −0.0920

−0.1428 −0.3712 −0.3214 −0.5272

−0.6571 0.2874 −0.1428 0.6192

−0.5428 0.0598 0.1428 0.0502

Correlations are significant. * p < 0.05.

104

M. Kolasa et al. / Peptides 61 (2014) 98–106

cardiovascular changes and may suggest the cardioprotective effect of this peptide. According to our results, UCN2 can also be considered as a peripheral marker of anhedonic (stress-reactive) state of the animals. In our study, we observed changes in the expression levels of Crh, Ucn2 and Ucn3 mRNA in the pituitary and ACTH plasma level which are similar in the two groups of animals subjected to CMS (stress non-reactive and stress invert-reactive). It is also noteworthy that large inter-individual differences in the Crh gene expression in the pituitaries were observed in the stress-reactive group. Hyperactive and/or dysregulated CRH circuits are involved in neuroendocrinological disturbances and stress-related mood disorders, such as anxiety and depression. Generally, in response to stress, hypothalamic neurons release the neuropeptides CRH and arginine vasopressin (AVP), which act synergistically in the anterior pituitary to stimulate the synthesis and release of ACTH [3]. Resilience to stress is usually associated with the capacity to constrain stress-induced increases in CRH (a marker for HPA activation) through an elaborate negative feedback system [7,44]. In our earlier set of experiments, we did not observe any changes in the level of mRNA encoding CRH (in situ hybridization) in the hypothalamus of rats subjected to 5 weeks of CMS (unpublished study). Additionally, Bergström et al. [2] have published data indicating that rats subjected to 5-week CMS (stress-reactive group) displayed slightly increased (although not statistically significant) mRNA encoding CRH in the hypothalamus. Two week of chronic variable mild stress results in the increased Crh mRNA expression in the PVN of the hypothalamus [48]. As mentioned earlier, the duration of chronic stress has a significant impact on stress-related parameters, i.e. central and/or peripheral CRH or ACTH level. The alterations in Crh mRNA expression in the pituitary observed in our study following exposure to stress may suggest a paracrine and/or autocrine effect of CRH. Indeed, the synthesis and secretion of CRH from the anterior pituitary and its effective contribution to ACTH secretion has been proved by Pecori Giraldi and Cavagnini [37]. In our study, we did not observe any changes in the expression of Ucn1 mRNA, but data obtained with the use of knock-out UCN1 mouse models have indicated that UCN1 plays a minor role in stress-induced HPA axis regulation [58]. A similar tendency (although not always reaching statistical significance) as for the Crh mRNA level in the pituitary was observed for Ucn2 and Ucn3 mRNA, i.e., an increase in expression in the stress-reactive group of animals and a significant down-regulation of these genes in stress nonreactive animals. The observed similar expression pattern among Crh, Ucn2 and Ucn3 levels may suggest a common regulatory transcription mechanisms for these genes, i.e. through glucocorticoids [30]. The Ucn2 mRNA expression level in the rat pituitary is also regulated by CRH [29] so there is a possibility that the locally produced CRH could affect the gene expression of Ucn2 and Ucn3. Determining the nature of this transcriptional regulation is beyond the scope of the present study. Although the question about molecular mechanism of the regulation of transcription of Crh and urocortins in the pituitary under chronic stress remains open, our study suggests the putative link between plasma ACTH level (which depends on its secretion from the pituitary) and gene expression of selected CRH-related peptides in the pituitary gland. Crh, Ucn2 and Ucn3 production at the pituitary level might play considerable role in the individual reaction to stress, particularly in developing susceptibility or resilience to stressful events and may be involved in the modulation of HPA axis activity at the level of the pituitary. Additionally, according to the results obtained in our study, it is interesting that there was a similarity between stress non-reactive and stress invert-reactive groups at the level of stress response (i.e. ACTH plasma level and Crh, Ucn2 and Ucn3 gene expression) but

