Plant Science 224 (2014) 74–85

Contents lists available at ScienceDirect

Plant Science journal homepage: www.elsevier.com/locate/plantsci

Differential expression of structural genes for the late phase of phytic acid biosynthesis in developing seeds of wheat (Triticum aestivum L.) Kaushal Kumar Bhati a , Sipla Aggarwal a , Shivani Sharma a , Shrikant Mantri a , Sudhir P. Singh a , Sherry Bhalla a , Jagdeep Kaur b , Siddharth Tiwari a , Joy K. Roy a , Rakesh Tuli a , Ajay K. Pandey a,∗ a National Agri-Food Biotechnology Institute, Department of Biotechnology, Government of India, C-127, Industrial Area, S.A.S. Nagar, Phase 8, Mohali 160071, Punjab, India b Department of Biotechnology, Panjab University, Punjab, India

a r t i c l e

i n f o

Article history: Received 6 January 2014 Received in revised form 28 March 2014 Accepted 11 April 2014 Available online 18 April 2014 Keywords: Triticum aestivum Phytic acid pathway Seed development Gene expression Inositol phosphate kinases Multidrug resistance protein

a b s t r a c t In cereals, phytic acid (PA) or inositol hexakisphosphate (IP6 ) is a well-known phosphate storage compound as well as major chelator of important micronutrients (iron, zinc, calcium, etc.). Genes involved in the late phases of PA biosynthesis pathway are known in crops like maize, soybeans and barley but none have been reported from wheat. Our in silico analysis identified six wheat genes that might be involved in the biosynthesis of inositol phosphates. Four of the genes were inositol tetraphosphate kinases (TaITPK1, TaITPK2, TaITPK3, and TaITPK4), and the other two genes encode for inositol triphosphate kinase (TaIPK2) and inositol pentakisphosphate kinase (TaIPK1). Additionally, we identified a homolog of Zmlpa-1, an ABCC subclass multidrug resistance-associated transporter protein (TaMRP3) that is putatively involved in PA transport. Analyses of the mRNA expression levels of these seven genes showed that they are differentially expressed during seed development, and that some are preferentially expressed in aleurone tissue. These results suggest selective roles during PA biosynthesis, and that both lipid-independent and -dependent pathways are active in developing wheat grains. TaIPK1 and TaMRP3 were able to complement the yeast Scipk1 and Scycf1 mutants, respectively, providing evidence that the wheat genes have the expected biochemical functions. This is the first comprehensive study of the wheat genes involved in the late phase of PA biosynthesis. Knowledge generated from these studies could be utilized to develop strategies for generating low phyate wheat. © 2014 Elsevier Ireland Ltd. All rights reserved.

Introduction Phytic acid (myo-inositol 1,2,3,4,5,6-hexakisphosphate; IP6 ; PA) is an important plant molecule that acts as a primary reservoir of phosphates in seeds. PA is also involved in plant developmental and signaling processes including auxin storage and transport, phosphatidyl inositol signaling, cell wall biosynthesis, and production of stress-related molecules [1–3]. The storage form of PA is referred as phytate or phytin, which is mainly located in the aleurone layer of seeds. PA accumulation negatively impacts human nutrition because of its ability to chelate micronutrients such as

Abbreviations: DAA, day after anthesis; PA, phytic acid; lpa, low phytic acid; bp, base pairs; ABC-MRP, ATP binding cassette multi drug resistance protein. ∗ Corresponding author. Tel.: +91 1724990300 E-mail addresses: [email protected], [email protected] (A.K. Pandey). http://dx.doi.org/10.1016/j.plantsci.2014.04.009 0168-9452/© 2014 Elsevier Ireland Ltd. All rights reserved.

iron, zinc, and calcium [4,5], which reduces their bioavailability and absorption [6–8]. In order to enhance iron bioavailability in crop plants, multiple biotechnological strategies have been deployed that include suppression of PA pathway genes to generate low phytic acid mutants (lpa), over-expression of plant and fungal phytases to degrade PA [9], overexpression of plant ferritin to enhance storage of metals such as iron and zinc [10,11], and nicotinamide synthase that helps to mobilize iron and zinc from roots to seeds [12]. While these biotechnological efforts have enhanced total iron content by 2–3-fold in staple food crops, efforts to improve bioavailability of micronutrients have met with only marginal success [7,13]. In plants, PA can be synthesized by lipid-dependent or independent pathways. In the lipid-independent pathway, which is predominant in seeds of cereals and legumes, the first committed step in PA biosynthesis involves the formation of inositol 3-phosphate (Ins3P) from glucose-6-phosphate by myo-inositol3-phosphate synthase (MIPS). The subsequent early steps involve

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

a sequential and ordered phosphorylation of the remaining five positions of the inositol ring by a number of kinases [4,14]. The enzymes catalyzing these phosphorylation reactions include inositol tris/tetraphosphate kinase (ITPK), 2-phosphoglycerate kinase, inositol phosphate phosphatase/inositol monophosphatase (IMP), and inositol-pentakisphosphate 2-kinase (IPK1) [4,7]. IPK1 catalyzes the last step, which is common to both the lipid-dependent and independent pathways, resulting in the production of IP6 from inositol (1,3,4,5,6)P5 [15]. The lipid-independent pathway primarily involves ITPKs that belong to a large family of ATP-grasp proteins. This enzyme family is best known for its Ins(1,3,4)P3 5/6-kinase and Ins(3,4,5,6)P4 1-kinase activities. Multiple ITPK proteins have been identified in soybeans (GmITPK-4), maize (ZmITPK1) and rice (OsITPK1-6) [14,16,17], while no such genes have been reported in wheat. Mutations in these genes in maize resulted in low IP6 phenotypes [16]. Similarly, barley lpa2 mutant lines (M635 and M955) had enhanced free phosphorus and decreased IP6 levels due to loss of inositol phosphate kinase 5-kinase activity [18]. Synthesis of Ins(1,4,5)P3 involves phospholipase C and subsequently requires inositol 1,4,5tris-phosphate kinase (IPK2) to produce IP5 and is referred as the lipid-dependent pathway [19]. IPK2 genes from rice and Arabidopsis been reported to be involved in lipid-dependent PA biosynthesis in seeds [17,19]. In plants, the last gene involved in synthesis of IP6 was reported from rice (OsIPK1), maize (ZmIPK1 and ZmIPK2), Arabidopsis (AtIPK1 and AtG59900) and soybean (GmIPK1) [17,20–23]. Reducing IPK1 in Arabidopsis seeds lowers total PA content suggesting a potential target for genetic manipulation that could be expanded to other crops [20]. Maize lpa1-1 encodes an ATP-binding cassette multidrug resistance-associated protein (ABCC MRP) transporter, and the lpa1-1 mutant had 50–66% lower phytate without adversely affecting seed viability, germination, or plant growth [13]. The functional homologs of lpa1-1 were targeted in soybean [24], Arabidopsis [25], and Phaseolus [26] to achieve low phytic acid in seeds. Further genetic modification of the Zmlpa1-1 mutant by overexpressing soybean ferritin in endosperm resulted in enhanced iron bioavailability [27]. ABCC MRP transporters are also involved in cellular detoxification, organic anion transport and have high affinity for IP6 transport and storage [28,29]. Such studies emphasized the fact that both increased iron content and reduced phytate levels are important to enhance bioavailability. Overall these studies demonstrate that the multiple genes involved in regulating the level of PA in seeds are conserved among different crop species. Efforts have been made to reduce phytate content in soybean, maize, phaseolus, barley and rice [13,16,26,30,31], but to our knowledge there is no such report in wheat. Understanding the genes involved in PA biosynthesis, their functional characterization and targeting these genes for suppression could be one of the best strategies for reducing phytate. In order to achieve the above goal in wheat, it is therefore necessary to identify the genes those contribute in PA accumulation in during early stages of grain development. In this study the genes involved in the late phase of PA biosynthesis pathway were identified and their expression levels were quantified during different stages of seed development. Gene expression analysis was performed on developing wheat seeds from 7 to 28 days after anthesis (DAA). These developmental stages include formation of multi-cellular structures through grain filling and maturation followed by desiccation [32,33]. The corresponding homologs of inositol phosphate kinases (IPK), inositol tetraphosphate kinase (ITPK) and MRP subclass ABCC transporter genes were identified in wheat. Correlations were drawn between iron and PA accumulation during early phase of seed development (7–28 DAA) and at the tissue specific level. Yeast complementation studies established that both TaIPK1 and TaMRP3 were able to rescue their respective mutant phenotype, providing the evidence for the

