Vol.
188,
No.
November
16,
Dv
3, 1992
BIOCHEMICAL
AND
BkOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages
1992
1047-1053
REGULATION OF PHOSPHOLIPASE A2 BY CY’I’OKINES lYN’HlBlTING BONE FORMATION AND MINERALIzATKlN Lesley G. Ellies *, Ashwani R. Gupta and Jane E. Aubin MRC Group in Periodontal Physiology, 4384 Medical Sciences Building, University of Toronto, Canada M5S lA8
* Current Addmss: Department of Clinical Dental Sciences, Faculty of Dentistry, 2199 Wesbmok Mall, University of British Columbia, Canada V6T 123 Received
September
21,
1992
Group II phospholipase A2 (PLAz-II) has been shown to be strongly pro-i&lammamry in vivo, and its rdmse from various cell types is stimulated by the multifunctional cytokines, in&e&in-lee necrosis factor (TM;) (reviewed in 1). Interest in the role of audB(JL-laandIL-1B)andtumor this enzyme in bone metabolism has increased due to its recent isolation and cloning from human synovial fluid (2.3). We have examined the relationship between mutifunctional cytokines and PLA24I in modulating bone formation, and our previous studies have demonstrated that IL-la and TNFu enhance the release of PLA2-II from fetal rat calvarial (RC!) cells (4). By using an in vitro syseemin which discmte hone nodules resembling woven bone at the UltrastructuraJ level can form in long term cultures of RC cells (5,6), we have further demonstrated that both IL-la and PLA@l can inhibit bone formation and miueralization (7,8). We report here an extension of these studies which shows that TNFoz and TGF-61 inhibit mineralization as well as osteoid development and demo-s that although all three cytokines inhibit bone format& IL-la and TM;a induce RC cell mRNA for PLA2-II, whiIe TGF-Bl supresses the same message.
1047 .
Copyright 0 1992 All rights of reproduction
0006.29 1X/Y2 $4.00 by Academic Press, Inc. in any j&m re.retwd
Vol.
188,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
MATERIALS AND METHODS Cell Culture A sequential collagenase digestion technique was used to isolate cells from calvariae of 21 day fetal Wistar rats as previously described (5). Populations II to V, each of which has the capacity to make bone in vitro (5), were pooled and plated into 35 mm dishes (day 0) at 3 x 104 cells per dish in standard medium (a-MEM containing 10 % heat-inactivated fetal bovine serum - Flow Laboratories, McLean, VA and antibiotics: 100 pg/ml penicillin G - Sigma Chemical Co., St. Louis, MO; 50 j.tg/ml gentamycin sulfate - Sigma; and 0.3 pg/ml fungizone -Flow). On day 1, the medium was changed to standard medium supplemented with 50 pg/ml ascorbic acid (AA) and 10 mM sodium B-glycerophosphate (O-GP) with or without other additives as required. All dishes were maintained at 37’C in a humidified atmosphere consisting of 95 % air and 5 % CO2 and media were changed every 2 to 3 days. Bone Nodule Experiments RC cells were cultured in supplemented medium (with AA and O-GP) and either vehicle; IL-la, 500 U/ml; TNFa, 500 U/ml; TGF-l31, 1 rig/ml, or PLA2-II, 1000 U/ml (as measured using an E.CoZi assay (4)); was added from day 5 to day 9 when bone nodules were forming. Dishes were fixed at the end of the culture period (day 17 to 21) with 10 % neutral buffered formalin, stained by the von Kossa technique for calcium mineral deposits and both mineralized (black) and unmineralized nodules (deep yellow) were counted on a grid using a dissecting microscope as described (5). To increase the number of bone nodules formed, RC cells were plated at 6 x 104 cells per 35 mm dish and were cultumd in the presence of AA, without RGP, until late in the culture period so that bone nodules developed, but did not mineralize (9). On day 18, cultures were treated with vehicle; IL-la, 100 U/ml; TNFa, 500 U/ml, TGF-Sl, 1 @ml; or PLA2-II, 1000 U/ml for 24 or 48 h before the medium was changed to standard 45Ca pulse medium: 50 l.tg/ml AA, 10 mM D-GP and 0.1 pCi 4&lcium/ml (ICN Biochemical Canada Ltd., Mississauga, Ont., Canada), in addition to the cytokines for a further 24 h. The supematant was then removed, the cell layers washed 2 times with phosphate buffered saline, and the cells collected in Eppendorf tubes in 0.5 ml of 10 % formic acid. 45Ca