the discrepancy between behavioral effect manifested by sucrose consumption. The heterogeneous behavioral symptoms may also be observed in different clinical depression sub-types that can have opposed features, such as sleep and appetite (i.e. hypersomnia vs. insomnia, weight loss vs. weight gain), but all characterize stress states which probably depend on HPA axis dynamics and reactivity [32]. The experimental data were additionally analyzed by Spearman’s Rank Correlation for each pair of genes expressed in the pituitary in all groups of animals. Interestingly, in the control group we observed numerous positive correlations between genes, which indicate that there is unimpaired homeostasis, as manifested by the positive interactions of these genes. The correlations between Crh and its receptors, Crhr1 and Crhr2, were expected [41]. Similarly, positive correlations were observed for urocortins 2 and 3 with Crh or Crhr2. Both UCN2 and UCN3 are selective for type 2 CRH receptors, and they represent potential endogenous ligands for this receptor [20,24,42]. Unexpectedly, there were significant positive correlations between Crhr1 and Ucn2 and Ucn3, which were observed in the control, stress-reactive and stress invert-reactive groups. Although interactions between CRHR2 and urocortins 2 and 3 have been documented, their interaction with the type 1 CRH receptor is poorly understood, as they display minimal affinity for CRHR1 and are inactive as few as stimulation of adenylate cyclase is concerned in pituitary cells expressing endogenous CRHR1 [24]. It is noteworthy that similarly positive correlations of Crhr1 with Ucn2 and Ucn3 were observed in the stress-reactive and stress invert-reactive groups. In addition, this type of correlation was not observed in the group of animals that did not respond to stress (stress non-reactive). These data suggest that the interaction between CRHR1 and UCN2 or UCN3 not only results from the stress procedure but also reflects the behavioral responses to stress, i.e., either lower or excessive sucrose intake. Another explanation could also be possible without assuming a direct interaction between Crhr1 and Ucn2 or Ucn3. Provided that CRH can locally regulate the expression of the urocortins (shown for Ucn2 by Nemoto et al. [29]) and both of its receptors, Crhr1 and Crhr2, a statistically significant correlation obtained between the expression levels of Crhr1 and Ucn2 or Ucn3 might result from the independent (although similar) regulation of these two genes by CRH. In all groups of animals that were subjected to stress, we observed decrease in the number of significant correlations between genes in the pituitary, which may reflect a disturbance of homeostasis. In search of the molecular basis of stress resilience, we also compared the stress non-reactive group to all of the other groups of animals, and we observed the disappearance of correlations between Crhr1 and other genes (such as Crh, Ucn2 and Ucn3) in the non-reactive group, which might contribute to resilience to stress. Additionally, although Crhr2 seems an important gene involved in the response to stress, while we observed the disappearance of any correlation between the Crhr2 receptor and other genes in animals subjected to the CMS procedure. This result may further confirm an important role for type 2 CRH receptor expression in the pituitary in the response to stress and the involvement of interactions between Crhr2 and other HPA genes in the development of axial symptoms of depression, particularly anhedonia in the rat CMS model. A Spearman’s rank coefficient analysis of the pituitary gene expression and behavioral data similarly indicate the involvement of type 2 CRH receptor in the response to stress and in the development of anhedonia in the experimental animals. Despite a lack of change in the expression of this gene in the pituitary of all animals, the correlation analyses indicate that the expression of this gene determines the behavioral response: the higher the expression of Crhr2, the stronger the reduction of sucrose intake, which is reflected by a statistically significant negative correlation

M. Kolasa et al. / Peptides 61 (2014) 98–106

between these two parameters in the non-stressed (control) animals, as opposed to the positive correlation that was observed for the stress-reactive group (Table 2). Urocortin plays a role in reducing food intake and in inducing anxiety-like behavior [47]. Several studies have reported that stress induces the expression of urocortins in different regions of the brain [22,59]. In our studies, we observed a negative correlation between Ucn1 and the level of sucrose intake in the stress invertreactive group. However, we did not observe any changes in the mean expression of Ucn1 in the pituitary. This result suggests that the increased food intake may correspond to the reduced expression of Ucn1 in these animals (within the group characterized by an increase in sucrose intake). Correlations themselves do not provide any information regarding the causality of the observed alterations. However, interdependences identified for a given pair of genes may suggest direct or indirect co-regulation. This might be especially important for HPA axis regulation [3], where the ratios of particular genes/proteins are even more meaningful than their absolute levels of expression. The results obtained in this study indicate that in control animals, numerous positive correlations between the CRHfamily genes can be observed, which are then disturbed in animals subjected to CMS.

