Mol Cell Biochem DOI 10.1007/s11010-014-2295-9
Differential expression and DNA methylation of angiotensin type 1A receptors in vascular tissues during genetic hypertension development Fang Pei • Xinquan Wang • Rongchuan Yue Caiyu Chen • Ji Huang • Jie Huang • Xiaohui Li • Chunyu Zeng
•
Received: 1 September 2014 / Accepted: 27 November 2014 Ó Springer Science+Business Media New York 2015
Abstract Angiotensin type 1a receptor (AT1aR) is thought to play an important role in the development of hypertension. However, it is unknown how the AT1aR expression in vascular tissue is changed during the development of hypertension or if the degree of methylation in the AT1aR promoter correlates with the expression of AT1aR. To address these questions, we measured AT1aR mRNA, protein expression, and methylation status of the AT1aR promoter in the aorta and mesenteric artery of male spontaneously hypertensive rats (SHRs) and age-matched Wistar-Kyoto (WKY) rats acting as controls at pre-hypertensive (4 weeks), evolving (10 weeks), and established (20 weeks) stages of hypertension. The expression of the AT1aR mRNA and protein was not different between the SHRs and WKY rats at 4 weeks. However, they were significantly greater in SHRs than in WKY rats at 20 weeks. Bisulfite sequencing revealed that the AT1aR promoter from the aorta and mesenteric artery of the SHRs was progressively hypo-methylated with age as compared Fang Pei and Xinquan Wang have contributed equally to this work. F. Pei X. Li (&) Institute of Materia Medica and Department of Pharmaceutics, College of Pharmacy, Third Military Medical University, 30 Gaotanyan, Shapingba District, Chongqing 400038, China e-mail: [email protected] F. Pei X. Wang R. Yue C. Chen C. Zeng (&) Department of Cardiology, Daping Hospital, Third Military Medical University, 10 Changjiang Branch Rd, Yuzhong District, Chongqing 400042, China e-mail: [email protected] F. Pei J. Huang J. Huang Department of Cardiology, Chongqing Corps Hospital of Chinese People’s Armed Police Force, No. 90, Marbles Shi Weiguo Road, Nanan District, Chongqing 400061, China
with their WKY rat counterparts. These results suggest that the heightened AT1aR expression in SHRs is related to the AT1aR promoter hypo-methylation, which might be a consequence of the increased blood pressure and may be important in the maintenance of high blood pressure. Keywords Hypertension AT1 receptor DNA methylation Artery SHRs
Introduction For the last 3 decades, studies have established that the renin-angiotensin-aldosterone system (RAAS) plays a critical role in the development and establishment of the hypertensive state in humans and animal hypertension models such as the spontaneously hypertensive rat (SHR) [1, 2]. Angiotensin II (Ang II), the key effector of RAAS, has an important role in the control of blood pressure and fluid volume [3, 4]. Two 7-transmembrane Ang II receptor subtypes have so far been identified in humans: angiotensin type 1 receptor (AT1R) and angiotensin type 2 receptor (AT2R) [5]. To date, AT1R has been shown to mediate most of the physiological actions of Ang II and is predominant in the control of Ang II-induced vascular functions [6–8]. In rodents, the AT1R exists as 2 distinct subtypes, termed AT1aR and AT1bR, which is 95 % identical in their amino acid sequences [9]. The AT1aR is predominantly expressed in all tissues except the adrenal and pituitary glands where it is the AT1bR that is predominant [10–12]. The AT1aR is abundantly expressed in vascular smooth muscle cells, and its activation by Ang II results in elevated levels of intracellular calcium, generation of reactive oxygen species (ROS), and vasoconstriction, proliferation, and hypertrophy of vascular smooth
123
Mol Cell Biochem
cells [8, 13]. Ang II therefore acts to increase vascular pressure, and accordingly AT1aR antagonists have proven to be highly effective in reversing the hypertension [14]. More and more evidence suggest the importance of AT1aR in the hypertension in SHRs but little is known regarding the expression of the AT1aR in the vasculature at different developmental stages of hypertension. In addition, the mechanism of this overexpression of the AT1aR in SHR remains undetermined. DNA methylation has been implicated in the development and progression of hypertension [15–22]. DNA methylation is a stable epigenetic modification that consists of the covalent binding of a methyl group to the 50 carbon of cytosine mostly occurring at CpG dinucleotide sequences in the mammalian genome [23, 24]. The CpG-rich regions are called CpG islands and are usually located in or near the promoters [25]. Methylation of CpGs in the promoter region has the potential of silencing gene expression. On the contrary, DNA demethylation is generally associated with gene reactivation [26]. In rodents, the AT1aR gene contains a number of CG dinucleotides. Our analysis of the AT1aR gene using MethPrimer software (http://www.urogene.org/methpri mer/indexl.html) revealed two CpG island (?35 to ?161 and ?257 to ?374) in the AT1aR promoter region, suggesting that the regulation of the AT1aR gene expression might be highly related to the methylation status of the CpG islands. Taken together, the main purpose of the present study was to evaluate the mRNA and protein expressions of the AT1aR in the aorta and mesenteric artery at different developmental stages of hypertension, and to investigate whether local AT1aR expression is correlated to the DNA methylation status of the AT1aR promoter during the development of hypertension.
(MBP) in conscious SHRs and WKY rats were performed using a tail-cuff system (ML125, PowerLab, AD Instruments, Castle Hill, Australia) according to the supplier’s protocol. Tissue preparation Male SHRs and age-matched WKY rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and euthanized by exsanguination. The thoracic aorta and superior mesenteric artery were collected and kept at -80 °C until further analysis. RNA extraction and quantitative real-time RT-PCR RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendations. RNA purity and quality were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Beijing, China). The cDNA was prepared from 1ug of total RNA using SuperScript III enzyme (Invitrogen) and random nanomer primers. Quantitative real-time PCR was performed using SYBR Premix Ex Taq (DRR041A; TaKaRa, Tokyo, Japan) and analyzed using an iQ Lightcycler instrument (Bio-Rad). The PCR cycle settings were 95 °C for 30 s, followed by 40 cycles at 95 °C for 10 s, 58 °C for 20 s, and 72 °C for 40 s. Melting curves of the products were obtained after cycling by a stepwise increase of temperature from 65 to 95 °C. The relative mRNA expression level was determined by calculating the values of D cycle threshold (DCt) by normalizing the average Ct value compared with its endogenous control (GAPDH) and then calculating 2-DDCt [27]. All primer sets used in the performance of real-time PCR are shown in Table 1.