75

functionality of these genes. These studies establish candidate genes that can be manipulated to alter PA content in wheat. Materials and methods Plant material A bread wheat (Triticum aestivum) variety, C306, was grown in three replicates at the research farm of National Agri-Food Biotechnology (NABI). The main individual spikes of the biological replicates were tagged at the first days after anthesis (DAA). The tagged spikes were harvested at four main developmental stages i.e. 7, 14, 21, and 28 DAA and frozen in liquid nitrogen for RNA extraction. To compare the expression of genes in aleurone and endosperm, these tissues were separated from 14 DAA seeds and were frozen for further processing. For studying gene expression in different parts of wheat, tissues were collected from seeds, roots, shoots, leaves and flag leaf of wheat plants at the stage of 5 DAA. RNA isolation Total RNA was extracted from the multiple stages of wheat seed development i.e. 7, 14, 21 and 28 DAA using an RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). For the seed tissue specific study, aleurone layers and endosperms of 14 DAA seeds were separated by micro-dissecting the whole seed in presence of dry ice with careful removal of aleurone and allowing starchy endosperm to come out of the pericarp. For tissue collections, a minimum of fifteen seeds from three different plants were pooled together. The tissues were subsequently snap frozen in liquid nitrogen. RNA was extracted as per the manufacturer’s protocol followed by DNAse I treatment using an RNase free kit (Ambion, USA). Sequence analysis and primer designing Candidate wheat genes involved in PA biosynthesis pathway were identified by searching the cereal database (http://www. cerealsdb.uk.net/) and using the BLAST program. Multiple ESTs were aligned using DNASTAR Lasergene 11 Core suite. The amino acid sequences of conserved domains were aligned using Clustal X ver. 1.83 [34] and MegAlign of Lasergene 11 Core suite. Based on the consensus sequence, primers were designed for ORF amplification. For the genes lacking full length information 5 and 3 race were performed and sequence information was utilized to clone full ORF from mixed cDNA derived from RNA collected during seed developmental stages. Quantitative real time PCR (qRT-PCR) Two micrograms of DNA-free RNA was used for the first strand cDNA synthesis using the Transcriptor First Strand cDNA Synthesis Kit RT-PCR (Roche, USA) with random hexamer primers following the manufacturer’s guidelines. The qRT-PCRs were performed using gene-specific primers (Table 1) by using QuantiTect SYBR Green RT-PCR Master mix (Qiagen) for 45 cycles on ABI 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA). The Ct values obtained were normalized against 18S rRNA, because its expression was shown to be consistent. Four to five PCRs were performed in at least two to three separate RNA preparations from independent tissues. Multiple cDNA dilutions were used to generate a logarithmic value and reaction efficiencies were calculated before selecting the primer concentration. The amount of target RNA fell within the range tested, allowing a reliable quantification of target RNA samples. Data were analyzed using ABI PRISM 7700 Sequence Detection System software (Applied Biosystems). The 2CT method was used to calculate relative quantities [35]. The specificity of the

76

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

Table 1 Gene-specific primers used for qRT-PCR. Name of Gene

Primers (5 –3 )

Amplicon size (in bp)

TaITPK1

Forward: CGCGCGCTGGGCCTGCAACTCTT Reverse: TTATTTCACGACAACATGGTTGGC

211

TaITPK2

Forward: AGGAGTTCGTCAACCATGGCGGCGT Reverse: GCCGCCCGCGATCTGGTTGATGAAT

247

TaITPK3

Forward: CCACGTCACCTGCGTCAAGC Reverse: ATGTCGAAGTTGAAGAGCTGCAGG

197

TaITPK4

Forward: CACCATCGGCTACGCGATGCAGCC Reverse: AAGGCCTCCAGCTGCGCGCGCCA

191

TaIPK2

Forward: GCCCTACGTCACCAAGTGCCTCGC Reverse: AACCACGCCTTGAGCTCGCGCAGC

283

TaIPK1

Forward: ACTGGGTCTACAAGGGAGAGGGC Reverse: ACACGAACCCCGCCATCAACATGA

279

TaMRP3

Forward: ATGGCTCTGCCTGCGAATGGA Reverse: CAAGGCCAGCCATACTTGGT

110

␣/␤-Gliadin (Ta.67647)

Forward: GACCTTTCTCATCCTTGTCCTCCT Reverse: CTGTGAATATGGTAGTTGCGGCTG

265

␥-Gliadin (Ta.50482)