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

Conclusion Pituitary functions are regulated by both hypothalamic neuropeptides and peripheral hormones, which reach the pituitary gland via portal vessels and the systemic circulation, respectively. In our study, the differential responses to stress in the rats exposed to CMS were reflected by gene expression changes in the pituitary. Interesting findings include alterations in the expression of Crh, Ucn2 and Ucn3 mRNA in the pituitary following stress exposure, which may confirm the paracrine and/or autocrine effects of these peptides in response to stress. The results imply that these genes are important for regulating the HPA axis and the behavioral reaction to CMS exposure in rats. Spearman’s Rank Correlations between each pair of genes in the pituitary imply an important role for type 2 CRH receptor expression in the pituitary under stress conditions and might indicate the importance of an interaction between Crhr2 and the other HPA genes in the development of the axial symptoms of depression, modelled as anhedonia in rats subjected to CMS. Additionally, we observed the disappearance of correlations between expression of Crhr1 and other genes (such as Crh, Ucn2 and Ucn3) in the stress non-reactive group, which might indicate the contribution of type 1 CRH receptor in resilience to stress. Acknowledgments This work was financially supported by grants from MNiSW no. NN 401 067438 and DeMeTer POIG.01.01.02-12-004/09.

[16]

[17]

[18] [19]

[20]

[21]

[22]

[23]

[24]

[25] [26]

[27]

References [28] [1] Behan DP, De Souza EB, Lowry PJ, Potter E, Sawchenko P, Vale WW. Corticotropin releasing factor (CRF) binding protein: a novel regulator of CRF and related peptides. Front Neuroendocrinol 1995;16:362–82. [2] Bergström A, Jayatissa MN, Mørk A, Wiborg O. Stress sensitivity and resilience in the chronic mild stress rat model of depression; an in situ hybridization study. Brain Res 2008;1196:41–52. [3] Bonfiglio JJ, Inda C, Refojo D, Holsboer F, Arzt E, Silberstein S. The corticotropinreleasing hormone network and the hypothalamic–pituitary–adrenal axis: molecular and cellular mechanisms involved. Neuroendocrinology 2011;94:12–20. [4] Catalán R, Gallart JM, Castellanos JM, Galard R. Plasma corticotropin-releasing factor in depressive disorders. Biol Psychiatry 1998;44:15–20. [5] Chalmers DT, Lovenberg TW, De Souza EB. Localization of novel corticotropinreleasing factor receptor (CRF2) mRNA expression to specific subcortical nuclei

[29] [30]

[31]

[32]