Materials and methods
Protein extraction and western blot
Animals
Protein was extracted by homogenizing the aorta and mesenteric artery with radio-immuno-protection assay (RIPA) buffer containing 0.1 % PMSF (Beyotime, China). Protein concentration was measured using the bicinchoninic acid method (Beyotime, China). Equal amount of proteins (35 lg) was separated using SDS–PAGE (9 %) and transferred to nitrocellulose membranes (NC) using semi-dry transblotters (BioRad, Hercules, CA, USA). The reactions to non-specific proteins on the NC membranes were blocked using 5 % skim milk in TBS (25 mM Tris base and 150 mM NaCl) for 2 h at room temperature. The target proteins were then incubated with the primary antibodies against AT1R (PA5-20812, 1:800; Thermo Scientific, Waltham, MA, USA) or GAPDH (AP7873b, 1:600; Abgent, San Diego, CA, USA) overnight at 4 °C. The membranes were washed twice for 10 min each with 0.1 %
Male SHRs and age-matched WKY rats at three different postnatal ages corresponding to the pre-hypertensive (4 weeks), evolving (10 weeks), and established (20 weeks) stages of hypertension were purchased from SLRC Laboratory Animals (Shanghai, China). The study was conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the experimental protocol was approved by the Third Military Medical University Animal Use and Care Committee. Blood pressure measurement Measurements of systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean arterial blood pressure
123
Mol Cell Biochem Table 1 List of primers used for quantitative real-time PCR
Table 2 List of primers used for bisulfite sequencing PCR of AT1aR promoter
Parameter
Primers (50 –30 )
Tm (°C)
Amplicon size (bp)
AT1aR
F: ATTCGTGGCTTGAGTCCTGT
58
105
(NM_030985.4)
R: GTTAACTCAGGGAATGTGGCA
GAPDH
F: CCATTCTTCCACCTTTGATGCT
58
98
(NM_017008)
R: TGTTGCTGTAGCCATATTCATTGT
Parameter CpG island I
Primers (50 –30 )
Tm (°C)
Amplicon size (bp)
F: TTTAGGTAGTTGGGAGGGATTG
55
224
55
288
R: AAATTCAAATATAATAACAAAAAACC CpG island II
F: TATTTTTTGGTGAGTTTTAGTTTAGG R: ACCTCCCCATTTCTATAAAATTCTAC
Tween phosphate buffer solution (PBST) then incubated with goat anti-rabbit Alexa Fluor 680 CW (1:1,0000 dilution) in secondary dilution buffer (5 ml of blocking buffer and 5 ml of 1 9 PBS ? 0.4 % Tween-20) for 2 h at room temperature. Washes were performed twice after secondary labeling, for 10 min in PBST, and then placed in doubledistilled water. Images were acquired using the Odyssey infrared imaging system (Li-Cor; Lincoln, NE, USA) and analyzed by the proprietary software. GAPDH was used as the endogenous reference protein for normalization. The ratio of AT1R/GAPDH was used for semi-quantification and comparison between the groups. DNA bisulfite modification and sequencing Genomic DNA was isolated using DNAsol reagent (Tiangen Biotech, Beijing, China) and (0.5 mg) was subjected to bisulfate treatment using EZ DNA Methylation-Gold Kit TM (ZYMO Research, Orange, CA, USA) according to the manufacturer’s recommendations. PCR on the two CpG island (?35 to ?161 and ?257 to ?374) of the AT1aR promoter region was then performed. PCR cycle conditions used included: 95 °C for 5 min, then 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, and finally one cycle of 7 min for 72 °C. The reaction mixture contained 10 9 PCR buffer, 0.2 mmol/L dNTPs, 2 mmol/L MgCl2, 10 lmol/L primers, 0.5 U of hot start Taq polymerase (Takara, Tokyo, Japan), and 4 ll DNA template. PCR products were separated using 3 % agarose gels, and bands were excised using the QIAquick Gel Extraction kit (Qiagen, Germantown, MD, USA). Purified bands were cloned into a pGEM-T vector (Promega, Madison, WI, USA). Ten clones from each sample were sequenced. Primer set used in bisulfate modified PCR is shown in Table 2.
Statistical analysis Quantitative data are expressed as mean ± the standard deviation (SD) and were analyzed for statistical significance by one-way ANOVA or Student’s t test as appropriate. A two-sided P value \0.05 was considered statistically significant.
Results Parameters of experimental animals SBP, DBP, and MBP were higher in the SHRs than WKY rats even at the age of 4 weeks, and continued to be significantly greater in the SHRs as compared to WKY rats at both succeeding stages of evolving (10-week-old) and established (20-week-old) hypertension. The results are shown in Table 3. Expression levels of AT1aR in aorta and mesenteric artery from WKY and SHRs In order to confirm whether the levels of AT1aR protein are different between WKY and SHRs during conditions of increased blood pressure, we performed immunoblotting using the aorta and mesenteric artery from 4-, 10-, and 20-week-old WKYs and SHRs. As shown in Fig. 1A, B, the AT1aR protein levels of these vessels tended to gradually increase with age in both strains but greatly increased with age in the SHRs. No significant differences were found in the AT1aR protein levels between the strains at the initial pre-hypertensive (4-week-old) stage. At the evolving (10-week-old) stage of hypertension, the AT1aR
123
Mol Cell Biochem Table 3 Body weight, heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean BP (MBP) in WKY and SHR at different ages 4 weeks WKY (n = 6)
10 weeks SHR (n = 6)
20 weeks
WKY (n = 6)
SHR (n = 6)
WKY (n = 6)
SHR (n = 6)
Weight (g)
44.2 ± 6.9
33.6 ± 7.5
237.3 ± 10.1
215.9 ± 9.0
335.2 ± 8.1
316.4 ± 7.8
HR (bpm)
362.7 ± 12.8
388.5 ± 11.9
348.1 ± 11.4
365.4 ± 12.3
358.2 ± 10.7
382.3 ± 13.1
SBP (mmHg) DBP (mmHg)
115.3 ± 5.2 75.6 ± 4.4
124.6 ± 4.5** 83.2 ± 3.7**
125.7 ± 5.3 78.9 ± 4.8
175.9 ± 6.8** 132.1 ± 5.1**
134.8 ± 5.8 85.6 ± 4.3
212.5 ± 4.9** 149.2 ± 5.7**
MBP (mmHg)
87.5 ± 3.7
96.1 ± 4.9**
90.3 ± 3.1
146.7 ± 4.3**
97.2 ± 3.5
162.2 ± 4.1**
** P \ 0.01 versus WKY Fig. 1 Differential expression of AT1aR protein and mRNA in the arteries from both WKY and SHRs. Representative blots and density graphs show the expression levels of AT1aR protein in aorta (A), mesenteric artery (B) from WKY and SHRs. AT1aR protein expression was determined by immunoblotting. AT1aR mRNA expression in aorta (C), mesenteric artery (D) from WKY and SHRs was determined by quantitative realtime PCR. **P \ 0.01 versus age-matched WKY
protein levels tended to be higher in SHRs as compared to WKY rats but did not reach statistical significance. However, the AT1aR protein levels in the aorta and mesenteric artery were markedly increased in the SHRs as compared to WKY rats at the established (20-week-old) stage of hypertension. As shown in Fig. 1C, D, the AT1aR mRNA expression in the aorta and mesenteric artery also tended to gradually
123
increase with age in both strains, though more so in the SHRs. Furthermore, the trend of the increase of the AT1aR mRNA in both strains at different stages of hypertension was very similar to that of AT1aR protein. At the age of 4 weeks, the AT1aR mRNA tended to be lower in the SHRs compared to the WKY rats though it did not reach statistical significance. The AT1aR mRNA further tended to be higher in SHRs at the evolving (10-week-old) stage of
Mol Cell Biochem
hypertension, with the greatest difference occurring at the established (20-week-old) stage of hypertension. These results indicate that the vascular AT1aR protein expression is in parallel with the tendency of the increase as seen in the vascular AT1aR mRNA and is mainly controlled at the transcription level. Comparison of DNA methylation status of AT1aR promoter in WKY and SHRs In order to investigate the status of the AT1aR promoter methylation, we examined the methylation levels of the two CpG islands located in the AT1aR promoter using bisulfite sequencing from the aorta and mesenteric artery of WKYs and SHRs (Fig. 2A). As shown in Fig. 2B–I, the DNA methylation status of the two CpG islands in both the aorta (Fig. 2B–D) and mesenteric artery (Fig. 2F–H) of SHRs displayed age-related progressive hypomethylation. As for the WKY rats, the methylation levels of the CpG island I tended to become gradually hypermethylated with age in both vascular vessels tested (Fig. 2B, C, F, G), whereas the methylation levels of CpG island II showed progressive hypomethylation with increasing age in both the aorta (Fig. 2B, D) and mesenteric artery (Fig. 2F, H). In addition, the average total methylation rate of the AT1aR gene promoter in both the aorta and mesenteric artery of SHRs was significantly hypomethylated with age as compared with those from WKY rats (Fig. 2E, I). Compared with agematched WKY rats, the AT1aR promoter in 4-week-old SHRs showed a slightly higher level of methylation, whereas the 10-week-old SHRs showed a slightly lower methylation level of the AT1aR promoter. At 20 weeks, the SHRs exhibited considerably lower total rate of AT1aR promoter methylation than that seen in WKY rats.
