Q J Med 2014; 107:1001–1007 doi:10.1093/qjmed/hcu130 Advance Access Publication 17 June 2014
Diagnostic value of MUC1 and EpCAM mRNA as tumor markers in differentiating benign from malignant pleural effusion W. SUN1, J. LI1, H.-G. JIANG1, L.-P. GE1 and Y. WANG2 From the 1Department of Pulmonary Medicine and 2Center of Experimental Medicine, Affiliated Hospital of Jiangsu University, 438 North Jiefang Street, Zhenjiang 212001, China Address correspondence to Prof. J. Li, Department of Pulmonary Medicine, Affiliated Hospital of Jiangsu University, 438 North Jiefang Street, Zhenjiang 212001, China. email: [email protected] Received 16 April 2014 and in revised form 21 May 2014
Summary (ROC) curves were constructed to assess diagnostic performance of the four tumor markers in PE. Results: For the diagnosis of malignant PE, MUC1 and EpCAM mRNA had larger area under ROC curves (0.916 and 0.922) and higher sensitivity (67.2 and 70.7%) with the same specificity, when compared with CEA and Cyfra21-1 (0.821 and 0.780; 48.3 and 44.8%, respectively). By combining cytology with MUC and EpCAM, a positive result indicating the presence of malignancy was achieved in 87.9%, with a good specificity of 95%. Conclusions: Compared with CEA and Cyfra21-1, the performance of MUC1 and EpCAM mRNA in malignant PE diagnosis was better. MUC1 and EpCAM mRNA in combination with cytology is a highly sensitive and specific diagnostic tool for detecting malignancy in PE.
Introduction
by conventional cytology is hampered by the problem of differentiating malignant cells from reactive mesothelial cells, cytology examination only identify tumor cells in 40% of malignant PE.6 Blind needle pleural biopsy confers little additive diagnostic value for false-negative cytology,2 while ultrasound guided pleural biopsy can improve the diagnostic yield.7 To further improve the diagnosis of malignant PE, many studies have investigated the use of different tumor markers in pleural fluid, the best known of which are carcinoembryonic antigen (CEA) and Cyfra21-1, with diagnostic accuracy
Malignancy is the most common cause of exudative pleural effusion (PE) and the majority of malignant PEs are due to metastatic disease.1,2 Differentiation between malignant and benign PE has particular clinical relevance,3,4 and more than half of the patients with malignant PE died within 6 months of the diagnosis of PE.5 Early diagnosis and management of malignant PE may improve outcomes. The detection of tumor cells in PE is essential to establish a diagnosis. However, the detection of malignancy in PE
! The Author 2014. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: [email protected]
Downloaded from by guest on September 12, 2015
Background: The sensitivity of conventional cytology for the detection of tumor cells in pleural effusion (PE) is inadequate. Mucine 1 (MUC1) and epithelial cell adhesion molecule (EpCAM) are two frequently and intensely expressed tumor-associated antigens in malignancies of epithelial origin. Objective: To evaluate the diagnostic value of pleural fluid MUC1 and EpCAM mRNA in differentiating benign and malignant PE. Method: Fifty-eight patients with malignant PE and 40 patients with benign PE were included in this study. Pleural fluid MUC1 and EpCAM mRNA levels were measured by quantitative real-time PCR. Carcinoembryonic antigen (CEA) and cytokeratin 19 fragment (Cyfra21-1) were also detected simultaneously. The receiver operating characteristic
1002
W. Sun et al.
Method Study population From July 2011 to December 2013, 98 patients with PE who admitted to our hospital were enrolled in the study. The subjects included 60 men and 38
women, and had a mean age of 61 years. Malignant PEs were presented in 58 patients (59%), while PEs were benign in 40 patients (41%). All PEs had definite etiology documented by physical examination, chest radiology, pleural fluid biochemistry, microbiology and cytology analyses, pleural biopsy, percutaneous needle biopsy or endoscopy biopsy. When initial thoracentesis and cytology were non-diagnostic for suspected malignant PE, repeated thoracenteses and cytology or pleural biopsy were pursued as clinical dictated. All patients with ‘suspicious’ pleural fluid cytology were defined as cytologic negativity. Malignant PEs were diagnosed by either pleural fluid cytology positivity or malignant cells identified in a pleural biopsy specimen. The study was proved by the Ethics Committee of the Affiliated Hospital of Jiangsu University and written informed consent was obtained from all participants.