105

in rat brain: comparison with CRF1 receptor mRNA expression. J Neurosci 1995;15:6340–50. Charalampopoulos I, Androulidaki A, Minas V, Chatzaki E, Tsatsanis C, Notas G, et al. Neuropeptide urocortin and its receptors are expressed in rat Kupffer cells. Neuroendocrinology 2006;84:49–57. Charney DS. Psychobiological mechanisms of resilience and vulnerability: implications for successful adaptation to extreme stress. Am J Psychiatry 2004;161:195–216. Chen CC, Fernald RD. Sequences, expression patterns and regulation of the corticotropin-releasing factor system in a teleost. Gen Comp Endocrinol 2008;157:148–55. Chen R, Lewis KA, Perrin MH, Vale WW. Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci USA 1993;90:8967–71. Christensen T, Bisgaard CF, Wiborg O. Biomarkers of anhedonic-like behavior, antidepressant drug refraction, and stress resilience in a rat model of depression. Neuroscience 2011;196:66–79. Delgado y Palacios R, Campo A, Henningsen K, Verhoye M, Poot D, Dijkstra J, et al. Magnetic resonance imaging and spectroscopy reveal differential hippocampal changes in anhedonic and resilient subtypes of the chronic mild stress rat model. Biol Psychiatry 2011;70:449–57. Dieterle T, Meili-Butz S, Bühler K, Morandi C, John D, Buser PT, et al. Immediate and sustained blood pressure lowering by urocortin 2: a novel approach to antihypertensive therapy. Hypertension 2009;53:739–44. Duncko R, Kiss A, Skultétyová I, Rusnák M, Jezová D. Corticotropin-releasing hormone mRNA levels in response to chronic mild stress rise in male but not in female rats while tyrosine hydroxylase mRNA levels decrease in both sexes. Psychoneuroendocrinology 2001;26:77–89. ˙ Faron-Górecka A, Ku´smider M, Kolasa M, Zurawek D, Gruca P, Papp M, et al. Prolactin and its receptors in the chronic mild stress rat model of depression. Brain Res 2014;1555:48–59. Galard R, Catalán R, Castellanos JM, Gallart JM. Plasma corticotropin-releasing factor in depressed patients before and after the dexamethasone suppression test. Biol Psychiatry 2002;51:463–8. ˜ Gayle DA, Beloosesky R, Desai M, Amidi F, Nunez SE, Ross MG. Maternal LPS induces cytokines in the amniotic fluid and corticotropin releasing hormone in the fetal rat brain. Am J Physiol Regul Integr Comp Physiol 2004;286: 1024–9. Grigoriadis DE, Lovenberg TW, Chalmers DT, Liaw C, De Souze EB. Characterization of corticotropin-releasing factor receptor subtypes. Ann N Y Acad Sci 1996;780:60–80. Grippo AJ, Beltz TG, Johnson AK. Behavioral and cardiovascular changes in the chronic mild stress model of depression. Physiol Behav 2003;78:703–10. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 2007;8:R19. Hsu SY, Hsueh AJ. Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat Med 2001;7:605–11. Iino K, Sasano H, Oki Y, Andoh N, Shin RW, Kitamoto T, et al. Urocortin expression in human pituitary gland and pituitary adenoma. J Clin Endocrinol Metab 1997;82:3842–50. Jamieson PM, Li C, Kukura C, Vaughan J, Vale W. Urocortin 3 modulates the neuroendocrine stress response and is regulated in rat amygdala and hypothalamus by stress and glucocorticoids. Endocrinology 2006;147:4578–88. Kioukia-Fougia N, Antoniou K, Bekris S, Liapi C, Christofidis I, PapadopoulouDaifoti Z. The effects of stress exposure on the hypothalamic–pituitary–adrenal axis, thymus, thyroid hormones and glucose levels. Prog Neuropsychopharmacol Biol Psychiatry 2002;26:823–30. Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, et al. Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci USA 2001;98:7570–5. Li S, Wang C, Wang W, Dong H, Hou P, Tang Y. Chronic mild stress impairs cognition in mice: from brain homeostasis to behavior. Life Sci 2008;82:934–42. Lovenberg TW, Chalmers DT, Liu C, De Souza EB. CRF2 alpha and CRF2 beta receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology 1995;136:4139–42. Müller MB, Preil J, Renner U, Zimmermann S, Kresse AE, Stalla GK, et al. Expression of CRHR1 and CRHR2 in mouse pituitary and adrenal gland: implications for HPA system regulation. Endocrinology 2001;142:4150–3. Naert G, Ixart G, Maurice T, Tapia-Arancibia L, Givalois L. Brain-derived neurotrophic factor and hypothalamic–pituitary–adrenal axis adaptation processes in a depressive-like state induced by chronic restraint stress. Mol Cell Neurosci 2011;46:55–66. Nemoto T, Iwasaki-Sekino A, Yamauchi N, Shibasaki T. Regulation of the expression and secretion of urocortin 2 in rat pituitary. J Endocrinol 2007;192:443–52. Nemoto T, Yamauchi N, Shibasaki T. Novel action of pituitary urocortin 2 in the regulation of expression and secretion of gonadotropins. J Endocrinol 2009;201:105–14. Neufeld-Cohen A, Tsoory MM, Evans AK, Getselter D, Gil S, Lowry CA, et al. A triple urocortin knockout mouse model reveals an essential role for urocortins in stress recovery. Proc Natl Acad Sci USA 2010;107:19020–5. O’Keane V, Frodl T, Dinan TG. A review of atypical depression in relation to the course of depression and changes in HPA axis organization. Psychoneuroendocrinology 2012;37:1589–99.