Discussion In this study, we attempted to determine the correlation between the expression of vascular AT1aR and AT1aR gene promoter methylation during the development of hypertension. The results demonstrate for the first time the differential mRNA and protein expressions of the AT1aR in the aorta and mesenteric artery of SHRs as compared with age-matched normotensive WKY rats. The expression of AT1aR mRNA and protein in the vasculature is well correlated with the DNA methylation levels in the AT1aR promoter during postnatal development of hypertension. In order to elucidate the changes that occur to the vascular AT1aR in the development of hypertension, we assessed the mRNA and protein expression of AT1aR in the aorta and mesenteric artery of male SHRs and agematched WKY rats at pre-hypertensive (4-week-old),
evolving (10-week-old), and established (20-week-old) stages of hypertension. With regards to the age-dependent changes, the AT1aR mRNA and protein levels of the aorta and mesenteric artery tended to increase with age in both strains. These increases in the AT1aR expression are comparable with a previous developmental study regarding changes in the expression of angiotensin receptor subtypes in the rat aorta [28]. Therefore, the AT1aR appears to be necessary for vascular smooth muscle cell normal development and during the pathological processes. When the possible differences of AT1aR expression between SHRs and WKY rats were compared, no differences were detected in the AT1aR mRNA and protein levels at the prehypertensive (4-week-old) and evolving (10-week-old) stages of hypertension, though there was a tendency of lower AT1aR mRNA and protein levels in the 10-week-old WKY rats. The AT1aR mRNA and protein levels in the aorta and mesenteric artery were markedly increased in SHRs as compared to the WKY rats at the established (20week-old) stage of hypertension. In 4-week-old (prehypertensive) and 10-week-old (evolving stage) SHRs, the blood pressure was higher than those found in the agematched WKY rats, though the expression of AT1aR mRNA and protein levels was not different between both strains. Therefore, it is unlikely that the increase in AT1aR mRNA and protein levels is related to the cause of hypertension. Hence, the increase in the AT1aR expression in 20-week-old SHRs might be more of a consequence of the increased blood pressure and may therefore be necessary to the maintenance of the high blood pressure. Although in previous as well as in our present findings, we demonstrated that the AT1aR is overexpressed in the established stage of hypertension and is considered to be one of the factors contributing to the pathogenesis of hypertension. However, the regulation of the AT1aR expression during the development of hypertension needs to be further elucidated. Recently, increasing evidence from human and animal studies indicates that epigenetic changes may play a significant role in the pathogenesis of hypertension [15–22, 29–34]. Epigenetic changes are defined as heritable alterations in gene expression patterns that do not change the DNA sequences [35, 36]. Among the epigenetic changes, the DNA methylation of cytosine residues in the regulatory CpG islands of genes is the most intensely investigated mechanisms and plays a vital role in the regulation of gene expression [24–26]. DNA hypermethylation is a hallmark of gene silencing, while DNA hypomethylation promotes active transcription [24, 25]. In our study, we used the MethPrimer software to predict the CpG island in the promoter regions 50 untranslated regions (50 UTRs), exons, introns, 30 UTRs, and two thousand base pairs of the AT1aR promoter. Two CpG islands were found in the promoter region of the AT1aR, suggesting that its cytosine methylation status might contribute to the epigenetic control
123
Mol Cell Biochem
123
Mol Cell Biochem b Fig. 2 Comparison of DNA methylation status of the AT1aR
promoter in the arteries of WKY and SHRs. A Diagram of two CpG islands in the promoter region of the AT1aR gene. Underlined is the bisulfite sequencing region. ?1: transcriptional start site. B DNA methylation status of two CpG islands in the promoter region of the AT1aR gene in the aorta from WKY or SHRs. Open and closed circles denote un-methylated and methylated CpGs, respectively. Twelve clones for each aorta or mesenteric artery were subjected to sequencing. C Percentage of methylated CpG loci in CpG island I of AT1aR promoter in the aorta from WKY or SHRs. D Percentage of methylated CpG loci in CpG island II of AT1aR promoter in the aorta from WKY or SHRs. E The average total percentage of methylated CpG loci in two CpG islands of AT1aR promoter in the aorta of WKY or SHRs. F DNA methylation status of two CpG islands in the promoter region of the AT1aR gene in the mesenteric artery from WKY or SHRs. G Percentage of methylated CpG loci in CpG island I of AT1aR promoter in the mesenteric artery from WKY or SHRs. H Percentage of methylated CpG loci in CpG island II of AT1aR promoter in the mesenteric artery from WKY or SHRs. I The average total percentage of methylated CpG loci in two CpG islands of AT1aR promoter in the mesenteric artery from WKY or SHRs. *P \ 0.05 versus age-matched WKY rats, **P \ 0.01 versus agematched WKY rats, ***P \ 0.001 versus age-matched WKY rats
of AT1aR gene transcription. Bisulfite sequencing revealed that the promoter region of AT1aR was largely methylated in both WKY and SHRs at 4 weeks of age. However, the AT1aR promoter from the aorta and mesenteric artery of the SHRs became hypomethylated with age as compared with those from age-matched WKY rats, especially at the established (20-week-old) stage of hypertension. These results suggest that both age and blood pressure affect CpG methylation in the promoter region of the AT1aR, and that the increasing blood pressure suppresses CpG methylation in the promoter. These data are in accordance with the expression levels of AT1aR mRNA and protein, suggesting that the methylation status of AT1aR promoter is associated with the regulation of the AT1aR gene and is responsible for the development of hypertension.