Forward: TCTACAACAACAGATGAACCCCTG Reverse: GCCTTGTTGTTGTTCTTGCTGCATG

225

amplification was also assessed for each gene by dissociation curve analysis. A unique peak on the dissociation curve was confirmed for each gene. Phytic acid, phosphate and micronutrient estimation in developing wheat grains Total phytic acid was estimated from developing wheat grains using the K-PHYT kit (Megazyme, Inc, Bray, Ireland). Briefly, the seeds were powdered and acidified overnight in 0.66 N HCl. The supernatant was then used for colorimetric development to estimate total PA and free phosphate. Standards were plotted as mentioned in the manufacturer instruction booklet. For micronutrient analyses aleurone and endosperm were separated from seeds at 14 DAA in chilled condition from about 30 grains. The tissues were lyophilized (VirTis, sentry 2.0, USA) and acid digestion (65% Nitric Acid, Suprapur, Merck) was performed in the Microwaveassisted Digestion System (Mars 6, CEM Corporation, USA). Iron concentration was estimated in the digested samples using inductively coupled plasma mass spectrometry (ICP-MS; 7700× Agilent Technologies, Santa Clara, CA). The error bars indicate standard deviation in two independent experiments. Yeast strains and complementation assays Wild types yeast strains BY4741 (MATa, his31; leu20; met150; ura30), YPH499 (MAT˛, ura3–52; leu2-  1; lys2–801; his3  200; trp1  63; ade2–101), yeast mutant ipk1 (MATa, YDR315c::kanMX4; his31; leu20; met150; ura30) and ycf1 (MAT˛, Dycf1::KanMX2; ura3–52; leu2-D1; lys2–801; his3D200; trp1D63; ade2–101) were used in the current study. Yeast cells were routinely grown at 30 ◦ C on complete medium (yeast extract-peptone-dextrose [YPD]) or minimal drop-out medium (i.e., synthetic complete medium without Uracil [SD-Ura]). Yeast transformation was carried out by Li-Acetate method using plasmid pYES263 or pYES260. Full length cDNAs of ScIPK1 and TaIPK1 were cloned directionally in pYES260 whereas TaMRP3 was cloned into pYES263. Empty pYES260 and pYES263 vectors was transformed into the respective yeast mutants and used as negative controls. The wild type and mutant were grown overnight at 30 ◦ C to an OD600 of

1.0. The diluted cells (OD600 of 0.5–0.7) were subsequently grown for 6–8 h in minimal medium (SD-Ura with 2% galactose and 1% raffinose). The cell pellet was further diluted to an OD600 of 0.1, and additional serial dilution was done in 10-fold increments and spotted onto SD-Ura (2% galactose and 1% raffinose) plates. The colony plates were subsequently incubated at 30 and 37 ◦ C and representative pictures were taken after three days. For cadmium sensitivity assays, after induction 5 ␮l of yeast cells with an OD600 of 0.1 and additional serial dilution was spotted serially onto YPD media containing 100 ␮M of cadmium salt (CdSO4 ) and incubated at 30 ◦ C for four days. Results Identification, characterization, and expression analyses of wheat inositol tetraphosphate kinase (ITPK) genes Multiple plant ITPK proteins have been identified and shown to be important in regulating I(3,4,5,6)P4 metabolism. The barley (AM404177; HvIPK) and maize (AY172635; ZmIP5/6K) genes were used in sequence searches to identify forty-four wheat expressed sequence tags (ESTs) for this category. Three full length and one partial cDNA sequences were obtained by alignment of the wheat EST sequences. These four cDNAs represented different genes and we referred to them as TaITPK1 (UniGene ID: Ta.70767), TaITPK2 (EST ID: CA618510.1), TaITPK3 (UniGene ID: Ta.39455), and TaITPK4 (UniGene ID: Ta.36061). The multiple sequence alignment of three full length ITPKs with that of Arabidopsis (AtITPK1), soybean (GmITPK1-4), barley (HvIPK), and maize (ZmIP5/6k) suggested several motifs that define conserved regions among different inositol phosphate kinases (Fig. 1A). The percentage amino acid identity of TaITPK1 with TaITPK4, TaITPK3 and OsITPK4 was 52.0, 51.1 and 49.8 respectively, and the percentage identity between TaITPK3 with TaITPK4 was 47.2. Phylogenetic analysis of the deduced amino acid sequences of multiple plant ITPKs revealed that the wheat genes were clustered separately into two major clades (Fig. 2A). TaITPK1 and TaITPK4 were clustered together along with OsITPK4. TaITPK3 was placed into another clade along with HvIPK, ZmIP5/6k and OsITPK5 with the percentage amino acid identity of 97.7, 80.9 and 79.2, respectively.

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

77

Fig. 1. Amino acid sequence alignment of proteins involved in the late PA pathway. (A) Alignment of amino acids of selected regions of inositol tetraphosphate kinases from the following plant species: Arabidopsis AtITPK1 (Q9SBA5); soybean (Gm; type 1 EU033958, type 2 EU033959, type 3 EU033960, type 4 EU033961; maize ZmIP5/6K (AY172635) and wheat (TaITPK1, TaITPK2, TaITPK3 and TaITPK4). (B) Inositol phosphate kinase: OsIPK2 (AK072296) and AtIPK2 (AY147935). (C) Inositol pentakisphosphate kinase: AtIPK1 (AT5G42810), OsIPK1 (AK102842), ZmIPK1 (DQ431470) and TaIPK1. (D) ABC signature domains and walker B box are shown for sequence conservation among the plants listed: AtMRP5 (EFH68457.1), ZmLPA1 (ABS81429.1), TaMRP3 and ScYCF1 (EEU09342). The consensus motif sequences are shown in the black shaded boxes.

Expression of the four TaITPK genes was quantified by qRTPCR in developing seeds at time points representing four distinct developmental stages [(i.e. 7, 14, 21 and 28 DAA]. The analysis showed that the TaITPK’s were expressed throughout the examined developmental stages. The expression level of TaITPK1 did not changed significantly during seed development stages indicating its

constitutive expression (Fig. 3A). TaITPK2 was induced at early stage of the seed development and its expression level was significantly higher at 14 DAA when compared to other development stages. At 14 DAA, TaITPK2 transcript accumulation was 5-fold higher compared to the late stages of seed development. TaITPK3 was highly induced at the early stage (i.e. 7 DAA) and the late stage (i.e. 28 DAA)

78

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

Fig. 2. Phylogenetic tree analysis of different PA pathway genes indentified from wheat. (A) Phylogenetic relationships of ITPKs from the following plant species: Arabidopsis (AtITPK1: Q9SBA5, AtITPK2: Q81893, ATITPK3: F4JG14 and AtITPK4: O80568); soybean (GmITPK1: EU033958, GmITPK2: EU033959, GmITPK3: EU033960, GmITPK4: EU033961); maize ZmIp5/6k (AY172635); rice (OsITPK1: AK106544; OsITPK2: AK100971; OsITPK3: AK067068; OsITPK4: AK071209; OsITPK5: AK059148; OsITPK6: AK102571) and wheat (TaITPK1, TaITPK3 and TaITPK4). (B) Phylogenetic relationships of IPK2s from the following plant species: Arabidopsis (AtIPK2␣: AY147935), rice (OsIPK2: AK072296), soybean (GmIPK2: ABU93830) and wheat (Ta.35113). (C) Phylogenetic relationships of IPK1s from Arabidopsis (AtIPK1: AT5G42810), rice (OsIPK1: AK102842), maize (ZmIPK1: DQ431470), yeast (ScIPK1: YDR315c) and wheat (TaIPK1: Ta.41955). (D) Phylogenetic relationships of wheat TaMRP3 (Ta.74676), arabidopsis AtMRP5 (EFH68457.1), maize ZmLPA1 (ABS81429.1), Phaseolus vulgaris PvMRP1 (CBX25010) and yeast ScYCF1 (EEU09342). (E) Intron–exon genomic organization of the wheat TaIPK1 and TaMRP3 genes. Exons are indicated by boxed structure. The number indicates the intron size in base pairs.

of seed development. There was gradual increase in its transcript accumulation from 14 to 21 DAA. TaITPK3 transcript accumulation increased by 5-fold at 28 DAA and was similar when compared to the 7 DAA stage of seed maturation. Expression of TaITPK4 was highest at the early stages of seed development (7 and 14 DAA) when compared to the late phase of seed maturation from 21 to 28 DAA. The fold accumulation of TaITPK3 was highest when compared to TaITPK1, TaITPK2 and TaITPK4 during early stage (i.e. 7 DAA) of seed development. Overall, the expression analysis suggested differential expression of the TaITPK2, TaITPK3 and TaITPK4 while TaITPK1 is constitutively expressed during grain development.