106

M. Kolasa et al. / Peptides 61 (2014) 98–106

[33] Oki Y, Iwabuchi M, Masuzawa M, Watanabe F, Ozawa M, Iino K, et al. Distribution and concentration of urocortin, and effect of adrenalectomy on its content in rat hypothalamus. Life Sci 1998;62:807–12. [34] Orth DN, Mount CD. Specific high-affinity binding protein for human corticotropin-releasing hormone in normal human plasma. Biochem Biophys Res Commun 1987;143:411–7. [35] Pan Y, Kong LD, Li YC, Xia X, Kung HF, Jiang FX. Icariin from Epimedium brevicornum attenuates chronic mild stress-induced behavioral and neuroendocrinological alterations in male Wistar rats. Pharmacol Biochem Behav 2007;87:130–40. [36] Papp M, Willner P, Muscat R. An animal model of anhedonia: attenuation of sucrose consumption and place preference conditioning by chronic unpredictable mild stress. Psychopharmacology 1991;104:255–9. [37] Pecori Giraldi F, Cavagnini F. Corticotropin-releasing hormone is produced by rat corticotropes and modulates ACTH secretion in a paracrine/autocrine fashion. J Clin Invest 1998;101:2478–84. [38] Pignatelli D, Maia M, Castro AR, da Conceic¸ão Magalhães M, Vivier J, Defaye G. Chronic stress effects on the rat adrenal cortex. Endocr Res 2000;26: 537–44. [39] Potter E, Behan DP, Linton EA, Lowry PJ, Sawchenko PE, Vale WW. The central distribution of a corticotropin-releasing factor (CRF)-binding protein predicts multiple sites and modes of interaction with CRF. Proc Natl Acad Sci USA 1992;89:4192–6. [40] Rademaker MT, Cameron VA, Charles CJ, Richards AM. Integrated hemodynamic, hormonal, and renal actions of urocortin 2 in normal and paced sheep: beneficial effects in heart failure. Circulation 2005;112:3624–32. [41] Reul JM, Holsboer F. Corticotropin-releasing factor receptors 1 and 2 in anxiety and depression. Curr Opin Pharmacol 2002;2:23–33. [42] Reyes TM, Lewis K, Perrin MH, Kunitake KS, Vaughan J, Arias CA, et al. Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 2001;98:2843–8. [43] Sapolsky R, Rivier C, Yamamoto G, Plotsky P, Vale W. Interleukin-1 stimulates the secretion of hypothalamic corticotropin-releasing factor. Science 1987;238:522–4. [44] Sapolsky RM, Krey LC, McEwen BS. Stress down-regulates corticosterone receptors in a site-specific manner in the brain. Endocrinology 1984;114: 287–92. [45] Seasholtz AF, Burrows HL, Karolyi IJ, Camper SA. Mouse models of altered CRHbinding protein expression. Peptides 2001;22:743–51. [46] Speert DB, McClennen SJ, Seasholtz AF. Sexually dimorphic expression of corticotropin-releasing hormone-binding protein in the mouse pituitary. Endocrinology 2002;143:4730–41. [47] Spina M, Merlo-Pich E, Chan RK, Basso AM, Rivier J, Vale W, et al. Appetite-suppressing effects of urocortin, a CRF-related neuropeptide. Science 1996;273:1561–4. [48] Sterrenburg L, Gaszner B, Boerrigter J, Santbergen L, Bramini M, Elliott E, et al. Chronic stress induces sex-specific alterations in methylation and expression of corticotropin-releasing factor gene in the rat. PLoS One 2011;6: e28128. [49] Stout SC, Mortas P, Owens MJ, Nemeroff CB, Moreau J. Increased corticotropinreleasing factor concentrations in the bed nucleus of the stria terminalis of anhedonic rats. Eur J Pharmacol 2000;401:39–46. [50] Takahashi K, Totsune K, Murakami O, Shibahara S. Urocortins as cardiovascular peptides. Peptides 2004;25:1723–31.