activity was counted on a scintillation counter (Model LS5OOOTD, Beckman Instruments Inc, Fullerton, CA) and background counts read from cultures which had 45Ca, but not O-GP added were subtracted from treatment groups in all experiments. Isolation of RNA: RC cells were plated into T75 flasks at 1 x 106 cells/flask and cultured in standard medium plus AA. On day 15, 1 flask was treated with either IL-la, TNFa, TGF-l31, IL-la + TNFa or IL-la + TGF-l31 for 24 h . Cell layers were washed, removed, and lysed in LiCl and urea to prepare total RNA (10). Probes: PLA2-II cDNA was obtained by polymerase chain reaction of reverse transcribed RNA from RC cells grown with IL-la or TNFa with specific primers (primer 1: 5’ CTGAATTCAG GTCCAGGGGAGC 3’; primer 2: 5’ ‘ITGGATCCAAGGGAAAAGTGGGC 3’). The amplified DNA was subcloned into phagemid pT3T7 19U (Pharmacia, LKB Biotechnology Inc.) and the recombinant plasmid was called PLA2G2-9. DNA sequencing confirmed that amplified and subcloned cDNA was PLA2-II. A DNA fragment of 450 bp was excised from pPLA2G2-9 by restriction enzyme B&l. Rat alkaline phosphatase (AP) cDNA was a gift from Dr. G.A. Rodan, Merck Sharp and Dohme Research Laboratories, West Point, USA (11) and rat glyceraldehyde-3phosphate dehydrogenase (GAP) was provided to us by Dr. G. Brady, Ontario Cancer Institute, Toronto, Canada (12). Probes of the three cDNAs were prepared by nick labelling with af2PdCTP (MEN, 3OOft Ci/mmole) using an oligolabelling kit and purifying with nick columns (Pharmacia). Elecuophoresis and Hybridization: 30 l.tg of total RNA from each sample was run on a 1% agarose formaldehyde gel. The RNA was transferred to a 0.2 mm BiotransTM nylon membrane (ICN Biomedical Canada Ltd) and immobilized by baking at 8O’C for 2 hours. Prehybridization and hybridization were performed in 5x Denhardt’s solution, 5 x SSC, 50 mM sodium monophosphate. 50% f ormamide, 250 pg/ml salmon testes DNA at 42°C for 16-20 hours. The membranes were washed twice in 2 x SSC and 0.1% SDS, and twice in 0.1 x SSC 0.1% SDS for 30 minutes each at temperatures ranging from room temperature to 50°C. The membranes were then exposed to Kodak X-Omat AR fiis at -7O“C. The amount of mRNA in each lane was standardized to that of GAP by doing densitometric scanning of developed films on an ultrascan XL (Pharmacia). 1048
Vol.
188,
No.
3,
BIOCHEMICAL
1992
-on
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
usmg a
Recombinant human IL-la (specific activity 2.1 x 107 U/mg) was kindly supplied by Dr. P. Lomedico, Hoffmaun-LaRoche, Inc., Nutley, NJ. TNFa was pu~&%sed from Genzyme, Cambridge, M& TGF-Bl from R&D, Minneapolis, MN, and PLA2-II (Cmtalus adamauteus snake venom) from Sigma Chemical Co., St. Louis, MO. Data wete analyzed using Dunnett’s t test for multiple comparisons (13). Results are expressed as means + SEM.
Continuous exposure of RC cells to IL-la, TNFa, TGF-I31 or PLA2-II caused a significant inhibition of osteoid formation (Fig. 1) and mineralization of fully formed bone nodules, with
01
co
IL-1
TNF
m-6
PLAz
02
Treatment
co
IL-I
TNF
TGF-6
Treatment
Figum 1. Id&i&n d k-me tmdule form8don by cytokines. RC cells were exposed to IL-la (500 U/ml), TlWu (500 U/ml), TGF-81 (1 rig/ml) M PI&II (1000 U/ml) from day 5 (late in log ph8se growth) to day 9, when bone nodules began developing. Figme 2 m of minedz8tion. A. 45Ca uptake into bone nodules formed by RC cells was ~‘ovn824hperiod45CauptaLewss~bitedf~g824hpraaclmwntof th8 cells with IL-la (100 U/ml). TNFU (500 U/ml), TGF-fll (1 q/ml) or ptA2-II (1000 U/ml). B. IL-la and TNFa were more effective when a 48 h pretre8tment was usedprior to the 4Q8 pulse.
1049
PLA 2
Vol.
188, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
A 28-
123456
0.0
co
IL-l
TNF
TGF-I3
IL-1 + TNF
IL-I + TGF-B
Cytokine levels. A. An elevation of PLAz-II mRNA over
Figure 3. Northern blot analysisof PLAz mRNA control (vehicle, lane 1) wss observed when RC cells were incubated with IL-la (100 U/ml, lane Z), TNFa (500 U/ml, lane 3) or IL-la + TNFa (lane 5) for 24 h on day 15. TGF-81 (1 n&ml, lane 4) causeda marked inhibition of the same messageeither alone
or in combination with IL-la (lane 6). B. Densitometric scanof Northern blot.