Identification, characterization, and expression analyses of inositol polyphosphate kinase (TaIPK2) The gene sequences of rice (OsIPK2; AK072296) [17] and Arabidopsis (AtIPK2˛; AY147935) [17] genes contributing to lipid-dependent synthesis of PA in seeds were used to perform BLAST searches against wheat EST and cereal databases. BLASTx analysis determined that only TaIPK2 (UniGene ID: Ta.35113) gene possessed all the conserved domains that are present in other members of this gene family. Domain analysis revealed the presence of typical inositol phosphate and ATP binding site (Fig. 1B). TaIPK2 had highest homology at amino acid level with

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

79

Fig. 3. Quantitative RT-PCR analysis of late PA pathway genes. (A) Quantification of TaITPK1-4, TaIPK2, TaIPK1 and TaMRP3 transcripts during seed development. The cDNA templates were prepared from 2 ␮g of DNAse free RNA isolated from different time point of seed maturation at 7, 14, 21 and 28 DAA. (B) Estimation of the PA content during the course of seed development. Data were statically analyzed to determine differences between means. Each bar indicates the mean of four to five replicates with the indicated standard deviation of the mean. Values sharing common letters are not significant different at p < 0.05.

OsIPK2 when compared to GmIPK2 and AtIPK2 with the identity of 68.3, 45.8 and 39.6 percentage, respectively. Expression of TaIPK2 gene was quantified by qRT-PCR during four seed developmental stages (i.e. 7, 14, 21, and 28 DAA). The analysis showed TaIPK2 transcript accumulation increased during early seed developmental stages reaching a maximum at 14 DAA (Fig. 3A). At this stage its expression level was close to 2-fold when compared to other stages of seed development. The accumulation then decreased from 21 to 28 DAA to return to levels similar to 7 DAA. Differential regulation of inositol 1,3,4,5,6-pentakisphosphate (IP5 ) 2-kinase (TaIPK1) during wheat seed development Inositol 1,3,4,5,6-pentakisphosphate (IP5 ) 2-kinase (IPK1) catalyzes the production of inositol hexakisphosphate (IP6 ), the last step of the PA pathway. Targeting this gene has been one of the most successful approaches for developing lpa crops. Gene sequences of rice (OsIPK1; AK102842) [17] and Arabidopsis (AtIPK1; AT5G42810)

[20] were used to perform BLAST searches against wheat EST and cereal databases. Out of the twenty ESTs, only one full length gene was obtained having homology with inositol pentakisphosphate kinase, TaIPK1 (UniGene ID: Ta.41955). TaIPK1 like other plant IPK1’s had three typical motifss, GEG(G/A)ANL, RxxMHQxLK and LDxLDIEGx4Y [15,21,22,36] (Fig. 1C). TaIPK1 sequence showed percentage identity of 83.5, 78.7, 53.2 and 19.2 with that of rice (OsIPK1), maize (ZmIPK1), Arabidopsis (AtIPK1), and yeast (ScIPK1), respectively at amino acid level. To obtain its genomic organization in wheat, TaIPK1 sequence was used to query the wheat genome database (IWGSC). The sequence alignments suggested the presence of 5 introns (Fig. 2D). Expression of the TaIPK1 transcript was quanfied by qRT-PCR over the seed development time course described above. These data showed that TaIPK1 transcripts were expressed from 7 to 21 DAA during which there was no significant change in levels (Fig. 3A). The accumulation was approximately 2-fold higher at the last time point studied i.e. 28 DAA when compared to the early stages of wheat seed development.

80

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

TaMRP3 is highly expressed during early phase of seed development. ZmMRP2 (lpa1-1) of maize and AtMRP5 of Arabidopsis are actively involved in PA accumulation and vacoular transport [26,28]. Homology searches for AtMRP5 and maize lpa1-1 in wheat led to identification of a unigene, Ta.74676 that we designated as TaMRP3. The full length cDNA sequence of TaMRP3 was confirmed by 5 and 3 RACE. Based on the RACE product information, gene specific primers were designed, and PCR amplification was performed to clone the complete ORF of TaMRP3. Translated amino acid sequence analysis of TaMRP3 identified the presence of typical protein domains of ABC-MRP proteins from Arabidopsis, maize, and yeast (Fig. 1D). The TaMRP3 protein has well conserved domains like the ABC signature, walker A/B box with respective transmembrane domain, and it shares 90.5, 77.5, 73.5 and 34.9 percent amino acid identity with Zmlpa-1, PvMRP1, AtMRP5 and ScYCF1, respectively (Fig. 2D). Quantitative expression analysis of TaMRP3 in developing seeds indicated early accumulation of its transcripts that gradually increased from 7 to 14 DAA (Fig. 3A). At this stage, the transcript accumulation level was 4-fold higher when compared to late stages of seed development. At the time points i.e. 21 and 28 DAA, the accumulation of the TaMRP3 decreased significantly suggesting its possible role in transporting PA into vacuoles at the initial stages of seed development (Fig. 3A). Correlation of PA accumulation and differential expression of PA pathway genes in aleurone layer and endosperm To correlate the gene expression study with the PA accumulation in seeds, PA content was estimated through the early and late phase of wheat seed development. The six seed development stages i.e. 7, 14, 21, 28, 35, and 42 DAA were included in the study (Fig. 3B). The results suggested an early detection of PA during grain filing and this accumulation increased linearly as development progressed (Fig. 3B). The rate of PA accumulation was very high at the early phase of grain filing i.e. from 7 to 21 DAA. Although, PA was highest at 42 DAA, the rate of its accumulation decreased after 28 DAA. This suggests high activity of late PA pathway genes during the early phase of seed development in wheat plants. Concomitantly, the level of free phosphate decreased with the seed development (data not shown). In order to gain insight into the tissue specific expression for late phytic acid pathway genes, we quantified expression of TaITPK2, TaITPK3, TaIPK2, TaIPK1 and TaMRP3 in the aleurone layer and endosperm tissues of 14 DAA seeds. TaITPK1 and TaITPK4 were not included in this experiment since they were expressed at very low levels in wheat seed. Quantitative expression analysis of ␣- and ␤-gliadins was performed as a control to validate separation of these tissues from seeds (Fig. S1). The expression analysis of the studied genes showed high accumulation in the aleurone layer in comparison to the endosperm (Fig. 4A) except for TaIPK2. Interestingly, TaIPK2 showed little difference in the transcript accumulation between the aleurone layer and endosperm (Fig. 4A). The transcript accumulation for TaITPK3 had the greatest difference between aleurone layer and endosperm with a 9–11-fold change. Similarly, in comparison to the endosperm, transcript accumulation levels of TaMRP3, TaIPK1, and TaITPK2 ranged from 6 to 8-fold greater in the aleurone layer. These results suggest that the transcripts of these genes are specifically expressed in the aleurone layer. Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.plantsci.2014.04.009. To correlate our tissue-specific expression results, we estimated total PA and important mineral ions in the aleurone layer and endosperm tissues. The high accumulation of PA was

