A r t i c l e
DIFFERENTIAL GENE EXPRESSION IN MALE AND FEMALE FAT BODY IN THE ORIENTAL FRUIT FLY, Bactrocera dorsalis Yu-Han Zuo and Mei-Er Chen Department of Entomology, National Chung Hsing University, Taichung, Taiwan
The sexual difference in gene expression in fat body between 8- and 10-day-old male and female Bactrocera dorsalis was examined using suppression subtractive hybridization. A total of 952 clones were sequenced and searched using BLAST from the subtracted cDNA library. About 22% of these clones showed homology with detoxification enzymes including cytochrome P450 monooxygenases (CYPs) and glutathione S-transferase. NADH dehydrogenases, distributed to energy metabolism, constituted about 9% of these clones. About 10% of these clones were cecropin, an antimicrobial peptide. Real-time quantitative polymerase chain reaction (qPCR) analysis showed that four transcripts were expressed at a higher level in fat body of males, compared to females. Bactrocera dorsalis cyp6g2 (Bdcyp6g2) was cloned (accession number KF469179) and the temporal profile of transcriptional expression showed that Bdcyp6g2 mRNA increased with age in males from day 3 after eclosion, but only on days 0–3 in females. Compared to females, the susceptibility of 9-day-old males to three insecticides was significantly less. These results suggested the C 2013 Wiley genes expressed at a higher level in male act in its survival. Periodicals, Inc. Keywords: Bactrocera dorsalis; fat body; differential gene expression; cytochrome P450 monooxygenases
Grant sponsor: National Science Council; Grant number: NSC 98-2313-B-005-029-MY3. Correspondence to: Mei-Er Chen, Department of Entomology, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan. E-mail: [email protected] ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 85, No. 1, 48–59 (2014) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2013 Wiley Periodicals, Inc. DOI: 10.1002/arch.21142
Differential Gene Expression in B. dorsalis Fat Body
r
49
INTRODUCTION The insect fat body plays many roles, including synthesis of yolk protein precursors for oocyte maturation, storage and release of energy in response to changing physiological states, synthesis of detoxification enzymes, and synthesis of antimicrobial peptides (AMPs) in response to infection (Arrese and Soulages, 2010). In particular, the insect fat body is the major tissue of intermediary metabolism where most hemolymph proteins are synthesized. Increasing expression of metabolic detoxification enzymes in fat body may increase insect resistance to insecticides. Insects defend themselves against pesticides through an elaborate three-phase detoxification system (Xu et al., 2005). Phase I enzymes consist of cytochrome P450 monooxygenases (CYPs), which decrease the biological activity of a broad range of substrates. The phase II enzymes act on the toxic by-products of the phase I response and include glutathione S-transferases (GSTs), uridine 5 -diphospho (UDP)glucuronosyltansferases, and N-acetyltransferases. The CYPs and GSTs are large families of multifunctional enzymes involved in the metabolism of insecticides (Feyereisen, 2005). CYPs act in the metabolic resistance to a range of insecticide classes including pyrethroids, organochlorides, neonicotinoids, organophosphates, carbamates, and insect growth regulators (Li et al., 2007). The activities of GSTs are associated with resistance to all major classes of insecticides including DDT (Ortelli et al., 2003), organophosphates (Huang et al., 1998; Wei et al., 2001), and pyrethroids (Vontas et al., 2001). In addition to expression of insecticide detoxification enzymes, the fat body synthesizes AMPs in response to microbial infection. AMPs are rapidly and transiently synthesized mainly by the fat body and other epithelia (Tzou et al., 2002). Most AMPs are thought to disrupt the permeability of bacterial cytoplasmic membranes (Lemaitre and Hoffmann, 2007). The AMP, cecropin, was first isolated from the moth Hyalophora cecropia (Steiner et al., 1981). Cecropins have been identified in many insect species and in mammals; they are active against Gram-positive and Gram-negative bacteria by creating channels in their lipid bilayer (Lemaitre and Hoffmann, 2007). The regional and developmental differences in structure and function of the fat body have been studied in Lepidoptera and Diptera (Haunerland and Shirk, 1995). Segregation of synthesis and storage functions is associated with the developmental stages and location within the fat body. However, sexual differences in gene expression within the fat body remain understudied. This may be a crucial issue because male and female animals are not merely reproductive partners, but separate genders, each with its individual evolutionary history. Their individual histories prompted us to pose the hypothesis that fat body gene expression differs in males and females. Here, we report the outcomes of experiments designed to test our hypothesis in the oriental fruit fly, Bactrocera dorsalis, one of the most destructive pests of fruit crops worldwide.