Specimen processing Pleural fluids were collected by diagnostic thoracentesis before the patients received any therapy. Each fluid specimen was centrifuged in 50-ml tubes at 1500 rpm for 10 min at 48C, Then, cell pellets were pooled together, washed once and centrifuged again at 1500 rpm for 10 min at 48C. The cell pellets were stored at 808C until use. Meanwhile, PE specimens were taken to the clinical laboratory for routine biochemical tests and carcinoembrgynic antigen (CEA) and cytokeratin 19 fragment (Cyfra211) assay, and pathologic department for cytology examination.
Quantitative real-time PCR Total RNA was extracted from the cell pellets using TRIZOL Reagent (Invitrogen, Carslbad, CA) following the manufacturer’s instructions. The RNA concentration was measured by UV absorption at 260 and 28 nm. The A260/A280 ratio was calculated to assess RNA quality and purity. First-strand cDNA was produced from total RNA by using an RNA PCR Kit version 3.0 (TakaRa Bio Inc., Tokyo, Japan), according to manufacturer’s instructions. QRT-PCR of the target MUC1 and EpCAM mRNA and b-actin as internal control was performed on an ABI 7500 thermal cycler real-time PCR system (Applied Biosystems, Foster City, CA), using the SYBR-Green I Chemistry. Amplification primers of the two genes were synthesized by Shanghai Invitrogen Biotechnology Co, Ltd, in China. The primer sequences, annealing temperatures and expected length of synthesis fragment were shown in Table 1. The cycling conditions were as follows: a denaturation step at 958C for 30 s,
Downloaded from by guest on September 12, 2015
higher than that of other tumor markers.8–15 However, false-positive results of the two tumor markers may weaken their diagnostic value16; thus, there is no consensus of these results with regard to which markers are most effective at differentiating malignant from benign PE. Mucine 1 (MUC1) is a cell surface glycoprotein and expressed at a based level by normal ductal epithelial cells of secretory organs.17 As a tumorassociated antigen, MUC1 is overexpressed on various carcinomas of epithelial origin, including lung, breast, ovary and colon cancer.18 Studies have demonstrated that an elevated level of MUC1 protein plays a role in tumor progression, especially in the process of metastasis.19 Epithelial cell adhesion molecule (EpCAM) is also a transmembrane glycoprotein that is expressed on the basolateral surface of most normal epithelial tissue.20 Likewise, EpCAM can now be considered to be one of the most frequently and most intensely expressed tumorassociated antigens known. It is overexpressed to varying digress in most human carcinomas.20,21 The diagnostic and prognostic characteristics of EpCAM have been reported by many investigators.20–22 Recently, we have used quantitative real-time PCR (QRT-PCR) method to detect the expression of MUC1 and EpCAM mRNA in peripheral blood of patients with non-small cell lung cancer (NSCLC) and have demonstrated that blood MUC1 and EpCAM mRNA are predictive and prognostic markers in NSCLC patients who undergo curative surgery.23 MUC1 and EpCAM are considered as two oncogenes and involved in intercellular adhesion, proliferation, survival, carcinogenesis and metastasis formation.19-23 Because MUC1 and EpCAM genes are thought to be restricted to epithelial cells, they have been used for the detection of micrometastatic tumor cell in blood, bone marrow and lymph node of patients with numerous solid tumors.23–27 However, relatively few studies have been undertaken to investigate the diagnostic utility of pleural fluid MUC1 and EpCAM mRNA in patients with malignant PE.28,29 In this study, we evaluated the efficiency of pleural fluid MUC1 and EpCAM mRNA QRT-PCR assay in identification of the origin of PE and examined these test as potentially useful in assisting the diagnosis of malignant PE.