Conclusions In summary, this study is the first to demonstrate that the vascular expression of AT1aR may be under the strong epigenetic influence by DNA methylation during the development of hypertension in rats, providing a novel insight into the transcriptional regulation of AT1aR in hypertension. However, the details of the underlying molecular mechanisms such as the alterations in the methylation pattern as a result of increased blood pressure still merits further investigation. Acknowledgments This study was supported by grants from the National Natural Science Foundation of China (No. 81200193 and No. 81273507). Conflict of interest
None declared.
References 1. Unger T, Paulis L, Sica DA (2011) Therapeutic perspectives in hypertension: novel means for renin-angiotensin-aldosterone system modulation and emerging device-based approaches. Eur Heart J 32(22):2739–2747 2. Bader M (2010) Tissue renin-angiotensin-aldosterone systems: targets for pharmacological therapy. Annu Rev Pharmacol Toxicol 50:439–465 3. Savoia C, Burger D, Nishigaki N et al (2011) Angiotensin II and the vascular phenotype in hypertension. Expert Rev Mol Med 13:e11 4. Navar LG, Prieto MC, Satou R et al (2011) Intrarenal angiotensin II and its contribution to the genesis of chronic hypertension. Curr Opin Pharmacol 11(2):180–186 5. Dasgupta C, Zhang L (2011) Angiotensin II receptors and drug discovery in cardiovascular disease. Drug Discov Today 16(1–2):22–34 6. Aplin M, Bonde MM, Hansen JL (2009) Molecular determinants of angiotensin II type 1 receptor functional selectivity. J Mol Cell Cardiol 46(1):15–24 7. Higuchi S, Ohtsu H, Suzuki H et al (2007) Angiotensin II signal transduction through the AT1 receptor: novel insights into mechanisms and pathophysiology. Clin Sci (Lond) 112(8):417–428 8. Nguyen Dinh Cat A, Touyz RM (2011) Cell signaling of angiotensin II on vascular tone: novel mechanisms. Curr Hypertens Rep 13(2):122–128 9. Kitami Y, Okura T, Marumoto K et al (1992) Differential gene expression and regulation of type-1 angiotensin II receptor subtypes in the rat. Biochem Biophys Res Commun 188(1):446–452 10. Llorens-Cortes C, Greenberg B, Huang H et al (1994) Tissular expression and regulation of type 1 angiotensin II receptor subtypes by quantitative reverse transcriptase-polymerase chain reaction analysis. Hypertension 24(5):538–548 11. Gasc JM, Shanmugam S, Sibony M et al (1994) Tissue-specific expression of type 1 angiotensin II receptor subtypes. An in situ hybridization study. Hypertension 24(5):531–537 12. Du Y, Guo DF, Inagami T et al (1996) Regulation of ANG IIreceptor subtype and its gene expression in adrenal gland. Am J Physiol 271(2 Pt 2):H440–H446 13. Nguyen Dinh Cat A, Montezano AC, Burger D et al (2013) Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid Redox Signal 19(10):1110–1120 14. Imaizumi S, Miura S, Yahiro E et al (2013) Class- and moleculespecific differential effects of angiotensin II type 1 receptor blockers. Curr Pharm Des 19(17):3002–3008 15. Frey FJ (2005) Methylation of CpG islands: potential relevance for hypertension and kidney diseases. Nephrol Dial Transplant 20(5):868–869 16. Bogdarina I, Welham S, King PJ et al (2007) Epigenetic modification of the renin- angiotensin system in the fetal programming of hypertension. Circ Res 100(4):520–526 17. Friso S, Pizzolo F, Choi SW et al (2008) Epigenetic control of 11 beta- hydroxysteroid dehydrogenase 2 gene promoter is related to human hypertension. Atherosclerosis 199(2):323–327 18. Smolarek I, Wyszko E, Barciszewska AM et al (2010) Global DNA methylation changes in blood of patients with essential hypertension. Med Sci Monit 16(3):CR149–CR155 19. Cho HM, Lee HA, Kim HY et al (2011) Expression of Na?–K?– 2Cl– cotransporter 1 is epigenetically regulated during postnatal development of hypertension. Am J Hypertens 24(12):1286–1293 20. Bellavia A, Urch B, Speck M et al (2013) DNA hypomethylation, ambient particulate matter, and increased blood pressure: findings from controlled human exposure experiments. J Am Heart Assoc 2(3):e000212
123
Mol Cell Biochem 21. Wang X, Falkner B, Zhu H et al (2013) A genome-wide methylation study on essential hypertension in young African American males. PLoS One 8(1):e53938 22. Wang F, Demura M, Cheng Y et al (2014) Dynamic CCAAT/ enhancer binding protein-associated changes of DNA methylation in the angiotensinogen gene. Hypertension 63(2):281–288 23. Meissner A, Mikkelsen TS, Gu H et al (2008) Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454(7205):766–770 24. Jones PA (2012) Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat Rev Genet 13(7):484–492 25. Deaton AM, Bird A (2011) CpG islands and the regulation of transcription. Genes Dev 25(10):1010–1022 26. Maunakea AK, Nagarajan RP, Bilenky M et al (2010) Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466(7303):253–257 27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408 28. Viswanathan M, Tsutsumi K, Correa FM et al (1991) Changes in expression of angiotensin receptor subtypes in the rat aorta during development. Biochem Biophys Res Commun 179(3):1361–1367 29. Millis RM (2011) Epigenetics and hypertension. Curr Hypertens Rep 13(1):21–28
123
30. Pojoga LH, Williams JS, Yao TM et al (2011) Histone demethylase LSD1 deficiency during high-salt diet is associated with enhanced vascular contraction, altered NO-cGMP relaxation pathway, and hypertension. Am J Physiol Heart Circ Physiol 301(5):H1862–H1871 31. Chu CH, Lo JF, Hu WS et al (2012) Histone acetylation is essential for ANG-II-induced IGF-IIR gene expression in H9c2 cardiomyoblast cells and pathologically hypertensive rat heart. J Cell Physiol 227(1):259–268 32. Lee HA, Lee DY, Lee HJ et al (2012) Enrichment of (pro)renin receptor promoter with activating histone codes in the kidneys of spontaneously hypertensive rats. J Renin Angiotensin Aldosterone Syst 13(1):11–18 33. Lee HA, Cho HM, Lee DY et al (2012) Tissue-specific upregulation of angiotensin-converting enzyme 1 in spontaneously hypertensive rats through histone code modifications. Hypertension 59(3):621–626 34. Batkai S, Thum T (2012) MicroRNAs in hypertension: mechanisms and therapeutic targets. Curr Hypertens Rep 14(1):79–87 35. Bird A (2007) Perceptions of epigenetics. Nature 447(7143):396–398 36. Marx V (2012) Epigenetics: reading the second genomic code. Nature 491(7422):143–147
Differential expression and DNA methylation of angiotensin type 1A receptors in vascular tissues during genetic hypertension development Fang Pei • Xinquan Wang • Rongchuan Yue Caiyu Chen • Ji Huang • Jie Huang • Xiaohui Li • Chunyu Zeng
•
Received: 1 September 2014 / Accepted: 27 November 2014 Ó Springer Science+Business Media New York 2015