IL- la and TNFu s&owing a time-dependent effect on mineralization (Fig. 2). All mediators tested also had dose-dependent effects (4,7, data not shown). Treatment of RC cells with either IL-la, TNFa or a combination of both e&axed the induction of PLA2:II mRNA (Fig. 3 A and B). This response was dose-dependent (data not shown). Interestingly TGF-Bl, which was a more potent inhibitor of bone fortnation and mineralization than either IL-k or TIWcc, suppressed basal PLA2-II mRNA levels and prevented the induction of RC PLA2-II rnRNA by IL-la Recent evidence strongly suggests that the enzyme AP plays a role in the initiation of mineralization (9.14). However, our data show that cytokines which significantly inhibited mineralization had only a moderate effect in reducing AP mRNA levels (Fig. 4 A and B). Analysis of inorganic phosphate levels in the medium showed that although levels were significantly reduced after 6 h with IL-la or TNFu treatment, they had rtturned to control levels by 24 h (Fig.
3.
0.6 A zs-
2
0.4
0.2
18-
1
2
3
4
0.0 co
IL-1
TNF
TGF-6
Cytokine Figure
blot analysis of alkak phosphatase (AP) UIRNA. A. A modera& reduction in levels was see.n when RC cells were incubated with IL-la (100 U/ml, lane 2). TNFa (500 U/ml, lane 3), or TGF-61 (1 q/ml, lane 4) for 24 h on day 15. The control (vehicle) is in lane 1. B. Dcnsitomctric scanof Nahcrn blot.
4. Northern AF mRNA
1050
Vol.
188,
No. 3, 1992
BIOCHEMICAL
co
AND BIOPHYSICAL
IL-1
TNF
RESEARCH COMMUNICATIONS
PLA 2
Treatment Figure 5. Assessmentof AP activity by measurementof medium phosphate levels. A decreasein phosphatelevels at 6 h occurred when RC cells were incubated with 6GP + IL-la (100 U/ml) or TNFa (500 U/ml) following a 24 h pretreatment on day 18 with cytokine only. By 24 h, phosphate levelshad returned to control values.
Disturbances in hone metabolism are characteristic of a variety of disease states, and are closely associated with the progression of chronic inflammatory disorders affecting hard tissues such as the arthritides and periodontal disease. Our data confirm the results of previous studies showing that the multifunctional cytokines IL-la, TNFa and TGF-81 can inhibit osteoid formation (7,15,16), and extend these findings to show that minemlixation is also inhibited. However only those cymkines associated with inflammation, IL-la and TNFa, induced PLA2-II mRNA in RC cells. IL-1 and TNF have also been shown to enhance PLA2-II mRNA in rat vascular smooth muscle cells (17), rat mesangial cells (18) and rat cultured astrocytes (19) and a similar increase in PLA2 mRNA has been qorted in mponse to IL-16 treatment of rabbit chondroeytes (20). Since exogenous PLA2-II also inhibited osteoid formation and mineralixation, our data suggest that IL-la and TN’& may modulate bone formation indirectly by the induction and release of PLAZ-II (497).
Although ‘IGF-I3 1 appears to have similar effects on bone formation to IL- la and TNPa, it is a more potent mediator, causing significant inhibition of bone nodule formation a&x time periods as short as 15 minutes (16). In contrast, the presence of IL-la (21) or TNJ?a (data not shown) is required in RC cell cultures for 24 to 48 h before an effect of these mediators is observed, supporting the hypothesis of an indirect mechanism of action and suggesting different mechanisms of action of these groups of cytokines in affect&g bone formation. Merry and Gowen (22) have recently examined the transcriptional control of ‘IGF-I3 and IL-U in osteoblastk cells and found that the production of these cytokines is differentially regulated by the systemic hormones 1.25-dihydroxyvitamin D3 and parathyroid hormone, ok cytokines, IL-la and TNFa and also bacterial lipopolysaccharide. They speculated that varied functional roles for TGF-g and 1051
Vol.
188,
No.
3,
1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
IL-l in bone remodelling are made possible by their specific individual responses to local and systemic factors. Our data support this concept and suggest that the differential modulation of proinflammatory mediators such as PLA2-II by these cytokines may be important in disease progression. It will be of interest to investigate further the potent inhibitory effect of TGF-81 on PLA2-II mRNA as, to our knowledge this is the first report of cytokine inhibition of this message. Since previous studies have shown that the AP inhibitor Levamisole can prevent BGPinduced mineralization in the RC system (23), we examined the effects of the various mediators on RC cell AP mRNA. Our results showed that levels of RC cell AP mRNA were only moderately reduced after a 24 h cytokine pretreatment period and enough residual AP activity was present to maintain phosphate levels (3 mM or greater) sufficient for mineralization to occur (9,24). Thus, the data suggest that the inhibition of 4%!a uptake by nodule-forming RC cells is not due to an inadequate conversion of 8GP to inorganic phosphate by AP. An alternative mechanism to explain the cytokine-induced inhibition of mineralization may involve an effect of PLA2 on matrix vesicles. These extracellular organelles, which have been identified in RC cell bone nodules (6), are thought to play a role in the initiation of mineralization in cartilage and woven bone by acting as reservoirs for calcium and phosphate ion accumulation thus creating a nidus for initial mineral &position. Their specialized membranes contain high levels of AP, PLA2 (25), and acidic phospholipids which have been shown to form complexes with calcium and phosphate (26,27). Although the function of PLA2 in the matrix vesicle membrane is not known, high levels of PLA2 activity in normal precalcified growth plate (28) have been suggested to be associated with degradation of matrix vesicle membranes and the facilitation of crystal growth (29,30). In. pathological situations where the release of inflammatory cytokines leads to increased PLA2 activity, matrix vesicle breakdown may occur prematurely, destroying the microenvironment necessary for mineral fcamation. Further studies to determine the mechanism of action of PLA2 in inhibiting osteoid formation and mineralization may provide a better understanding for the development of therapeutic strategies in treating inflammatory disorders.