MATERIALS AND METHODS Insects The oriental fruit fly, B. dorsalis, colony was obtained from Bureau of Animal and Plant Health Inspection and Quarantine in Taichung, Taiwan, and has been raised for over 1 year in the laboratory. The flies were housed in cages (35 × 35 × 28 cm) and fed with a mixture of sucrose:yeast extract:peptone = 3:1:1 and water ad libitum. Larvae were reared Archives of Insect Biochemistry and Physiology
50
r
Archives of Insect Biochemistry and Physiology, January 2014
on an artificial diet (Chiu, 1978). The rearing conditions were 28 ± 1◦ C, 50 ± 5% r.h., and a 12:12 h photoperiod. Suppression Subtractive Hybridization and Library Construction The subtraction was performed using a PCR-SelectTM cDNA Subtraction Kit (Clontech, Mountain View, CA) according to the manufacturer’s instructions. The mRNA was isolated R mRNA Purification Kit (Invitrogen, Carlsbad, CA) from total RNA using a Dynabeads from fat bodies of 8- to 10-day-old adults. The mRNA (1 μg) was used to synthesize cDNA for the subtraction. The cDNA synthesized from males was used as the tester, and female cDNA as the driver. The cDNA samples were digested with RsaI and tester cDNA was separated into two groups and ligated with two different adapters, respectively, for further hybridization. In the first hybridization, two groups of tester cDNA were hybridized with an excess of driver cDNA at 68◦ C for 8 h to enrich the differentially expressed sequences. In the second hybridization, both of the previous reactions were hybridized together in the presence of fresh driver cDNA at 68◦ C for overnight. After the second hybridization, the subtracted products were amplified by PCR using primers complementary to adapters (applied by the kit). PCR parameters were 75◦ C for 5 min, 94◦ C for 25 s, 27 cycles of 94◦ C for 10 s, 66◦ C for 30 s, and 72 ◦ C for 1.5 min. A nested PCR reaction of 12 cycles of 94◦ C for 10 s, 68◦ C for 30 s, and 72 ◦ C for 1.5 min was carried out. The subtracted R -T Easy Vector System I (Promega, Madison, PCR products were cloned into the pGEM WI), and transformed into Escherichia coli HIT-DH5 α strain (Tri-I Biotech, Taipei, Taiwan). The white colonies were checked by PCR with vector specific primers and electrophoresed on 1% agarose gel. Nine hundred and fifty-two insert-included clones were sequenced using ABI PRISM Big Dye Terminator Cycle sequencing Core kit with AmpliTaq DNA polymerase (ABI, Foster City, CA), performed by Tri-I Biotech. The sequence results were compared with the protein database using BLAST (Altschul et al., 1997) at the National Center for Biotechnology Information (NCBI). cDNA Cloning of Cytochrome P450 cyp6g2 The 5 and 3 ends of the cyp6g2 cDNA were synthesized using the GeneRacerTM kit (Invitrogen). The first-strand cDNA was synthesized from 1 μg of total RNA from the fat body of 8-day-old B. dorsalis male following the manufacturer’s instructions. Specific primers were designed based on the sequence of 339-bp fragment from the subtracted cDNA library. The antisense primer for the 5 RACE PCR was 5 -AACATTCTCATCGACCACTTAATCTC3 , and sense primer for the 5 RACE PCR was the GeneRacerTM 5 Primer. The sense primer for the 3 RACE PCR was 5 -GAATGCCTATATGCCCTTCGG-3 , and antisense primer for the 3 RACE was the GeneRacerTM 3 Primer. RACE PCR products were cloned and sequenced and encompassed the full-length of cyp6g2 cDNA. Real-Time Quantitative RT-PCR (qPCR) We used qPCR to record the transcript levels of cyp6g2, GST, NADH dehydrogenase, and cecropin of 8- to 10-day-old B. dorsalis male and female fat bodies; and the temporal regulation of cyp6g2 in B. dorsalis male and female adults. The first-strand cDNA was synthesized from 1 μg of total RNA with SuperScriptTM III First-Strand Synthesis SuperMix R iQ5 for qRT-PCR kit (Invitrogen). qPCR reactions were performed using the iCycler Archives of Insect Biochemistry and Physiology