observed in aleurone layer when compared to endosperm (Fig. 4B), which correlates with expression for some of the PA pathway genes. Elemental analysis using inductively coupled plasma mass spectrometry (ICP-MS) suggested high accumulation of Ca, Fe and Zn in aleurone as compared to endosperm (Fig. 4C). This also supports the previous observation regarding the colocalization of anti-nutrients like PA and micronutrients such as iron [7,37]. Expression of PA pathway genes from different tissues of wheat The expression of wheat PA pathway genes TaITPK1, TaITPK2, TaITPK3, TaITPK4, TaIPK2, TaIPK1 and TaMRP3 was examined from various plant parts including roots, shoots, leaves, flag leaf and seeds at 5 DAA. qRT-PCR analysis suggested preferentially higher expression of these genes in shoots, flag leaf and seeds when compared to roots. TaITPK1 was expressed in all the tissues with no significant change in the level of expression (Fig. 5). Interestingly, TaITPK2 and TaIPK2 showed specificity for the flag leaf when compared to the other tissues examined. Expression of TaITPK3 and TaIPK1 showed preferential expression in the shoots of the wheat plants at 5 DAA (Fig. 5). TaITPK3, TaITPK4, TaIPK1 and TaMRP5 showed significantly higher expression level in developing wheat seeds at 5 DAA when compared to that of other tissues. Expression levels for the transcript of TaITPK3 in seeds were comparable to those in shoots. Additionally, the expression of PA pathway genes was also investigated through meta-analysis of online data in GENEVESTIGATOR (Fig. S2). Our comprehensive, meta-analysis also suggested an overall low expression of TaITPK1 and TaITPK4 when compared to other TaITPKs in different tissues of wheat (Fig. S2). Supplementary Fig. S2 material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.plantsci. 2014.04.009. Functional analysis of wheat IPK1 and MRP3 in yeast mutants Previous efforts suggested that lowering the IPK1 and MRP levels in seeds helps in achieving lpa crops without compromising any important physiological parameters. To ascertain the functional activity of TaIPK1 and TaMRP3, complementation assays were performed using their respective yeast mutants. BY4741 and ipk1 showed growth sensitivity at 30 ◦ C on SD-Ura plates, whereas growth was restored when transformed with empty pYES260 suggesting uracil prototrophic phenotype (Fig. 6A, left panel). Similarly growth was also observed for ipk1 transformed with either ScIPK1 or TaIPK1 cloned in pYES260 plasmid. When similar plates were subjected to heat stress at 37 ◦ C only ipk1 transformed with either ScIPK1 or TaIPK1 could rescue the growth phenotype. At 37 ◦ C, the growth was restricted for BY4741 and ipk1 strains that were either untransformed or transformed with the empty pYES260 vector when compared to 30 ◦ C. Yeast ipk1 transformed with pYES260-TaIPK1 was able to grow at 37 ◦ C confirming the functionality of the TaIPK1 enzyme (Fig. 6A). Our complementation results suggested that TaIPK1 complements ScIPK1 function in ipk1 for temperature sensitivity (Fig. 6A, right panel). These results were repeated using two independent colonies. To functionally validate TaMRP3, we utilized the yeast ycf1 mutant. YCF1 contributes to cadmium detoxification in yeast by mediating its transport into the vacuole [38]. TaMRP3 cloned into the pYES263 was transformed into the ycf1 mutant and complementation assays were performed on YPD plates supplemented with 100 ␮M of CdSO4 . The ycf1 mutant is hypersensitive to cadmium salts and its growth gets retarded in the presence of CdSO4 . Yeast ycf1 mutant transformed with pYES263-TaMRP3 was able

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

81

Fig. 4. Quantitative estimation of PA, iron and quantitative transcript accumulation in aleurone and endosperm tissues of wheat seeds. (A) Quantification of TaITPK2, TaITPK3, TaMRP3, TaIPK1 and TaIPK2 transcripts in aleurone and endosperm of wheat seeds. The cDNA templates were prepared from 2 ␮g of DNAse free RNA isolated from each tissue. (B) Estimation of PA in the different tissues of wheat seeds, aleurone (Al) and endosperm (En). (C) Estimation of calcium, iron and zinc iron in different tissues of the wheat seeds.

to rescue the growth in the presence of Cd (Fig. 6B) demonstrating that TaMRP3 complements YCF1 function in yeast. In silico chromosome mapping of the late PA pathway genes The EST sequences of the late PA pathway genes placed on the wheat genome map using online databases (http://wheat-urgi. versailles.inra.fr/Seq-Repository). Our analysis using multiple ESTs revealed consistent mapping of the gene to the same wheat chromosomes (Table 2). To observe any synteny, chromosome mapping of PA biosynthesis genes on wheat, maize and rice was done.

Table 2 Chromosomal location of the late PA biosynthesis pathway genes. UniGene ID/EST

Putative Gene

Chromosomal Location

Ta.70767 CA618510.1 Ta.39455 Ta.36061 Ta.35113 Ta.41955 Ta.74676

TaITPK1 TaITPK2 TaITPK3 TaITPK4 TaIPK2 TaIPK1 TaMRP3

1AL 1BL 1BL 1AL 7AL 2AL, 2BL and 2DL 5AL, 4BL and 4DL

Based on our analysis TaITPK1 and TaITPK4 was mapped to wheat chromosome 1AL, while TaITPK2 and TaITPK3 to chromosome 1BL. Maize ZmIP5/6K (AY172635), TaITPK2 and TaMRP3 are located on respective chromosome 1 with high similarity. The TaIPK1 was mapped on the long arm of the chromosome 2 of the A, B and D genomes, and TaIPK2 to chromosome 7AL. Maize and rice IPK1 were located on chromosome 10 and 4 respectively. ABC-MRP transporter in this study, TaMRP3 was mapped on the long arm of the chromosome 4BL, 4DL and 5AL genomes. ZmMRP4, an lpa loci in maize is located on chromosome 1S, its rice orthologue OsMRP5 maps on chromosome 2. Discussion Several genes involved in PA accumulation have been reported in plants [4], but very few of these genes have been identified in wheat [39]. The present work describes spatio-temporal expression analysis and functional characterization of genes possibly involved during late phase of PA biosynthesis in common wheat. In the context of molecular and biochemical functions of these multiple inositol phosphate kinases from other crops, we propose the model describing the placement of these wheat genes coding for

82

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

Fig. 5. Expression analysis of PA pathway biosynthesis genes (TaITPK1, TaITPK2, TaITPK3, TaITPK4, TaIPK2 and TaIPK1) different parts of wheat plants. The cDNA templates were prepared from 2 ␮g of DNAse free RNA isolated from roots (R), shoots (S), leaves (L), flag leaf (FL) and seeds of 5 days after anthesis (5 DAA). Each bar indicates the mean of five replicates with the indicated standard deviation of the mean. *p < 0.05 indicates significant differences in the relative expression levels of the genes in the tissue samples studied.