::
3.
4. 5. 76: 8. 9. 10. 11.
Pruzanski, W. and Vadas, P. (1991) Immunol. Today 12, 143-146. Seilhamer, J.J., Pruzanski, W., Vadas, P., Plant, S., Miller, J.A., Kloss, J., and Johnson, L.K. (1989) J. Biol. Chem. 264,5335-5338. Wery, J.-P., Schevitz, R.W., Clawson, D.K., Bobbit, J.L., Dow, E.R., Gamboa, G., Goodson, T.,Jr., Hermann, R.B., Kramer, R.M., McClure, D.B., Mihelich, E.D., Putnam, J.E., Sharp, J.D., Stark, D.H., Teater, C., Warrick, M.W., and Jones, N.D. (1991) Nature 352, 79-82. Vadas, P., Pruzanski, W., Stefanski, E., Ellies, L.G., Aubin, J.E., SOS,A,, and Melcher, A. (1991) Immunol. Lett. 28, 187-194. Bellows, C.G., Aubin, J.E., Heersche, J.N.M., and Antosz, M.E. (1986) Calcif. Tissue Int. 38, 143-154. Bhargava, U., Bar&v, M., Bellows, C.G., and Aubin, J.E. (1988) Bone 9, 155-163. Ellies, L.G., Heersche, J.N.M., Vadas, P., Pruzanski, W., Stefanski, E., and Aubin, J.E. (1991) J. Bone Min. Res. 6, 843-850. Ellies, L.G., Heersche, J.N.M., Pruzanski, W., and Aubin, J.E. (1992) J. Dent. Res. in press. Bellows, C.G., Aubin, J.E., and Heersche, J.N.M. (1991) Bone and Min. 14, 27-40. Affray, C. and Rougeon, F. (1980) Eur. J. Biochem. 107,303-314. Thiede, M.A., Yoon, K., Golub, E.E., Noda, M., and Rodan, G.A. (1988) Proc. Natl. Acad Sci. USA 85,319-323. 1052
Vol.
188,
No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
12. Fort, Ph., Marty, L., Piechaczyk, M., El Sabrouty, S., Dani, Ch., Jeanteur, Ph., and Blanchard, J.M. (1985) Nucl. Acids Res. 13, 1431-1442. 13. Dunnett, C.W. (1955) J. Am. Stat. Assoc. 50,1096-1121. Tenenbaum, I-LC. (1987) Bone and Min. 3,13-26. 2 Stashenko, P., Obernesser, M.S., and Dewhirst, FE. (1989) Immunol. Invest. 18, 239-249. 16: Antosz, M.A., Bellows, C.G., and Aubin, J.E. (1989) J. Cell. Physiol. 140, 386-395. Nakano, T., Ohara, O., Teraoka, H., and Arita, H. (1990) FEBS Lett. 261, 171-174. ii: Schalkwijk, C., Pfeilschifter, J., Ma&i, F., and van den Bosch, H. (1991) Biochem. Biophys. Res. Commun. 174,268-275. Oka, S. and Arita, II. (1991) 3. Biol. Chem. 266,9956-9960. Kerr, J.S., Stevens, T.M., Davis, G.L., McLaughlin, J.A., and Harris, R.R. (1989) B&hem. Biophys. Res. Commun. 165, 1079-1084. Ellies, L.G. and Aubin, J.E. (1990) Cytokine 2,430-437. Merry, K. and Gowen, M. (1992) Cytokine 4,171-179. Bellows, C.G., Heersche, J.N.M., and Aubin, J.E. (1991) Bone and Min. 17, 15-29. Gronowicz, G., Woodiel, F.N., McCarthy, M.-B., and Raisz, L.G. (1989) J. Bone Min. Res. 4, 313-324. t;3;ani8BkD., Schwartz, Z., Cames, Jr.,D.L., and Ramirez, V. (1988) Endocrinology 122, Wuthier, RE. and Gore, S.T. (1977) Calc. Tiss. Res. 24, 163-171. Boskey, A.L., Posner, A.S., Lane, J.M., Goldberg, M.R., and Cordella, D.M. (1980) Arch. Biochem. Biophys. 199.305-311. Wuthier, R.E. (1973) Clin. Chthop. Rel. Res. 90, 191-200. Anderson, H.C. (1984) SEM 11.953-964. Wuthier, R.E. (1989) Connect. Tissue Res. 22,27-33.