Differential Gene Expression in B. dorsalis Fat Body
r
51
Table 1. Sequences of Primers Used in qPCR Gene Actin Cyp6g2 Gst Cecropin NADH dehydrogenase
Forward primer
Reverse primer
ccccaccagagcgtaaatactccg gaatgcctatatgcccttcgg aggtgttgatgaactgaagaaagtc cttcatcttcttggccgtggtgat ccactgggttgactgtctgttattct
gcctgggccggattcatcg cggagtcttttcacatggcgt agcgacataattccaaagccg tgaatggcggcatctctggtatg cctcgcaatataactcaaccttcatc
R R system (Bio-Rad, Hercules, CA) with SYBR GreenER qPCR SuperMix for iCycler ◦ (Ivitrogen). The specific primers are listed in Table 1. The PCR parameters were 50 C for 2 min; 95◦ C for 8 min, 30 s; 40 cycles of 95◦ C for 10 s, and 56◦ C for 30 s. A melting curve analysis was carried out for each test to check the specificity of the amplification. Three independent biological replicates of each treatment were performed and normalized to the internal control of β-actin expression. The qPCR data were collected using the Bio-Rad iQ5 2.0 Standard Edition Optical System Software V2.0. Statistical analyses were performed using Prism 5.0 (GraphPad Software, San Diego, CA). The data of cyp6g2, GST, NADH dehydrogenase, and cecropin transcript levels were analyzed by Student’s t-test. The data of temporal expression were analyzed by ANOVA followed by a Tukey multiple comparison test. A value of P < 0.05 was considered statistically significant. TM
Insecticides Deltamethrin (980 g/kg), technical grade, was provided by Polymax Chemical Mfg. Co., Ltd. (Taipei, Taiwan). Technical permethrin (920 g/kg) was provided by Sinon Corporation (Taichung, Taiwan). Bendiocarb (970 g/kg), technical grade, was given by Kuo Ching R ) was provided by Chemical Co., Ltd. (Taichung, Taiwan). Spinosad (800 g/kg, Entrust Dow AgroSciences LLC (Indianapolis, IN). Bioassays The susceptibility of male and female 9-day-old adults to insecticides was determined with topical application. Permethrin, deltamathrin, and bendiocard were diluted in acetone and spinosad was diluted in water at the selected concentrations. The flies were anesthetized on ice. One microliter of working insecticide solutions was dropped on the ventral side of abdomens. After the solvent was evaporated, the flies were transferred to a plastic cup (250 ml capacity). Twenty flies were treated for each concentration. Flies treated with each concentration in three independent biological replicates were held at 28 ± 1◦ C, 50 ± 5% r.h., and a 12:12 h photoperiod for 24 h before assessment. Data Analysis After 24 h of insecticide treatments, fly mortality, as shown by no response to touching, was recorded. Mortality data were analyzed using probit analysis (Finney, 1971), which was developed into a computer program by the Department of Entomology, National Chung Hsing University (Chi, 2009). The program provides the linearity of dose–mortality and determines slope, lethal dose (LD), 95% fiducial limits of LD50 , and chi-square of each line tested. Student’s t-test was applied to compare the LD50 of males and females. Archives of Insect Biochemistry and Physiology
52
r
Archives of Insect Biochemistry and Physiology, January 2014
Table 2. List of Subtracted cDNA Clones Showing Similarity with NCBI Database Category
Accession no. Size (bp)
Homology
E value Number (%)