PA biosynthesis enzymes through this study (Fig. 7). The model not only depicts the genes involved during biosynthesis of PA but also reports its possible transporter. Thus, this is the first study in wheat reporting late phase components and providing the functional evidence of PA biosynthesis components. Wheat grain is a significant reservoir of phosphates along with micronutrients that are mainly accumulated in the outer bran layers [37]. Previous studies have suggested approaches directed toward the achievement of low phytate levels in crops especially in seeds to enhance iron bioavailability [7,40]. In wheat, mutagenized M2 lines were identified and characterized for low PA content

in the seeds [41]. Our work identified four genes belonging to the ITPK gene family, which is primarily responsible for synthesizing IP5 from IP3 /IP4 [14,42]. The Zmlpa2 gene of maize encodes Ins(1,3,4)P3 5/6 kinase and mutants have 30% reduction in phytate levels in seeds [16]. Zmlpa2 is most similar to TaITPK2 and TaITPK3 that had maximum transcript accumulation during the early stages of seed development, mainly in the aleurone layer. The purified recombinant ZmIPK protein has kinase activity with several inositol polyphosphates suggesting it to be a multifunctional kinase responsible for PA biosynthesis in maize seeds [21]. Domain analysis and phylogenetic alignment suggested that TaITPK3 and

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

83

Fig. 6. Complementation assays of yeast ipk1 and ycf1 mutants by TaIPK1 and TaMRP3, respectively. (A) Yeast parent strain BY4741 and Scipk1 mutant was used to complement with TaIPK1. For control empty vector (pYES260) was subsequently transformed into BY4741and ipk1 strains. Similarly for positive control ScIPK1 was transformed into ipk1 strains. After induction, an aliquot of yeast cells with an OD of 0.1 and subsequent 10 fold dilutions thereof were spotted on identical plates of SD-Ura containing 1% raffinose and 2% galactose. The plates were kept at 30 and 37 ◦ C and pictures were taken three days post incubation. (B) Parent strain YPH299 and its ycf1 mutant were used for TaMRP3 complementation studies. After induction, an aliquot of cells at OD of 0.1 and subsequent 10 fold dilutions thereof were spotted on YPD plates containing 100 ␮M of CdSO4 for incubation at 30 ◦ C. A control plate without CdSO4 was used. Pictures for all the plates were taken three days post incubation.

ZmIPK belong to same clade. Based on the domain conservation we suspect that wheat TaITPK3 possess multi-kinase activity, though it needs to be further substantiated by substrate studies. Of the four Arabidopsis ITPKs reported, AtITPK1 showed preferential transcript accumulation in seeds [25]. Similarly in soybean, GmITPK3 was highly expressed during early stages of seed development [14]. Due to the presence of multiple genes for ITPKs and their varying levels of expression during seed development, functional redundancies between the members are expected. Such specific temporal expression for TaITPK’s suggested different and sequential activities of these proteins during the continuous accumulation of PA. However, homeologous forms of the genes and their expression analysis remain to be established. Thus the current study reflects the quantified mRNA transcripts possibly originating from the three genomes of hexaploid wheat. Expression studies suggested an early expression of TaIPK2 transcripts during seed development. Previously, TaMIPS was also shown to be regulated during wheat seed development [39]. Our findings related to the differentially expressed wheat inositol monophosphatase (TaIMP: data not shown) and expression of TaIPK2 suggest that both lipiddependent and -independent pathways are operational during seed maturation. The insignificant difference in the expression of TaIPK2 in aleurone and endosperm (Fig. 4A) with respect to other genes studied, suggested that the lipid-independent pathway genes might be predominantly functional in wheat seeds. Although at this stage, the contribution of lipid-dependent pathway cannot be ruled out. Thus our molecular investigation and hypothesis need to be supported with enzyme characterization in relation to substrate utilization for these genes. Previous reports suggest that constitutive suppression of early PA pathway enzymes could be detrimental for seed growth and plant development [3,13,43]. However, silencing of IPK1 (involved

in late phase of PA biosynthesis) in Arabidopsis and rice resulted in 83 and 69% decrease in PA content, respectively, without affecting seed physiology [20,31]. Such evidence suggested an added advantage of perturbing IPK1 since they neither disturb the myo-inositol levels nor compromise plant physiology. Similarly, rice RNAi lines targeting OsIPK1 resulted in low PA and showed no changes in the important seed storage proteins and amino acid levels [31]. The success of manipulating IPK genes makes them a good choice for gene disruption to achieve lpa crops. Since TaIPK1 is expressed highly at the early to mid-phase of seed development (14–28 DAA), it could be a viable strategy to manipulate expression or activity of this gene to reduce PA in wheat seeds. Simultaneous increase in TaIPK1 transcript and accumulation of PA reinforce that this enzyme is an important component of the PA pathway in wheat. Functionality and substrate specificities for some of these late pathway genes from multiple crops were demonstrated by enzymatic characterization or by utilizing multiple yeast mutants to rescue their defective growth phenotypes [17,21,22,28,42]. TaIPK1 transformed in to Scipk1 was able to overcome the temperature sensitivity of yeast mutant. Similar functional activity of this gene in arabidopsis [22] also suggested that suppression of TaIPK1 will be a viable strategy to achieve low phytate wheat. Another strategy to generate lpa is to block the transport of cellular PA to vacuole. It has been speculated that either IP6 or the product of its turnover, regulate the transcription of genes encoding for the key enzymes of PA pathway [26]. Maize lpa-1 was characterized as a MRP protein [13] and its closest homolog from wheat, TaMRP3. TaMRP3 is also highly expressed in aleurone; this leads to speculation that TaMRP3 is possibly involved in PA transport to vacuoles in aleurone cells. Thus, supporting the hypothesis that targeting the genes involved in PA mobilization could be an effective strategy to achieve lpa. Wheat MRP3 complements yeast

84

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

Fig. 7. Schematic representation of genes contributing to the PA pathway in wheat. Inositol phosphates are synthesized via lipid-dependent (PtdIP) or lipidindependent (IP) pathways to form IP3 . The identified genes from wheat were either involved in the late phase of PA metabolism or might be involved in its transport. Italicized wheat genes are indicated at the position adjacent to the probable steps they catalyze.