1053
188,
No.
November
16,
Dv
3, 1992
BIOCHEMICAL
AND
BkOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages
1992
1047-1053
REGULATION OF PHOSPHOLIPASE A2 BY CY’I’OKINES lYN’HlBlTING BONE FORMATION AND MINERALIzATKlN Lesley G. Ellies *, Ashwani R. Gupta and Jane E. Aubin MRC Group in Periodontal Physiology, 4384 Medical Sciences Building, University of Toronto, Canada M5S lA8
* Current Addmss: Department of Clinical Dental Sciences, Faculty of Dentistry, 2199 Wesbmok Mall, University of British Columbia, Canada V6T 123 Received
September
21,
1992
Group II phospholipase A2 (PLAz-II) has been shown to be strongly pro-i&lammamry in vivo, and its rdmse from various cell types is stimulated by the multifunctional cytokines, in&e&in-lee necrosis factor (TM;) (reviewed in 1). Interest in the role of audB(JL-laandIL-1B)andtumor this enzyme in bone metabolism has increased due to its recent isolation and cloning from human synovial fluid (2.3). We have examined the relationship between mutifunctional cytokines and PLA24I in modulating bone formation, and our previous studies have demonstrated that IL-la and TNFu enhance the release of PLA2-II from fetal rat calvarial (RC!) cells (4). By using an in vitro syseemin which discmte hone nodules resembling woven bone at the UltrastructuraJ level can form in long term cultures of RC cells (5,6), we have further demonstrated that both IL-la and PLA@l can inhibit bone formation and miueralization (7,8). We report here an extension of these studies which shows that TNFoz and TGF-61 inhibit mineralization as well as osteoid development and demo-s that although all three cytokines inhibit bone format& IL-la and TM;a induce RC cell mRNA for PLA2-II, whiIe TGF-Bl supresses the same message.
1047 .
Copyright 0 1992 All rights of reproduction
0006.29 1X/Y2 $4.00 by Academic Press, Inc. in any j&m re.retwd
Vol.
188,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
MATERIALS AND METHODS Cell Culture A sequential collagenase digestion technique was used to isolate cells from calvariae of 21 day fetal Wistar rats as previously described (5). Populations II to V, each of which has the capacity to make bone in vitro (5), were pooled and plated into 35 mm dishes (day 0) at 3 x 104 cells per dish in standard medium (a-MEM containing 10 % heat-inactivated fetal bovine serum - Flow Laboratories, McLean, VA and antibiotics: 100 pg/ml penicillin G - Sigma Chemical Co., St. Louis, MO; 50 j.tg/ml gentamycin sulfate - Sigma; and 0.3 pg/ml fungizone -Flow). On day 1, the medium was changed to standard medium supplemented with 50 pg/ml ascorbic acid (AA) and 10 mM sodium B-glycerophosphate (O-GP) with or without other additives as required. All dishes were maintained at 37’C in a humidified atmosphere consisting of 95 % air and 5 % CO2 and media were changed every 2 to 3 days. Bone Nodule Experiments RC cells were cultured in supplemented medium (with AA and O-GP) and either vehicle; IL-la, 500 U/ml; TNFa, 500 U/ml; TGF-l31, 1 rig/ml, or PLA2-II, 1000 U/ml (as measured using an E.CoZi assay (4)); was added from day 5 to day 9 when bone nodules were forming. Dishes were fixed at the end of the culture period (day 17 to 21) with 10 % neutral buffered formalin, stained by the von Kossa technique for calcium mineral deposits and both mineralized (black) and unmineralized nodules (deep yellow) were counted on a grid using a dissecting microscope as described (5). To increase the number of bone nodules formed, RC cells were plated at 6 x 104 cells per 35 mm dish and were cultumd in the presence of AA, without RGP, until late in the culture period so that bone nodules developed, but did not mineralize (9). On day 18, cultures were treated with vehicle; IL-la, 100 U/ml; TNFa, 500 U/ml, TGF-Sl, 1 @ml; or PLA2-II, 1000 U/ml for 24 or 48 h before the medium was changed to standard 45Ca pulse medium: 50 l.tg/ml AA, 10 mM D-GP and 0.1 pCi 4&lcium/ml (ICN Biochemical Canada Ltd., Mississauga, Ont., Canada), in addition to the cytokines for a further 24 h. The supematant was then removed, the cell layers washed 2 times with phosphate buffered saline, and the cells collected in Eppendorf tubes in 0.5 ml of 10 % formic acid. 45Ca