Enzyme
JZ477759
339 572 304 958 170 321
Cyp6g2 Cyp4g1 Glutathione S-transferase NADH dehydrogenase subunit 5 NADH dehydrogenase subunit 4 Aldo-keto reductase
1 × 1025 4 × 106 2 × 1022 8 × 10152 4 × 107 1 × 1016
JZ477753 JZ477757 JZ477762
417 534 289
Cecropin Serpin 27A isoform A Serine protease inhibitor 43Ab
2 × 1016 8 × 109 3 × 108
JZ477754 JZ477755
222 504
Anterior fat body protein Arylphorin receptor
7 × 1030 5 × 1033
JZ477758 JZ477760 JZ477761 JZ477763 JZ477764 JZ477765
696 168 519 688 246 323
Translation elongation factor 1 γ Translation initiation factor 2γ Odorant-binding protein 19d Bruchpilot Cytochrome c Cuticular protein 100A
1 × 10103 2 × 1028 7 × 1017 2 × 1050 1 × 107 3 × 1027
JZ477751 JZ477752 JZ477756 KF514115 a
Immunity
Storage protein receptor
Others
Hypothetical protein Unknown
318 (33.3) 202 (21.2) 1 (0.1) 5 (0.5) 80 (8.4) 4 (0.4) 26 (2.7) 146 (15.4) 93 (9.8) 49 (5.2) 4 (0.4) 66 (6.9) 64 (6.7) 2 (0.2) 50 (5.2) 27 (2.8) 13 (1.4) 6 (0.6) 2 (0.2) 1 (0.1) 1 (0.1) 49 (5.2) 323 (34.0)
The mitochondrial sequence
DIFFERENTIAL GENE EXPRESSION IN MALE AND FEMALE FAT BODY IN THE ORIENTAL FRUIT FLY, Bactrocera dorsalis Yu-Han Zuo and Mei-Er Chen Department of Entomology, National Chung Hsing University, Taichung, Taiwan
The sexual difference in gene expression in fat body between 8- and 10-day-old male and female Bactrocera dorsalis was examined using suppression subtractive hybridization. A total of 952 clones were sequenced and searched using BLAST from the subtracted cDNA library. About 22% of these clones showed homology with detoxification enzymes including cytochrome P450 monooxygenases (CYPs) and glutathione S-transferase. NADH dehydrogenases, distributed to energy metabolism, constituted about 9% of these clones. About 10% of these clones were cecropin, an antimicrobial peptide. Real-time quantitative polymerase chain reaction (qPCR) analysis showed that four transcripts were expressed at a higher level in fat body of males, compared to females. Bactrocera dorsalis cyp6g2 (Bdcyp6g2) was cloned (accession number KF469179) and the temporal profile of transcriptional expression showed that Bdcyp6g2 mRNA increased with age in males from day 3 after eclosion, but only on days 0–3 in females. Compared to females, the susceptibility of 9-day-old males to three insecticides was significantly less. These results suggested the C 2013 Wiley genes expressed at a higher level in male act in its survival. Periodicals, Inc. Keywords: Bactrocera dorsalis; fat body; differential gene expression; cytochrome P450 monooxygenases
Grant sponsor: National Science Council; Grant number: NSC 98-2313-B-005-029-MY3. Correspondence to: Mei-Er Chen, Department of Entomology, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan. E-mail: [email protected] ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 85, No. 1, 48–59 (2014) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2013 Wiley Periodicals, Inc. DOI: 10.1002/arch.21142
Differential Gene Expression in B. dorsalis Fat Body
r
49
INTRODUCTION The insect fat body plays many roles, including synthesis of yolk protein precursors for oocyte maturation, storage and release of energy in response to changing physiological states, synthesis of detoxification enzymes, and synthesis of antimicrobial peptides (AMPs) in response to infection (Arrese and Soulages, 2010). In particular, the insect fat body is the major tissue of intermediary metabolism where most hemolymph proteins are synthesized. Increasing expression of metabolic detoxification enzymes in fat body may increase insect