Abstract Angiotensin type 1a receptor (AT1aR) is thought to play an important role in the development of hypertension. However, it is unknown how the AT1aR expression in vascular tissue is changed during the development of hypertension or if the degree of methylation in the AT1aR promoter correlates with the expression of AT1aR. To address these questions, we measured AT1aR mRNA, protein expression, and methylation status of the AT1aR promoter in the aorta and mesenteric artery of male spontaneously hypertensive rats (SHRs) and age-matched Wistar-Kyoto (WKY) rats acting as controls at pre-hypertensive (4 weeks), evolving (10 weeks), and established (20 weeks) stages of hypertension. The expression of the AT1aR mRNA and protein was not different between the SHRs and WKY rats at 4 weeks. However, they were significantly greater in SHRs than in WKY rats at 20 weeks. Bisulfite sequencing revealed that the AT1aR promoter from the aorta and mesenteric artery of the SHRs was progressively hypo-methylated with age as compared Fang Pei and Xinquan Wang have contributed equally to this work. F. Pei X. Li (&) Institute of Materia Medica and Department of Pharmaceutics, College of Pharmacy, Third Military Medical University, 30 Gaotanyan, Shapingba District, Chongqing 400038, China e-mail: [email protected] F. Pei X. Wang R. Yue C. Chen C. Zeng (&) Department of Cardiology, Daping Hospital, Third Military Medical University, 10 Changjiang Branch Rd, Yuzhong District, Chongqing 400042, China e-mail: [email protected] F. Pei J. Huang J. Huang Department of Cardiology, Chongqing Corps Hospital of Chinese People’s Armed Police Force, No. 90, Marbles Shi Weiguo Road, Nanan District, Chongqing 400061, China
with their WKY rat counterparts. These results suggest that the heightened AT1aR expression in SHRs is related to the AT1aR promoter hypo-methylation, which might be a consequence of the increased blood pressure and may be important in the maintenance of high blood pressure. Keywords Hypertension AT1 receptor DNA methylation Artery SHRs
Introduction For the last 3 decades, studies have established that the renin-angiotensin-aldosterone system (RAAS) plays a critical role in the development and establishment of the hypertensive state in humans and animal hypertension models such as the spontaneously hypertensive rat (SHR) [1, 2]. Angiotensin II (Ang II), the key effector of RAAS, has an important role in the control of blood pressure and fluid volume [3, 4]. Two 7-transmembrane Ang II receptor subtypes have so far been identified in humans: angiotensin type 1 receptor (AT1R) and angiotensin type 2 receptor (AT2R) [5]. To date, AT1R has been shown to mediate most of the physiological actions of Ang II and is predominant in the control of Ang II-induced vascular functions [6–8]. In rodents, the AT1R exists as 2 distinct subtypes, termed AT1aR and AT1bR, which is 95 % identical in their amino acid sequences [9]. The AT1aR is predominantly expressed in all tissues except the adrenal and pituitary glands where it is the AT1bR that is predominant [10–12]. The AT1aR is abundantly expressed in vascular smooth muscle cells, and its activation by Ang II results in elevated levels of intracellular calcium, generation of reactive oxygen species (ROS), and vasoconstriction, proliferation, and hypertrophy of vascular smooth
123
Mol Cell Biochem
cells [8, 13]. Ang II therefore acts to increase vascular pressure, and accordingly AT1aR antagonists have proven to be highly effective in reversing the hypertension [14]. More and more evidence suggest the importance of AT1aR in the hypertension in SHRs but little is known regarding the expression of the AT1aR in the vasculature at different developmental stages of hypertension. In addition, the mechanism of this overexpression of the AT1aR in SHR remains undetermined. DNA methylation has been implicated in the development and progression of hypertension [15–22]. DNA methylation is a stable epigenetic modification that consists of the covalent binding of a methyl group to the 50 carbon of cytosine mostly occurring at CpG dinucleotide sequences in the mammalian genome [23, 24]. The CpG-rich regions are called CpG islands and are usually located in or near the promoters [25]. Methylation of CpGs in the promoter region has the potential of silencing gene expression. On the contrary, DNA demethylation is generally associated with gene reactivation [26]. In rodents, the AT1aR gene contains a number of CG dinucleotides. Our analysis of the AT1aR gene using MethPrimer software (http://www.urogene.org/methpri mer/indexl.html) revealed two CpG island (?35 to ?161 and ?257 to ?374) in the AT1aR promoter region, suggesting that the regulation of the AT1aR gene expression might be highly related to the methylation status of the CpG islands. Taken together, the main purpose of the present study was to evaluate the mRNA and protein expressions of the AT1aR in the aorta and mesenteric artery at different developmental stages of hypertension, and to investigate whether local AT1aR expression is correlated to the DNA methylation status of the AT1aR promoter during the development of hypertension.
(MBP) in conscious SHRs and WKY rats were performed using a tail-cuff system (ML125, PowerLab, AD Instruments, Castle Hill, Australia) according to the supplier’s protocol. Tissue preparation Male SHRs and age-matched WKY rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and euthanized by exsanguination. The thoracic aorta and superior mesenteric artery were collected and kept at -80 °C until further analysis. RNA extraction and quantitative real-time RT-PCR RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendations. RNA purity and quality were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Beijing, China). The cDNA was prepared from 1ug of total RNA using SuperScript III enzyme (Invitrogen) and random nanomer primers. Quantitative real-time PCR was performed using SYBR Premix Ex Taq (DRR041A; TaKaRa, Tokyo, Japan) and analyzed using an iQ Lightcycler instrument (Bio-Rad). The PCR cycle settings were 95 °C for 30 s, followed by 40 cycles at 95 °C for 10 s, 58 °C for 20 s, and 72 °C for 40 s. Melting curves of the products were obtained after cycling by a stepwise increase of temperature from 65 to 95 °C. The relative mRNA expression level was determined by calculating the values of D cycle threshold (DCt) by normalizing the average Ct value compared with its endogenous control (GAPDH) and then calculating 2-DDCt [27]. All primer sets used in the performance of real-time PCR are shown in Table 1.