activity was counted on a scintillation counter (Model LS5OOOTD, Beckman Instruments Inc, Fullerton, CA) and background counts read from cultures which had 45Ca, but not O-GP added were subtracted from treatment groups in all experiments. Isolation of RNA: RC cells were plated into T75 flasks at 1 x 106 cells/flask and cultured in standard medium plus AA. On day 15, 1 flask was treated with either IL-la, TNFa, TGF-l31, IL-la + TNFa or IL-la + TGF-l31 for 24 h . Cell layers were washed, removed, and lysed in LiCl and urea to prepare total RNA (10). Probes: PLA2-II cDNA was obtained by polymerase chain reaction of reverse transcribed RNA from RC cells grown with IL-la or TNFa with specific primers (primer 1: 5’ CTGAATTCAG GTCCAGGGGAGC 3’; primer 2: 5’ ‘ITGGATCCAAGGGAAAAGTGGGC 3’). The amplified DNA was subcloned into phagemid pT3T7 19U (Pharmacia, LKB Biotechnology Inc.) and the recombinant plasmid was called PLA2G2-9. DNA sequencing confirmed that amplified and subcloned cDNA was PLA2-II. A DNA fragment of 450 bp was excised from pPLA2G2-9 by restriction enzyme B&l. Rat alkaline phosphatase (AP) cDNA was a gift from Dr. G.A. Rodan, Merck Sharp and Dohme Research Laboratories, West Point, USA (11) and rat glyceraldehyde-3phosphate dehydrogenase (GAP) was provided to us by Dr. G. Brady, Ontario Cancer Institute, Toronto, Canada (12). Probes of the three cDNAs were prepared by nick labelling with af2PdCTP (MEN, 3OOft Ci/mmole) using an oligolabelling kit and purifying with nick columns (Pharmacia). Elecuophoresis and Hybridization: 30 l.tg of total RNA from each sample was run on a 1% agarose formaldehyde gel. The RNA was transferred to a 0.2 mm BiotransTM nylon membrane (ICN Biomedical Canada Ltd) and immobilized by baking at 8O’C for 2 hours. Prehybridization and hybridization were performed in 5x Denhardt’s solution, 5 x SSC, 50 mM sodium monophosphate. 50% f ormamide, 250 pg/ml salmon testes DNA at 42°C for 16-20 hours. The membranes were washed twice in 2 x SSC and 0.1% SDS, and twice in 0.1 x SSC 0.1% SDS for 30 minutes each at temperatures ranging from room temperature to 50°C. The membranes were then exposed to Kodak X-Omat AR fiis at -7O“C. The amount of mRNA in each lane was standardized to that of GAP by doing densitometric scanning of developed films on an ultrascan XL (Pharmacia). 1048
Vol.
188,
No.
3,
BIOCHEMICAL
1992
-on
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
usmg a
Recombinant human IL-la (specific activity 2.1 x 107 U/mg) was kindly supplied by Dr. P. Lomedico, Hoffmaun-LaRoche, Inc., Nutley, NJ. TNFa was pu~&%sed from Genzyme, Cambridge, M& TGF-Bl from R&D, Minneapolis, MN, and PLA2-II (Cmtalus adamauteus snake venom) from Sigma Chemical Co., St. Louis, MO. Data wete analyzed using Dunnett’s t test for multiple comparisons (13). Results are expressed as means + SEM.
Continuous exposure of RC cells to IL-la, TNFa, TGF-I31 or PLA2-II caused a significant inhibition of osteoid formation (Fig. 1) and mineralization of fully formed bone nodules, with
01
co
IL-1
TNF
m-6
PLAz
02
Treatment
co
IL-I
TNF
TGF-6
Treatment
Figum 1. Id&i&n d k-me tmdule form8don by cytokines. RC cells were exposed to IL-la (500 U/ml), TlWu (500 U/ml), TGF-81 (1 rig/ml) M PI&II (1000 U/ml) from day 5 (late in log ph8se growth) to day 9, when bone nodules began developing. Figme 2 m of minedz8tion. A. 45Ca uptake into bone nodules formed by RC cells was ~‘ovn824hperiod45CauptaLewss~bitedf~g824hpraaclmwntof th8 cells with IL-la (100 U/ml). TNFU (500 U/ml), TGF-fll (1 q/ml) or ptA2-II (1000 U/ml). B. IL-la and TNFa were more effective when a 48 h pretre8tment was usedprior to the 4Q8 pulse.
1049
PLA 2
Vol.
188, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
A 28-
123456
0.0
co
IL-l
TNF
TGF-I3
IL-1 + TNF
IL-I + TGF-B
Cytokine levels. A. An elevation of PLAz-II mRNA over
Figure 3. Northern blot analysisof PLAz mRNA control (vehicle, lane 1) wss observed when RC cells were incubated with IL-la (100 U/ml, lane Z), TNFa (500 U/ml, lane 3) or IL-la + TNFa (lane 5) for 24 h on day 15. TGF-81 (1 n&ml, lane 4) causeda marked inhibition of the same messageeither alone
or in combination with IL-la (lane 6). B. Densitometric scanof Northern blot.