resistance to insecticides. Insects defend themselves against pesticides through an elaborate three-phase detoxification system (Xu et al., 2005). Phase I enzymes consist of cytochrome P450 monooxygenases (CYPs), which decrease the biological activity of a broad range of substrates. The phase II enzymes act on the toxic by-products of the phase I response and include glutathione S-transferases (GSTs), uridine 5 -diphospho (UDP)glucuronosyltansferases, and N-acetyltransferases. The CYPs and GSTs are large families of multifunctional enzymes involved in the metabolism of insecticides (Feyereisen, 2005). CYPs act in the metabolic resistance to a range of insecticide classes including pyrethroids, organochlorides, neonicotinoids, organophosphates, carbamates, and insect growth regulators (Li et al., 2007). The activities of GSTs are associated with resistance to all major classes of insecticides including DDT (Ortelli et al., 2003), organophosphates (Huang et al., 1998; Wei et al., 2001), and pyrethroids (Vontas et al., 2001). In addition to expression of insecticide detoxification enzymes, the fat body synthesizes AMPs in response to microbial infection. AMPs are rapidly and transiently synthesized mainly by the fat body and other epithelia (Tzou et al., 2002). Most AMPs are thought to disrupt the permeability of bacterial cytoplasmic membranes (Lemaitre and Hoffmann, 2007). The AMP, cecropin, was first isolated from the moth Hyalophora cecropia (Steiner et al., 1981). Cecropins have been identified in many insect species and in mammals; they are active against Gram-positive and Gram-negative bacteria by creating channels in their lipid bilayer (Lemaitre and Hoffmann, 2007). The regional and developmental differences in structure and function of the fat body have been studied in Lepidoptera and Diptera (Haunerland and Shirk, 1995). Segregation of synthesis and storage functions is associated with the developmental stages and location within the fat body. However, sexual differences in gene expression within the fat body remain understudied. This may be a crucial issue because male and female animals are not merely reproductive partners, but separate genders, each with its individual evolutionary history. Their individual histories prompted us to pose the hypothesis that fat body gene expression differs in males and females. Here, we report the outcomes of experiments designed to test our hypothesis in the oriental fruit fly, Bactrocera dorsalis, one of the most destructive pests of fruit crops worldwide.
MATERIALS AND METHODS Insects The oriental fruit fly, B. dorsalis, colony was obtained from Bureau of Animal and Plant Health Inspection and Quarantine in Taichung, Taiwan, and has been raised for over 1 year in the laboratory. The flies were housed in cages (35 × 35 × 28 cm) and fed with a mixture of sucrose:yeast extract:peptone = 3:1:1 and water ad libitum. Larvae were reared Archives of Insect Biochemistry and Physiology
50
r
Archives of Insect Biochemistry and Physiology, January 2014
on an artificial diet (Chiu, 1978). The rearing conditions were 28 ± 1◦ C, 50 ± 5% r.h., and a 12:12 h photoperiod. Suppression Subtractive Hybridization and Library Construction The subtraction was performed using a PCR-SelectTM cDNA Subtraction Kit (Clontech, Mountain View, CA) according to the manufacturer’s instructions. The mRNA was isolated R mRNA Purification Kit (Invitrogen, Carlsbad, CA) from total RNA using a Dynabeads from fat bodies of 8- to 10-day-old adults. The mRNA (1 μg) was used to synthesize cDNA for the subtraction. The