YCF1 function and contributes to Cd detoxification. YCF1 confers tolerance to Cd by mediating transport of the Cd–glutathione complex into the vacuoles [38]. YCF1 is involved in glutathionemediated detoxification pathway in yeasts [44], thus it would be interesting to study whether TaMRP3 is also involved in such a phenomenon. Low phytic acid traits have the potential to improve the phosphorous economy for developed countries and improving human nutrition in developing countries that have primarily grain based diets. The identification of the biosynthesis pathway and related genes provide a foundation needed to manipulate PA content in wheat seeds. Among the genes studied TaIPK1 and TaMRP3 could be the most suitable targets for genetic engineering, although role of other genes cannot be ignored. Such strategies may prove to be an efficient way to not only decrease PA but also enhance iron bioavailability. Acknowledgements Authors would like to thank Executive director, NABI for facilities and support. This research was funded by Department of Biotechnology (DBT), Government of India, New Delhi (BT/PR5989/AGII/106/867/2012) to AKP and ST. We wish to thank Prof. Anand K. Bacchawat (IISER, Mohali) for providing ycf1 mutant and Dr. Rashna Bhandari (CDFD, Hyderabad) for sharing yeast ipk1 mutant and ScIPK1 clone used in the current study. We also thank Dr. Steven Whitham (Iowa State University, Ames, Iowa, USA) for critically reading the manuscript. KKB and SA acknowledge DBT and ICMR for Junior Research Fellowships. Fellowship for SS was supported by DBT grant. Technical assistance from Aakriti Gupta is greatly appreciated. References [1] F.A. Loewus, P.P.N. Murthy, Myo-Inositol metabolism in plants, Plant Sci. 15 (2000) 1–19.

[2] C.E. Hegeman, L.L. Good, E.A. Grabau, Expression of d-myo-inositol-3phosphate synthase in soybean. Implications for phytic acid biosynthesis, Plant Physiol. 125 (2001) 1941–19948. [3] E. Doria, L. Galleschi, L. Calucci, C. Pinzino, R. Pilu, E. Cassani, E. Nielsen, Phytic acid prevents oxidative stress in seeds: evidence from a maize (Zea mays L.) low phytic acid mutant, J. Exp. Bot. 60 (2009) 967–978. [4] S.R. Rasmussen, C.R. Ingvardsen, A.M. Torp, Mutations in genes controlling the biosynthesis and accumulation of inositol phosphates in seeds, Biochem. Soc. Trans. 38 (2010) 689–694. [5] H.E. Bouis, C. Hotz, B. McClafferty, J.V. Meenakshi, W.H. Pfeiffer, Biofortification: a new tool to reduce micronutrient malnutrition, Food Nutr. Bull. 32 (2011) S31–S40. [6] L. Bohn, A.S. Meyer, S.K. Rasmussen, Phytate: impact on environment and human nutrition. A challenge for molecular breeding, J. Zhejiang Univ. Sci. B9 (2008) 165–191. [7] V. Raboy, Approaches and challenges to engineering see phytate and total phosphorus, Plant Sci. 79 (2009) 281–296. [8] S. Borg, H. Brinch-Pedersen, B. Tauris, P.B. Holm, Iron transport, deposition and bioavailability in the wheat and barley grain, Plant Soil 325 (2009) 15–24. [9] H. Brinch-Pedersen, F. Hatzack, E. Stoger, E. Arcalis, K. Pontopidan, P.B. Homl, Heat-stable phytases in transgenic wheat (Triticum aestivum L.): deposition pattern, thermo stability and phytate hydrolysis, J. Agric. Food Chem. 54 (2006) 4624–4632. [10] G. Drakakaki, S. Marcel, R.P. Glahn, E.K. Lund, S. Pariagh, R. Fischer, P. Christou, E. Stöger, Endosperm-specific co-expression of recombinant soybean ferritin and Aspergillus phytase in maize results in significant increases in the levels of bioavailable iron, Plant Mol. Biol. 59 (2005) 869–880. [11] H. Masuda, T. Kobayashi, Y. Ishimaru, M. Takahashi, M.S. Aung, H. Nakanishi, S. Mori, N.K. Nishizawa, Iron-biofortification in rice by the introduction of three barley genes participated in mugineic acid biosynthesis with soybean ferritin gene, Front. Plant Sci. 4 (2013) 132. [12] S. Lee, Y.S. Kim, U.S. Jeon, Y.K. Kim, J.K. Schjoerring, G. An, Activation of rice nicotianamine synthase 2 (OsNAS2) enhances iron availability for biofortification, Mol. Cell 33 (2012) 269–275. [13] J. Shi, W. Wang, K. Schellin, B. Li, M. Faller, J.M. Styoop, R.B. Meeley, D.S. Ertl, J.P. Ranch, K. Glassman, Embryo-specific silencing of a transporter reduces phytic acid content of maize and soybean seeds, Nat. Biotechnol. 25 (2007) 930–937. [14] A.R. Stiles, X. Qian, S.B. Shears, E.A. Grabau, Metabolic and signaling properties of an Itpk gene family in Glycine max, FEBS Lett. 582 (2008) 1853–1858. ˜ [15] B. González, J.I. Banos-Sanz, M. Villate, C.A. Brearley, J. Sanz-Aparicio, Inositol 1,3,4,5,6-pentakisphosphate 2-kinase is a distant IPK member with a singular inositide binding site for axial 2-OH recognition, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 9608–9613. [16] J. Shi, H. Wang, Y. Wu, J. Hazebroek, R.B. Meeley, D.S. Ertl, The maize low-phytic acid mutant lpa2 is caused by mutation in an inositol phosphate kinase gene, Plant Physiol. 131 (2003) 507–515. [17] M. Suzuki, K. Tanaka, M. Kuwano, K.T. Yoshida, Expression pattern of inositol phosphate-related enzymes in rice (Oryza sativa L.): implications for the phytic acid biosynthetic pathway, Gene 405 (2007) 55–64. [18] J.A. Dorsch, A. Cook, K.A. Young, J.M. Anderson, A.T. Bauman, C.J. Volkmann, P.P. Murthy, V. Raboy, Seed phosphorus and inositol phosphate phenotype of barley low phytic acid genotypes, Phytochemistry 62 (2003) 691–706. [19] A.R. Odom, A. Stahlberg, S.R. Wente, J.D. York, A role for nuclear inositol 1,4,5trisphosphate kinase in transcriptional control, Science 287 (5460) (2000) 2026–2029. [20] J. Stevenson-Paulik, R.J. Bastidas, S.T. Chiou, R.A. Frye, J.D. York, Generation of phytate free seeds in Arabidopsis through disruption of inositol polyphosphate kinases, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 12612–12617. [21] Y. Sun, M. Thompson, G. Lin, H. Butler, Z. Gao, S. Thornburgh, K. Yau, D.A. Smith, V.K. Shukla, Inositol 1,3,4,5,6-pentakisphosphate 2-kinase from maize. Molecular and biochemical characterization, Plant Physiol. 144 (2007) 1278–1291. [22] D. Sweetman, S.E.K. Sue Johnson, D.E. Caddick, C.A. Hanke, Brearley, Characterization of an Arabidopsis inositol 1,3,4,5,6-pentakisphosphate 2-kinase (AtIPK1), Biochem. J. 394 (2006) 95–103. [23] F.J. Yuan, D.H. Zhu, Y.Y. Tan, D.K. Dong, X.J. Fu, S.L. Zhu, B.Q. Li, Q.Y. Shu, Identification and characterization of the soybean IPK1 ortholog of a low phytic acid mutant reveals an exon-excluding splice-site mutation, Theor. Appl. Genet. 125 (2012) 1413–1423. [24] J.D. Gillman, V.R. Pantalone, K. Bilyeu, The low phytic acid phenotype in soybean line CX1834 is due to mutation in two homologs of the maize low phytic acid gene, Plant Genome 2 (2009) 179–190. [25] S. Kim, T.H. Tai, Identification of genes necessary for wild-type levels of seed phytic acid in Arabidopsis thaliana using a reverse genetics approach, Mol. Genet. Genomics 286 (2011) 119–133. [26] D. Panzeri, E. Cassani, E. Doria, G. Tagliabue, L. Forti, B. Campion, R. Bollini, C.A. Brearley, R. Pilu, E. Nielsen, F. Sparvoli, A defective ABC transporter of the MRP family, responsible for the bean lpa1 mutation, affects the regulation of the phytic acid pathway, reduces seed myo-inositol and alters ABA sensitivity, New Phytol. 191 (2011) 70–83. [27] M.R. Aluru, S.R. Rodermel, M.B. Reddy, Genetic modification of low phytic acid11 maize to enhance iron content and bioavailability, J. Agric. Food Chem. 59 (2011) 12954–12962. [28] A. Frelet-Barrand, H.Ü. Kolukisaoglu, S. Plaza, M. Rüffer, L. Azevedo, S. Hörtensteiner, K. Marinova, B. Weder, B. Schulz, M. Klein, Comparative mutant