IL- la and TNFu s&owing a time-dependent effect on mineralization (Fig. 2). All mediators tested also had dose-dependent effects (4,7, data not shown). Treatment of RC cells with either IL-la, TNFa or a combination of both e&axed the induction of PLA2:II mRNA (Fig. 3 A and B). This response was dose-dependent (data not shown). Interestingly TGF-Bl, which was a more potent inhibitor of bone fortnation and mineralization than either IL-k or TIWcc, suppressed basal PLA2-II mRNA levels and prevented the induction of RC PLA2-II rnRNA by IL-la Recent evidence strongly suggests that the enzyme AP plays a role in the initiation of mineralization (9.14). However, our data show that cytokines which significantly inhibited mineralization had only a moderate effect in reducing AP mRNA levels (Fig. 4 A and B). Analysis of inorganic phosphate levels in the medium showed that although levels were significantly reduced after 6 h with IL-la or TNFu treatment, they had rtturned to control levels by 24 h (Fig.
3.
0.6 A zs-
2
0.4
0.2
18-
1
2
3
4
0.0 co
IL-1
TNF
TGF-6
Cytokine Figure
blot analysis of alkak phosphatase (AP) UIRNA. A. A modera& reduction in levels was see.n when RC cells were incubated with IL-la (100 U/ml, lane 2). TNFa (500 U/ml, lane 3), or TGF-61 (1 q/ml, lane 4) for 24 h on day 15. The control (vehicle) is in lane 1. B. Dcnsitomctric scanof Nahcrn blot.
4. Northern AF mRNA
1050
Vol.
188,
No. 3, 1992
BIOCHEMICAL
co
AND BIOPHYSICAL
IL-1
TNF
RESEARCH COMMUNICATIONS
PLA 2
Treatment Figure 5. Assessmentof AP activity by measurementof medium phosphate levels. A decreasein phosphatelevels at 6 h occurred when RC cells were incubated with 6GP + IL-la (100 U/ml) or TNFa (500 U/ml) following a 24 h pretreatment on day 18 with cytokine only. By 24 h, phosphate levelshad returned to control values.
Disturbances in hone metabolism are characteristic of a variety of disease states, and are closely associated with the progression of chronic inflammatory disorders affecting hard tissues such as the arthritides and periodontal disease. Our data confirm the results of previous studies showing that the multifunctional cytokines IL-la, TNFa and TGF-81 can inhibit osteoid formation (7,15,16), and extend these findings to show that minemlixation is also inhibited. However only those cymkines associated with inflammation, IL-la and TNFa, induced PLA2-II mRNA in RC cells. IL-1 and TNF have also been shown to enhance PLA2-II mRNA in rat vascular smooth muscle cells (17), rat mesangial cells (18) and rat cultured astrocytes (19) and a similar increase in PLA2 mRNA has been qorted in mponse to IL-16 treatment of rabbit chondroeytes (20). Since exogenous PLA2-II also inhibited osteoid formation and mineralixation, our data suggest that IL-la and TN’& may modulate bone formation indirectly by the induction and release of PLAZ-II (497).
Although ‘IGF-I3 1 appears to have similar effects on bone formation to IL- la and TNPa, it is a more potent mediator, causing significant inhibition of bone nodule formation a&x time periods as short as 15 minutes (16). In contrast, the presence of IL-la (21) or TNJ?a (data not shown) is required in RC cell cultures for 24 to 48 h before an effect of these mediators is observed, supporting the hypothesis of an indirect mechanism of action and suggesting different mechanisms of action of these groups of cytokines in affect&g bone formation. Merry and Gowen (22) have recently examined the transcriptional control of ‘IGF-I3 and IL-U in osteoblastk cells and found that the production of these cytokines is differentially regulated by the systemic hormones 1.25-dihydroxyvitamin D3 and parathyroid hormone, ok cytokines, IL-la and TNFa and also bacterial lipopolysaccharide. They speculated that varied functional roles for TGF-g and 1051
Vol.
188,
No.
3,
1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
IL-l in bone remodelling are made possible by their specific individual responses to local and systemic factors. Our data support this concept and suggest that the differential modulation of proinflammatory mediators such as PLA2-II by these cytokines may be important in disease progression. It will be of interest to investigate further the potent inhibitory effect of TGF-81 on PLA2-II mRNA as, to our knowledge this is the first report of cytokine inhibition of this message. Since previous studies have shown that the AP inhibitor Levamisole can prevent BGPinduced mineralization in the RC system (23), we examined the effects of the various mediators on RC cell AP mRNA. Our results showed that levels of RC cell AP mRNA were only moderately reduced after a 24 h cytokine pretreatment period and enough residual AP activity was present to maintain phosphate levels (3 mM or greater) sufficient for mineralization to occur (9,24). Thus, the data suggest that the inhibition of 4%!a uptake by nodule-forming RC cells is not due to an inadequate conversion of 8GP to inorganic phosphate by AP. An alternative mechanism to explain the cytokine-induced inhibition of mineralization may involve an effect of PLA2 on matrix vesicles. These extracellular organelles, which have been identified in RC cell bone nodules (6), are thought to play a role in the initiation of mineralization in cartilage and woven bone by acting as reservoirs for calcium and phosphate ion accumulation thus creating a nidus for initial mineral &position. Their specialized membranes contain high levels of AP, PLA2 (25), and acidic phospholipids which have been shown to form complexes with calcium and phosphate (26,27). Although the function of PLA2 in the matrix vesicle membrane is not known, high levels of PLA2 activity in normal precalcified growth plate (28) have been suggested to be associated with degradation of matrix vesicle membranes and the facilitation of crystal growth (29,30). In. pathological situations where the release of inflammatory cytokines leads to increased PLA2 activity, matrix vesicle breakdown may occur prematurely, destroying the microenvironment necessary for mineral fcamation. Further studies to determine the mechanism of action of PLA2 in inhibiting osteoid formation and mineralization may provide a better understanding for the development of therapeutic strategies in treating inflammatory disorders.