cDNA synthesized from males was used as the tester, and female cDNA as the driver. The cDNA samples were digested with RsaI and tester cDNA was separated into two groups and ligated with two different adapters, respectively, for further hybridization. In the first hybridization, two groups of tester cDNA were hybridized with an excess of driver cDNA at 68◦ C for 8 h to enrich the differentially expressed sequences. In the second hybridization, both of the previous reactions were hybridized together in the presence of fresh driver cDNA at 68◦ C for overnight. After the second hybridization, the subtracted products were amplified by PCR using primers complementary to adapters (applied by the kit). PCR parameters were 75◦ C for 5 min, 94◦ C for 25 s, 27 cycles of 94◦ C for 10 s, 66◦ C for 30 s, and 72 ◦ C for 1.5 min. A nested PCR reaction of 12 cycles of 94◦ C for 10 s, 68◦ C for 30 s, and 72 ◦ C for 1.5 min was carried out. The subtracted R -T Easy Vector System I (Promega, Madison, PCR products were cloned into the pGEM WI), and transformed into Escherichia coli HIT-DH5 α strain (Tri-I Biotech, Taipei, Taiwan). The white colonies were checked by PCR with vector specific primers and electrophoresed on 1% agarose gel. Nine hundred and fifty-two insert-included clones were sequenced using ABI PRISM Big Dye Terminator Cycle sequencing Core kit with AmpliTaq DNA polymerase (ABI, Foster City, CA), performed by Tri-I Biotech. The sequence results were compared with the protein database using BLAST (Altschul et al., 1997) at the National Center for Biotechnology Information (NCBI). cDNA Cloning of Cytochrome P450 cyp6g2 The 5 and 3 ends of the cyp6g2 cDNA were synthesized using the GeneRacerTM kit (Invitrogen). The first-strand cDNA was synthesized from 1 μg of total RNA from the fat body of 8-day-old B. dorsalis male following the manufacturer’s instructions. Specific primers were designed based on the sequence of 339-bp fragment from the subtracted cDNA library. The antisense primer for the 5 RACE PCR was 5 -AACATTCTCATCGACCACTTAATCTC3 , and sense primer for the 5 RACE PCR was the GeneRacerTM 5 Primer. The sense primer for the 3 RACE PCR was 5 -GAATGCCTATATGCCCTTCGG-3 , and antisense primer for the 3 RACE was the GeneRacerTM 3 Primer. RACE PCR products were cloned and sequenced and encompassed the full-length of cyp6g2 cDNA. Real-Time Quantitative RT-PCR (qPCR) We used qPCR to record the transcript levels of cyp6g2, GST, NADH dehydrogenase, and cecropin of 8- to 10-day-old B. dorsalis male and female fat bodies; and the temporal regulation of cyp6g2 in B. dorsalis male and female adults. The first-strand cDNA was synthesized from 1 μg of total RNA with SuperScriptTM III First-Strand Synthesis SuperMix R iQ5 for qRT-PCR kit (Invitrogen). qPCR reactions were performed using the iCycler Archives of Insect Biochemistry and Physiology
Differential Gene Expression in B. dorsalis Fat Body
r
51
Table 1. Sequences of Primers Used in qPCR Gene Actin Cyp6g2 Gst Cecropin NADH dehydrogenase
Forward primer
Reverse primer
ccccaccagagcgtaaatactccg gaatgcctatatgcccttcgg aggtgttgatgaactgaagaaagtc cttcatcttcttggccgtggtgat ccactgggttgactgtctgttattct
gcctgggccggattcatcg cggagtcttttcacatggcgt agcgacataattccaaagccg tgaatggcggcatctctggtatg cctcgcaatataactcaaccttcatc