[51] Taliaz D, Loya A, Gersner R, Haramati S, Chen A, Zangen A. Resilience to chronic stress is mediated by hippocampal brain-derived neurotrophic factor. J Neurosci 2011;31:4475–83. [52] Thompson RC, Seasholtz AF, Herbert E. Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1987;1:363–70. [53] Vale W, Spiess J, Rivier C, Rivier J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and betaendorphin. Science 1981;213:1394–7. [54] Van Pett K, Viau V, Bittencourt JC, Chan RK, Li HY, Arias C, et al. Distribution of mRNAs encoding CRF receptors in brain and pituitary of rat and mouse. J Comp Neurol 2000;428:191–212. [55] Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, et al. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 1995;378:287–92. [56] Wang Z, Zhang D, Hui S, Zhang Y, Hu S. Effect of tribulus terrestris saponins on behavior and neuroendocrine in chronic mild stress depression rats. J Tradit Chin Med 2013;33:228–32. [57] Wang X, Louden C, Ohlstein EH, Stadel JM, Gu JL, Yue TL. Osteopontin expression in platelet-derived-growth factor–stimulated vascular smooth muscle cells and carotid artery after balloon angioplasty. Circ Res 1996;16:1365–72. [58] Wang X, Su H, Copenhagen LD, Vaishnav S, Pieri F, Shope CD, et al. Urocortin-deficient mice display normal stress-induced anxiety behavior and autonomic control but an impaired acoustic startle response. Mol Cell Biol 2002;22:6605–10. [59] Weninger SC, Peters LL, Majzoub JA. Urocortin expression in the EdingerWestphal nucleus is up-regulated by stress and corticotropin-releasing hormone deficiency. Endocrinology 2000;141:256–63. [60] Westphal NJ, Evans RT, Seasholtz AF. Novel expression of type 1 corticotropinreleasing hormone receptor in multiple endocrine cell types in the murine anterior pituitary. Endocrinology 2009;150:260–7. [61] Willner P, Towell A, Sampson D, Sophokleous S, Muscat R. Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology 1987;93:358–64. [62] Wong ML, al-Shekhlee A, Bongiorno PB, Esposito A, Khatri P, Sternberg EM, et al. Localization of urocortin messenger RNA in rat brain and pituitary. Mol Psychiatry 1996;1:307–12. [63] Xu B, Sano T, Yamada S, Li CC, Hirokawa M. Expression of corticotropinreleasing hormone messenger ribonucleic acid in human pituitary corticotroph adenomas associated with proliferative potential. J Clin Endocrinol Metab 2000;85:1220–5. [64] Yamashita S, Nomoto T, Abe M, Tatematsu M, Sugimura T, Ushijima T. Persistence of gene expression changes in stomach mucosae induced by short-term N-methyl-N’-nitro-N-nitrosoguanidine treatment and their presence in stomach cancers. Mutat Res 2004;549:185–93. [65] Yamauchi N, Otagiri A, Nemoto T, Sekino A, Oono H, Kato I, et al. Distribution of urocortin 2 in various tissues of the rat. J Neuroendocrinol 2005;17:656–63. ˙ [66] Zurawek D, Faron-Górecka A, Ku´smider M, Kolasa M, Gruca P, Papp M, et al. M.Dziedzicka-WasylewskaMesolimbic dopamine D2 receptor plasticity contributes to stress resilience in rats subjected to chronic mild stress. Psychopharmacology 2013;227:583–93. ˙ D, Faron-Górecka A, Ku´smider M, Solich J, Kolasa M, Szafran K, et al. [67] Zurawek Dopamine D1 and D2 receptors in chronic mild stress: analysis of dynamic receptor changes in an animal model of depression using in situ hybridisation and autoradiography. In: Dopamine receptor technologies. Neuromethods series; 2014 [in press].