Materials and methods
Protein extraction and western blot
Animals
Protein was extracted by homogenizing the aorta and mesenteric artery with radio-immuno-protection assay (RIPA) buffer containing 0.1 % PMSF (Beyotime, China). Protein concentration was measured using the bicinchoninic acid method (Beyotime, China). Equal amount of proteins (35 lg) was separated using SDS–PAGE (9 %) and transferred to nitrocellulose membranes (NC) using semi-dry transblotters (BioRad, Hercules, CA, USA). The reactions to non-specific proteins on the NC membranes were blocked using 5 % skim milk in TBS (25 mM Tris base and 150 mM NaCl) for 2 h at room temperature. The target proteins were then incubated with the primary antibodies against AT1R (PA5-20812, 1:800; Thermo Scientific, Waltham, MA, USA) or GAPDH (AP7873b, 1:600; Abgent, San Diego, CA, USA) overnight at 4 °C. The membranes were washed twice for 10 min each with 0.1 %
Male SHRs and age-matched WKY rats at three different postnatal ages corresponding to the pre-hypertensive (4 weeks), evolving (10 weeks), and established (20 weeks) stages of hypertension were purchased from SLRC Laboratory Animals (Shanghai, China). The study was conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the experimental protocol was approved by the Third Military Medical University Animal Use and Care Committee. Blood pressure measurement Measurements of systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean arterial blood pressure
123
Mol Cell Biochem Table 1 List of primers used for quantitative real-time PCR
Table 2 List of primers used for bisulfite sequencing PCR of AT1aR promoter
Parameter
Primers (50 –30 )
Tm (°C)
Amplicon size (bp)
AT1aR
F: ATTCGTGGCTTGAGTCCTGT
58
105
(NM_030985.4)
R: GTTAACTCAGGGAATGTGGCA
GAPDH
F: CCATTCTTCCACCTTTGATGCT
58
98
(NM_017008)
R: TGTTGCTGTAGCCATATTCATTGT
Parameter CpG island I
Primers (50 –30 )
Tm (°C)
Amplicon size (bp)
F: TTTAGGTAGTTGGGAGGGATTG
55
224
55
288
R: AAATTCAAATATAATAACAAAAAACC CpG island II
F: TATTTTTTGGTGAGTTTTAGTTTAGG R: ACCTCCCCATTTCTATAAAATTCTAC
Tween phosphate buffer solution (PBST) then incubated with goat anti-rabbit Alexa Fluor 680 CW (1:1,0000 dilution) in secondary dilution buffer (5 ml of blocking buffer and 5 ml of 1 9 PBS ? 0.4 % Tween-20) for 2 h at room temperature. Washes were performed twice after secondary labeling, for 10 min in PBST, and then placed in doubledistilled water. Images were acquired using the Odyssey infrared imaging system (Li-Cor; Lincoln, NE, USA) and analyzed by the proprietary software. GAPDH was used as the endogenous reference protein for normalization. The ratio of AT1R/GAPDH was used for semi-quantification and comparison between the groups. DNA bisulfite modification and sequencing Genomic DNA was isolated using DNAsol reagent (Tiangen Biotech, Beijing, China) and (0.5 mg) was subjected to bisulfate treatment using EZ DNA Methylation-Gold Kit TM (ZYMO Research, Orange, CA, USA) according to the manufacturer’s recommendations. PCR on the two CpG island (?35 to ?161 and ?257 to ?374) of the AT1aR promoter region was then performed. PCR cycle conditions used included: 95 °C for 5 min, then 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, and finally one cycle of 7 min for 72 °C. The reaction mixture contained 10 9 PCR buffer, 0.2 mmol/L dNTPs, 2 mmol/L MgCl2, 10 lmol/L primers, 0.5 U of hot start Taq polymerase (Takara, Tokyo, Japan), and 4 ll DNA template. PCR products were separated using 3 % agarose gels, and bands were excised using the QIAquick Gel Extraction kit (Qiagen, Germantown, MD, USA). Purified bands were cloned into a pGEM-T vector (Promega, Madison, WI, USA). Ten clones from each sample were sequenced. Primer set used in bisulfate modified PCR is shown in Table 2.
Statistical analysis Quantitative data are expressed as mean ± the standard deviation (SD) and were analyzed for statistical significance by one-way ANOVA or Student’s t test as appropriate. A two-sided P value \0.05 was considered statistically significant.
Results Parameters of experimental animals SBP, DBP, and MBP were higher in the SHRs than WKY rats even at the age of 4 weeks, and continued to be significantly greater in the SHRs as compared to WKY rats at both succeeding stages of evolving (10-week-old) and established (20-week-old) hypertension. The results are shown in Table 3. Expression levels of AT1aR in aorta and mesenteric artery from WKY and SHRs In order to confirm whether the levels of AT1aR protein are different between WKY and SHRs during conditions of increased blood pressure, we performed immunoblotting using the aorta and mesenteric artery from 4-, 10-, and 20-week-old WKYs and SHRs. As shown in Fig. 1A, B, the AT1aR protein levels of these vessels tended to gradually increase with age in both strains but greatly increased with age in the SHRs. No significant differences were found in the AT1aR protein levels between the strains at the initial pre-hypertensive (4-week-old) stage. At the evolving (10-week-old) stage of hypertension, the AT1aR
123
Mol Cell Biochem Table 3 Body weight, heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean BP (MBP) in WKY and SHR at different ages 4 weeks WKY (n = 6)
10 weeks SHR (n = 6)
20 weeks
WKY (n = 6)
SHR (n = 6)
WKY (n = 6)
SHR (n = 6)
Weight (g)
44.2 ± 6.9
33.6 ± 7.5
237.3 ± 10.1
215.9 ± 9.0
335.2 ± 8.1
316.4 ± 7.8
HR (bpm)
362.7 ± 12.8
388.5 ± 11.9
348.1 ± 11.4
365.4 ± 12.3
358.2 ± 10.7
382.3 ± 13.1
SBP (mmHg) DBP (mmHg)
115.3 ± 5.2 75.6 ± 4.4
124.6 ± 4.5** 83.2 ± 3.7**
125.7 ± 5.3 78.9 ± 4.8
175.9 ± 6.8** 132.1 ± 5.1**
134.8 ± 5.8 85.6 ± 4.3
212.5 ± 4.9** 149.2 ± 5.7**
MBP (mmHg)
87.5 ± 3.7
96.1 ± 4.9**
90.3 ± 3.1
146.7 ± 4.3**
97.2 ± 3.5
162.2 ± 4.1**
** P \ 0.01 versus WKY Fig. 1 Differential expression of AT1aR protein and mRNA in the arteries from both WKY and SHRs. Representative blots and density graphs show the expression levels of AT1aR protein in aorta (A), mesenteric artery (B) from WKY and SHRs. AT1aR protein expression was determined by immunoblotting. AT1aR mRNA expression in aorta (C), mesenteric artery (D) from WKY and SHRs was determined by quantitative realtime PCR. **P \ 0.01 versus age-matched WKY
protein levels tended to be higher in SHRs as compared to WKY rats but did not reach statistical significance. However, the AT1aR protein levels in the aorta and mesenteric artery were markedly increased in the SHRs as compared to WKY rats at the established (20-week-old) stage of hypertension. As shown in Fig. 1C, D, the AT1aR mRNA expression in the aorta and mesenteric artery also tended to gradually
123
increase with age in both strains, though more so in the SHRs. Furthermore, the trend of the increase of the AT1aR mRNA in both strains at different stages of hypertension was very similar to that of AT1aR protein. At the age of 4 weeks, the AT1aR mRNA tended to be lower in the SHRs compared to the WKY rats though it did not reach statistical significance. The AT1aR mRNA further tended to be higher in SHRs at the evolving (10-week-old) stage of
Mol Cell Biochem
hypertension, with the greatest difference occurring at the established (20-week-old) stage of hypertension. These results indicate that the vascular AT1aR protein expression is in parallel with the tendency of the increase as seen in the vascular AT1aR mRNA and is mainly controlled at the transcription level. Comparison of DNA methylation status of AT1aR promoter in WKY and SHRs In order to investigate the status of the AT1aR promoter methylation, we examined the methylation levels of the two CpG islands located in the AT1aR promoter using bisulfite sequencing from the aorta and mesenteric artery of WKYs and SHRs (Fig. 2A). As shown in Fig. 2B–I, the DNA methylation status of the two CpG islands in both the aorta (Fig. 2B–D) and mesenteric artery (Fig. 2F–H) of SHRs displayed age-related progressive hypomethylation. As for the WKY rats, the methylation levels of the CpG island I tended to become gradually hypermethylated with age in both vascular vessels tested (Fig. 2B, C, F, G), whereas the methylation levels of CpG island II showed progressive hypomethylation with increasing age in both the aorta (Fig. 2B, D) and mesenteric artery (Fig. 2F, H). In addition, the average total methylation rate of the AT1aR gene promoter in both the aorta and mesenteric artery of SHRs was significantly hypomethylated with age as compared with those from WKY rats (Fig. 2E, I). Compared with agematched WKY rats, the AT1aR promoter in 4-week-old SHRs showed a slightly higher level of methylation, whereas the 10-week-old SHRs showed a slightly lower methylation level of the AT1aR promoter. At 20 weeks, the SHRs exhibited considerably lower total rate of AT1aR promoter methylation than that seen in WKY rats.