R R system (Bio-Rad, Hercules, CA) with SYBR GreenER qPCR SuperMix for iCycler ◦ (Ivitrogen). The specific primers are listed in Table 1. The PCR parameters were 50 C for 2 min; 95◦ C for 8 min, 30 s; 40 cycles of 95◦ C for 10 s, and 56◦ C for 30 s. A melting curve analysis was carried out for each test to check the specificity of the amplification. Three independent biological replicates of each treatment were performed and normalized to the internal control of β-actin expression. The qPCR data were collected using the Bio-Rad iQ5 2.0 Standard Edition Optical System Software V2.0. Statistical analyses were performed using Prism 5.0 (GraphPad Software, San Diego, CA). The data of cyp6g2, GST, NADH dehydrogenase, and cecropin transcript levels were analyzed by Student’s t-test. The data of temporal expression were analyzed by ANOVA followed by a Tukey multiple comparison test. A value of P < 0.05 was considered statistically significant. TM
Insecticides Deltamethrin (980 g/kg), technical grade, was provided by Polymax Chemical Mfg. Co., Ltd. (Taipei, Taiwan). Technical permethrin (920 g/kg) was provided by Sinon Corporation (Taichung, Taiwan). Bendiocarb (970 g/kg), technical grade, was given by Kuo Ching R ) was provided by Chemical Co., Ltd. (Taichung, Taiwan). Spinosad (800 g/kg, Entrust Dow AgroSciences LLC (Indianapolis, IN). Bioassays The susceptibility of male and female 9-day-old adults to insecticides was determined with topical application. Permethrin, deltamathrin, and bendiocard were diluted in acetone and spinosad was diluted in water at the selected concentrations. The flies were anesthetized on ice. One microliter of working insecticide solutions was dropped on the ventral side of abdomens. After the solvent was evaporated, the flies were transferred to a plastic cup (250 ml capacity). Twenty flies were treated for each concentration. Flies treated with each concentration in three independent biological replicates were held at 28 ± 1◦ C, 50 ± 5% r.h., and a 12:12 h photoperiod for 24 h before assessment. Data Analysis After 24 h of insecticide treatments, fly mortality, as shown by no response to touching, was recorded. Mortality data were analyzed using probit analysis (Finney, 1971), which was developed into a computer program by the Department of Entomology, National Chung Hsing University (Chi, 2009). The program provides the linearity of dose–mortality and determines slope, lethal dose (LD), 95% fiducial limits of LD50 , and chi-square of each line tested. Student’s t-test was applied to compare the LD50 of males and females. Archives of Insect Biochemistry and Physiology
52
r
Archives of Insect Biochemistry and Physiology, January 2014
Table 2. List of Subtracted cDNA Clones Showing Similarity with NCBI Database Category
Accession no. Size (bp)
Homology
E value Number (%)
Enzyme
JZ477759
339 572 304 958 170 321
Cyp6g2 Cyp4g1 Glutathione S-transferase NADH dehydrogenase subunit 5 NADH dehydrogenase subunit 4 Aldo-keto reductase
1 × 1025 4 × 106 2 × 1022 8 × 10152 4 × 107 1 × 1016
JZ477753 JZ477757 JZ477762
417 534 289
Cecropin Serpin 27A isoform A Serine protease inhibitor 43Ab
2 × 1016 8 × 109 3 × 108
JZ477754 JZ477755
222 504
Anterior fat body protein Arylphorin receptor
7 × 1030 5 × 1033
JZ477758 JZ477760 JZ477761 JZ477763 JZ477764 JZ477765
696 168 519 688 246 323
Translation elongation factor 1 γ Translation initiation factor 2γ Odorant-binding protein 19d Bruchpilot Cytochrome c Cuticular protein 100A
1 × 10103 2 × 1028 7 × 1017 2 × 1050 1 × 107 3 × 1027
JZ477751 JZ477752 JZ477756 KF514115 a
Immunity
Storage protein receptor
Others
Hypothetical protein Unknown
318 (33.3) 202 (21.2) 1 (0.1) 5 (0.5) 80 (8.4) 4 (0.4) 26 (2.7) 146 (15.4) 93 (9.8) 49 (5.2) 4 (0.4) 66 (6.9) 64 (6.7) 2 (0.2) 50 (5.2) 27 (2.8) 13 (1.4) 6 (0.6) 2 (0.2) 1 (0.1) 1 (0.1) 49 (5.2) 323 (34.0)
The mitochondrial sequence