K.K. Bhati et al. / Plant Science 224 (2014) 74–85

[29]

[30]

[31]

[32]

[33]

[34]

[35]

analysis of Arabidopsis ABCC-type ABC transporters: AtMRP2 contributes to detoxification, vacuolar organic anion transport and chlorophyll degradation, Plant Cell Physiol. 49 (2008) 557–569. R. Nagy, H. Grob, B. Weder, P. Green, M. Klein, A. Frelet-Barrand, J.K. Schjoerring, C. Brearley, E. Martinoia, The Arabidopsis ATP-binding cassette protein AtMRP5/AtABCC5 is a high affinity inositol hexakisphosphate transporter involved in guard cell signaling and phytate storage, J. Biol. Chem. 284 (2009) 33614–33622. H. Ye, X.Q. Zhang, S. Broughton, S. Westcott, D. Wu, L. Reg, C. Li, A nonsense mutation in a putative sulphate transporter gene results in low phytic acid in barley, Funct. Integr. Genomics 11 (2011) 103–110. N. Ali, S. Paul, D. Gayen, S.N. Sarkar, K. Datta, S.K. Datta, Development of low phytate rice by RNAi mediated seed-specific silencing of inositol 1,3,4,5,6pentakisphosphate 2-kinase gene (IPK1), PLoS ONE 8 (2013) e68161. D.L. Laudencia-Chingcuanco, B.S. Stamova, F.M. You, G.R. Lazo, D.M. Beckles, O.D. Anderson, Transcriptional profiling of wheat caryopsis development using cDNA microarrays, Plant Mol. Biol. 63 (2007) 651–668. Y. Wan, R.L. Poole, A.K. Huttly, C. Toscano-Underwood, K. Feeney, S. Welham, M.J. Gooding, C. Mills, K.J. Edwards, P.R. Shewry, R.A.C. Mitchell, Transcriptome analysis of grain development in hexaploid wheat, BMC Genomics 9 (2008) 121. J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. Livak, Schmitteng, Analysis of relative gene expression data using a real time quantitative PCR and 2-(Delta Delta C (T)) method, Methods 25 (2001) 402–408.

85

[36] J.W. Verbsky, M.P. Wilson, M.V. Kisseleva, P.W. Majerus, S.R. Wente, The synthesis of inositol hexakisphosphate. Characterization of human inositol 1,3,4,5,6-pentakisphosphate 2-kinase, J. Biol. Chem. 277 (2002) 31857–31862. [37] S.P. Singh, K. Vogel-Mikuˇs, I. Arˇcon, P. Vavpetiˇc, L. Jeromel, P. Pelicon, J. Kumar, R. Tuli, Pattern of iron distribution in maternal and filial tissues in wheat grains with contrasting levels of iron, J. Exp. Bot. 64 (2013) 3249–3260. [38] Z.S. Li, M. Szczypka, Y.P. Lu, D.J. Thiele, P.A. Rea, The yeast cadmium factor protein (YCF1) is a vacuolar glutathione S-conjugate pump, J. Biol. Chem. 271 (2006) 6509–6517. [39] D. Ma, Y. Zuo, D. Sun, C. Wang, T. Guo, Characterization of the TaMIPS gene from winter wheat (Triticum aestivum L.) and changes in its expression pattern with phytic acid accumulation in seeds during grain filing, J. Cereal Sci. 57 (2013) 437–443. [40] R. Salunke, K. Neelam, N. Rawat, V.K. Tiwari, G.S. Randhawa, H.S. Dhaliwal, P. Roy, Bioavailability of iron from wheat Aegilops derivatives selected for high grain iron and protein contents, J. Agric. Food Chem. 59 (2011) 7465–7473. [41] M. Guttieri, D. Bowen, J.A. Dorsch, V. Raboy, E. Souza, Identification and characterization of a low phytic acid wheat, Crop Sci. 44 (2004) 418–424. [42] L. Josefsen, L. Bohn, M.B. Soerensen, S.K. Rasmussen, Characterization of a multifunctional inositol phosphate kinase from rice and barley belonging to the ATP-grasp superfamily, Gene 397 (2007) 114–125. [43] X. Feng, K.T. Yoshida, Molecular approaches for producing low-phytic-acid grains in rice, Plant Biotechnol. 21 (2004) 183–189. [44] K.G. Sharma, R. Kaur, A.K. Bachhawat, The glutathione-mediated detoxification pathway in yeast: an analysis using the red pigment that accumulates in certain adenine biosynthetic mutants of yeasts reveals the involvement of novel genes, Arch. Microbiol. 180 (2003) 108–117.