Discussion In this study, we attempted to determine the correlation between the expression of vascular AT1aR and AT1aR gene promoter methylation during the development of hypertension. The results demonstrate for the first time the differential mRNA and protein expressions of the AT1aR in the aorta and mesenteric artery of SHRs as compared with age-matched normotensive WKY rats. The expression of AT1aR mRNA and protein in the vasculature is well correlated with the DNA methylation levels in the AT1aR promoter during postnatal development of hypertension. In order to elucidate the changes that occur to the vascular AT1aR in the development of hypertension, we assessed the mRNA and protein expression of AT1aR in the aorta and mesenteric artery of male SHRs and agematched WKY rats at pre-hypertensive (4-week-old),
evolving (10-week-old), and established (20-week-old) stages of hypertension. With regards to the age-dependent changes, the AT1aR mRNA and protein levels of the aorta and mesenteric artery tended to increase with age in both strains. These increases in the AT1aR expression are comparable with a previous developmental study regarding changes in the expression of angiotensin receptor subtypes in the rat aorta [28]. Therefore, the AT1aR appears to be necessary for vascular smooth muscle cell normal development and during the pathological processes. When the possible differences of AT1aR expression between SHRs and WKY rats were compared, no differences were detected in the AT1aR mRNA and protein levels at the prehypertensive (4-week-old) and evolving (10-week-old) stages of hypertension, though there was a tendency of lower AT1aR mRNA and protein levels in the 10-week-old WKY rats. The AT1aR mRNA and protein levels in the aorta and mesenteric artery were markedly increased in SHRs as compared to the WKY rats at the established (20week-old) stage of hypertension. In 4-week-old (prehypertensive) and 10-week-old (evolving stage) SHRs, the blood pressure was higher than those found in the agematched WKY rats, though the expression of AT1aR mRNA and protein levels was not different between both strains. Therefore, it is unlikely that the increase in AT1aR mRNA and protein levels is related to the cause of hypertension. Hence, the increase in the AT1aR expression in 20-week-old SHRs might be more of a consequence of the increased blood pressure and may therefore be necessary to the maintenance of the high blood pressure. Although in previous as well as in our present findings, we demonstrated that the AT1aR is overexpressed in the established stage of hypertension and is considered to be one of the factors contributing to the pathogenesis of hypertension. However, the regulation of the AT1aR expression during the development of hypertension needs to be further elucidated. Recently, increasing evidence from human and animal studies indicates that epigenetic changes may play a significant role in the pathogenesis of hypertension [15–22, 29–34]. Epigenetic changes are defined as heritable alterations in gene expression patterns that do not change the DNA sequences [35, 36]. Among the epigenetic changes, the DNA methylation of cytosine residues in the regulatory CpG islands of genes is the most intensely investigated mechanisms and plays a vital role in the regulation of gene expression [24–26]. DNA hypermethylation is a hallmark of gene silencing, while DNA hypomethylation promotes active transcription [24, 25]. In our study, we used the MethPrimer software to predict the CpG island in the promoter regions 50 untranslated regions (50 UTRs), exons, introns, 30 UTRs, and two thousand base pairs of the AT1aR promoter. Two CpG islands were found in the promoter region of the AT1aR, suggesting that its cytosine methylation status might contribute to the epigenetic control
123
Mol Cell Biochem
123
Mol Cell Biochem b Fig. 2 Comparison of DNA methylation status of the AT1aR
promoter in the arteries of WKY and SHRs. A Diagram of two CpG islands in the promoter region of the AT1aR gene. Underlined is the bisulfite sequencing region. ?1: transcriptional start site. B DNA methylation status of two CpG islands in the promoter region of the AT1aR gene in the aorta from WKY or SHRs. Open and closed circles denote un-methylated and methylated CpGs, respectively. Twelve clones for each aorta or mesenteric artery were subjected to sequencing. C Percentage of methylated CpG loci in CpG island I of AT1aR promoter in the aorta from WKY or SHRs. D Percentage of methylated CpG loci in CpG island II of AT1aR promoter in the aorta from WKY or SHRs. E The average total percentage of methylated CpG loci in two CpG islands of AT1aR promoter in the aorta of WKY or SHRs. F DNA methylation status of two CpG islands in the promoter region of the AT1aR gene in the mesenteric artery from WKY or SHRs. G Percentage of methylated CpG loci in CpG island I of AT1aR promoter in the mesenteric artery from WKY or SHRs. H Percentage of methylated CpG loci in CpG island II of AT1aR promoter in the mesenteric artery from WKY or SHRs. I The average total percentage of methylated CpG loci in two CpG islands of AT1aR promoter in the mesenteric artery from WKY or SHRs. *P \ 0.05 versus age-matched WKY rats, **P \ 0.01 versus agematched WKY rats, ***P \ 0.001 versus age-matched WKY rats
of AT1aR gene transcription. Bisulfite sequencing revealed that the promoter region of AT1aR was largely methylated in both WKY and SHRs at 4 weeks of age. However, the AT1aR promoter from the aorta and mesenteric artery of the SHRs became hypomethylated with age as compared with those from age-matched WKY rats, especially at the established (20-week-old) stage of hypertension. These results suggest that both age and blood pressure affect CpG methylation in the promoter region of the AT1aR, and that the increasing blood pressure suppresses CpG methylation in the promoter. These data are in accordance with the expression levels of AT1aR mRNA and protein, suggesting that the methylation status of AT1aR promoter is associated with the regulation of the AT1aR gene and is responsible for the development of hypertension.