::
3.
4. 5. 76: 8. 9. 10. 11.
Pruzanski, W. and Vadas, P. (1991) Immunol. Today 12, 143-146. Seilhamer, J.J., Pruzanski, W., Vadas, P., Plant, S., Miller, J.A., Kloss, J., and Johnson, L.K. (1989) J. Biol. Chem. 264,5335-5338. Wery, J.-P., Schevitz, R.W., Clawson, D.K., Bobbit, J.L., Dow, E.R., Gamboa, G., Goodson, T.,Jr., Hermann, R.B., Kramer, R.M., McClure, D.B., Mihelich, E.D., Putnam, J.E., Sharp, J.D., Stark, D.H., Teater, C., Warrick, M.W., and Jones, N.D. (1991) Nature 352, 79-82. Vadas, P., Pruzanski, W., Stefanski, E., Ellies, L.G., Aubin, J.E., SOS,A,, and Melcher, A. (1991) Immunol. Lett. 28, 187-194. Bellows, C.G., Aubin, J.E., Heersche, J.N.M., and Antosz, M.E. (1986) Calcif. Tissue Int. 38, 143-154. Bhargava, U., Bar&v, M., Bellows, C.G., and Aubin, J.E. (1988) Bone 9, 155-163. Ellies, L.G., Heersche, J.N.M., Vadas, P., Pruzanski, W., Stefanski, E., and Aubin, J.E. (1991) J. Bone Min. Res. 6, 843-850. Ellies, L.G., Heersche, J.N.M., Pruzanski, W., and Aubin, J.E. (1992) J. Dent. Res. in press. Bellows, C.G., Aubin, J.E., and Heersche, J.N.M. (1991) Bone and Min. 14, 27-40. Affray, C. and Rougeon, F. (1980) Eur. J. Biochem. 107,303-314. Thiede, M.A., Yoon, K., Golub, E.E., Noda, M., and Rodan, G.A. (1988) Proc. Natl. Acad Sci. USA 85,319-323. 1052
Vol.
188,
No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
12. Fort, Ph., Marty, L., Piechaczyk, M., El Sabrouty, S., Dani, Ch., Jeanteur, Ph., and Blanchard, J.M. (1985) Nucl. Acids Res. 13, 1431-1442. 13. Dunnett, C.W. (1955) J. Am. Stat. Assoc. 50,1096-1121. Tenenbaum, I-LC. (1987) Bone and Min. 3,13-26. 2 Stashenko, P., Obernesser, M.S., and Dewhirst, FE. (1989) Immunol. Invest. 18, 239-249. 16: Antosz, M.A., Bellows, C.G., and Aubin, J.E. (1989) J. Cell. Physiol. 140, 386-395. Nakano, T., Ohara, O., Teraoka, H., and Arita, H. (1990) FEBS Lett. 261, 171-174. ii: Schalkwijk, C., Pfeilschifter, J., Ma&i, F., and van den Bosch, H. (1991) Biochem. Biophys. Res. Commun. 174,268-275. Oka, S. and Arita, II. (1991) 3. Biol. Chem. 266,9956-9960. Kerr, J.S., Stevens, T.M., Davis, G.L., McLaughlin, J.A., and Harris, R.R. (1989) B&hem. Biophys. Res. Commun. 165, 1079-1084. Ellies, L.G. and Aubin, J.E. (1990) Cytokine 2,430-437. Merry, K. and Gowen, M. (1992) Cytokine 4,171-179. Bellows, C.G., Heersche, J.N.M., and Aubin, J.E. (1991) Bone and Min. 17, 15-29. Gronowicz, G., Woodiel, F.N., McCarthy, M.-B., and Raisz, L.G. (1989) J. Bone Min. Res. 4, 313-324. t;3;ani8BkD., Schwartz, Z., Cames, Jr.,D.L., and Ramirez, V. (1988) Endocrinology 122, Wuthier, RE. and Gore, S.T. (1977) Calc. Tiss. Res. 24, 163-171. Boskey, A.L., Posner, A.S., Lane, J.M., Goldberg, M.R., and Cordella, D.M. (1980) Arch. Biochem. Biophys. 199.305-311. Wuthier, R.E. (1973) Clin. Chthop. Rel. Res. 90, 191-200. Anderson, H.C. (1984) SEM 11.953-964. Wuthier, R.E. (1989) Connect. Tissue Res. 22,27-33.
1053