Conclusions In summary, this study is the first to demonstrate that the vascular expression of AT1aR may be under the strong epigenetic influence by DNA methylation during the development of hypertension in rats, providing a novel insight into the transcriptional regulation of AT1aR in hypertension. However, the details of the underlying molecular mechanisms such as the alterations in the methylation pattern as a result of increased blood pressure still merits further investigation. Acknowledgments This study was supported by grants from the National Natural Science Foundation of China (No. 81200193 and No. 81273507). Conflict of interest
None declared.
References 1. Unger T, Paulis L, Sica DA (2011) Therapeutic perspectives in hypertension: novel means for renin-angiotensin-aldosterone system modulation and emerging device-based approaches. Eur Heart J 32(22):2739–2747 2. Bader M (2010) Tissue renin-angiotensin-aldosterone systems: targets for pharmacological therapy. Annu Rev Pharmacol Toxicol 50:439–465 3. Savoia C, Burger D, Nishigaki N et al (2011) Angiotensin II and the vascular phenotype in hypertension. Expert Rev Mol Med 13:e11 4. Navar LG, Prieto MC, Satou R et al (2011) Intrarenal angiotensin II and its contribution to the genesis of chronic hypertension. Curr Opin Pharmacol 11(2):180–186 5. Dasgupta C, Zhang L (2011) Angiotensin II receptors and drug discovery in cardiovascular disease. Drug Discov Today 16(1–2):22–34 6. Aplin M, Bonde MM, Hansen JL (2009) Molecular determinants of angiotensin II type 1 receptor functional selectivity. J Mol Cell Cardiol 46(1):15–24 7. Higuchi S, Ohtsu H, Suzuki H et al (2007) Angiotensin II signal transduction through the AT1 receptor: novel insights into mechanisms and pathophysiology. Clin Sci (Lond) 112(8):417–428 8. Nguyen Dinh Cat A, Touyz RM (2011) Cell signaling of angiotensin II on vascular tone: novel mechanisms. Curr Hypertens Rep 13(2):122–128 9. Kitami Y, Okura T, Marumoto K et al (1992) Differential gene expression and regulation of type-1 angiotensin II receptor subtypes in the rat. Biochem Biophys Res Commun 188(1):446–452 10. Llorens-Cortes C, Greenberg B, Huang H et al (1994) Tissular expression and regulation of type 1 angiotensin II receptor subtypes by quantitative reverse transcriptase-polymerase chain reaction analysis. Hypertension 24(5):538–548 11. Gasc JM, Shanmugam S, Sibony M et al (1994) Tissue-specific expression of type 1 angiotensin II receptor subtypes. An in situ hybridization study. Hypertension 24(5):531–537 12. Du Y, Guo DF, Inagami T et al (1996) Regulation of ANG IIreceptor subtype and its gene expression in adrenal gland. Am J Physiol 271(2 Pt 2):H440–H446 13. Nguyen Dinh Cat A, Montezano AC, Burger D et al (2013) Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid Redox Signal 19(10):1110–1120 14. Imaizumi S, Miura S, Yahiro E et al (2013) Class- and moleculespecific differential effects of angiotensin II type 1 receptor blockers. Curr Pharm Des 19(17):3002–3008 15. Frey FJ (2005) Methylation of CpG islands: potential relevance for hypertension and kidney diseases. Nephrol Dial Transplant 20(5):868–869 16. Bogdarina I, Welham S, King PJ et al (2007) Epigenetic modification of the renin- angiotensin system in the fetal programming of hypertension. Circ Res 100(4):520–526 17. Friso S, Pizzolo F, Choi SW et al (2008) Epigenetic control of 11 beta- hydroxysteroid dehydrogenase 2 gene promoter is related to human hypertension. Atherosclerosis 199(2):323–327 18. Smolarek I, Wyszko E, Barciszewska AM et al (2010) Global DNA methylation changes in blood of patients with essential hypertension. Med Sci Monit 16(3):CR149–CR155 19. Cho HM, Lee HA, Kim HY et al (2011) Expression of Na?–K?– 2Cl– cotransporter 1 is epigenetically regulated during postnatal development of hypertension. Am J Hypertens 24(12):1286–1293 20. Bellavia A, Urch B, Speck M et al (2013) DNA hypomethylation, ambient particulate matter, and increased blood pressure: findings from controlled human exposure experiments. J Am Heart Assoc 2(3):e000212
123
Mol Cell Biochem 21. Wang X, Falkner B, Zhu H et al (2013) A genome-wide methylation study on essential hypertension in young African American males. PLoS One 8(1):e53938 22. Wang F, Demura M, Cheng Y et al (2014) Dynamic CCAAT/ enhancer binding protein-associated changes of DNA methylation in the angiotensinogen gene. Hypertension 63(2):281–288 23. Meissner A, Mikkelsen TS, Gu H et al (2008) Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454(7205):766–770 24. Jones PA (2012) Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat Rev Genet 13(7):484–492 25. Deaton AM, Bird A (2011) CpG islands and the regulation of transcription. Genes Dev 25(10):1010–1022 26. Maunakea AK, Nagarajan RP, Bilenky M et al (2010) Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466(7303):253–257 27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408 28. Viswanathan M, Tsutsumi K, Correa FM et al (1991) Changes in expression of angiotensin receptor subtypes in the rat aorta during development. Biochem Biophys Res Commun 179(3):1361–1367 29. Millis RM (2011) Epigenetics and hypertension. Curr Hypertens Rep 13(1):21–28
123
30. Pojoga LH, Williams JS, Yao TM et al (2011) Histone demethylase LSD1 deficiency during high-salt diet is associated with enhanced vascular contraction, altered NO-cGMP relaxation pathway, and hypertension. Am J Physiol Heart Circ Physiol 301(5):H1862–H1871 31. Chu CH, Lo JF, Hu WS et al (2012) Histone acetylation is essential for ANG-II-induced IGF-IIR gene expression in H9c2 cardiomyoblast cells and pathologically hypertensive rat heart. J Cell Physiol 227(1):259–268 32. Lee HA, Lee DY, Lee HJ et al (2012) Enrichment of (pro)renin receptor promoter with activating histone codes in the kidneys of spontaneously hypertensive rats. J Renin Angiotensin Aldosterone Syst 13(1):11–18 33. Lee HA, Cho HM, Lee DY et al (2012) Tissue-specific upregulation of angiotensin-converting enzyme 1 in spontaneously hypertensive rats through histone code modifications. Hypertension 59(3):621–626 34. Batkai S, Thum T (2012) MicroRNAs in hypertension: mechanisms and therapeutic targets. Curr Hypertens Rep 14(1):79–87 35. Bird A (2007) Perceptions of epigenetics. Nature 447(7143):396–398 36. Marx V (2012) Epigenetics: reading the second genomic code. Nature 491(7422):143–147