Pleural fluid MUC1 and EpCAM mRNA Table 1 Sequences and features of the primers used for QRT-PCR mRNA
Primer sequence (50 -30 )
Annealing temperature
Length (bp)
MUC1
AATGAATGGCTCAAAACTTGG CAGTAGGTTCTCACTCGCTCAG AGTTGTTAGGGTTCTGGTCAT GCTCTTGGTAGTCGGTGCT TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG
568C
203
588C
213
608C
205
EpCAM b-actin
Statistical analysis Statistical analysis was performed with SPSS software 13.0 (SPSS Inc., Chicago, IL). Data were expressed as the median (min–max) for each tumor marker because of its non-normally distributed variable. Comparisons between groups used the MannWhitney’s U-test for continuous variable, and the Fisher’s exact test for categorical variable. The correlation between the presence of malignancy and all variable was determined by logistic regression. The diagnostic performance of each tumor marker to distinguish malignant from benign PE was evaluated with the receiver operating characteristic (ROC) curve analysis. According to the optimum cutoff point provided by ROC curve analysis, sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and accuracy were calculated. Statistical significance was defined by a P value
Diagnostic value of MUC1 and EpCAM mRNA as tumor markers in differentiating benign from malignant pleural effusion W. SUN1, J. LI1, H.-G. JIANG1, L.-P. GE1 and Y. WANG2 From the 1Department of Pulmonary Medicine and 2Center of Experimental Medicine, Affiliated Hospital of Jiangsu University, 438 North Jiefang Street, Zhenjiang 212001, China Address correspondence to Prof. J. Li, Department of Pulmonary Medicine, Affiliated Hospital of Jiangsu University, 438 North Jiefang Street, Zhenjiang 212001, China. email: [email protected] Received 16 April 2014 and in revised form 21 May 2014
Summary (ROC) curves were constructed to assess diagnostic performance of the four tumor markers in PE. Results: For the diagnosis of malignant PE, MUC1 and EpCAM mRNA had larger area under ROC curves (0.916 and 0.922) and higher sensitivity (67.2 and 70.7%) with the same specificity, when compared with CEA and Cyfra21-1 (0.821 and 0.780; 48.3 and 44.8%, respectively). By combining cytology with MUC and EpCAM, a positive result indicating the presence of malignancy was achieved in 87.9%, with a good specificity of 95%. Conclusions: Compared with CEA and Cyfra21-1, the performance of MUC1 and EpCAM mRNA in malignant PE diagnosis was better. MUC1 and EpCAM mRNA in combination with cytology is a highly sensitive and specific diagnostic tool for detecting malignancy in PE.
Introduction
by conventional cytology is hampered by the problem of differentiating malignant cells from reactive mesothelial cells, cytology examination only identify tumor cells in 40% of malignant PE.6 Blind needle pleural biopsy confers little additive diagnostic value for false-negative cytology,2 while ultrasound guided pleural biopsy can improve the diagnostic yield.7 To further improve the diagnosis of malignant PE, many studies have investigated the use of different tumor markers in pleural fluid, the best known of which are carcinoembryonic antigen (CEA) and Cyfra21-1, with diagnostic accuracy
Malignancy is the most common cause of exudative pleural effusion (PE) and the majority of malignant PEs are due to metastatic disease.1,2 Differentiation between malignant and benign PE has particular clinical relevance,3,4 and more than half of the patients with malignant PE died within 6 months of the diagnosis of PE.5 Early diagnosis and management of malignant PE may improve outcomes. The detection of tumor cells in PE is essential to establish a diagnosis. However, the detection of malignancy in PE
! The Author 2014. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: [email protected]
Downloaded from by guest on September 12, 2015
Background: The sensitivity of conventional cytology for the detection of tumor cells in pleural effusion (PE) is inadequate. Mucine 1 (MUC1) and epithelial cell adhesion molecule (EpCAM) are two frequently and intensely expressed tumor-associated antigens in malignancies of epithelial origin. Objective: To evaluate the diagnostic value of pleural fluid MUC1 and EpCAM mRNA in differentiating benign and malignant PE. Method: Fifty-eight patients with malignant PE and 40 patients with benign PE were included in this study. Pleural fluid MUC1 and EpCAM mRNA levels were measured by quantitative real-time PCR. Carcinoembryonic antigen (CEA) and cytokeratin 19 fragment (Cyfra21-1) were also detected simultaneously. The receiver operating characteristic
1002
W. Sun et al.
Method Study population From July 2011 to December 2013, 98 patients with PE who admitted to our hospital were enrolled in the study. The subjects included 60 men and 38
women, and had a mean age of 61 years. Malignant PEs were presented in 58 patients (59%), while PEs were benign in 40 patients (41%). All PEs had definite etiology documented by physical examination, chest radiology, pleural fluid biochemistry, microbiology and cytology analyses, pleural biopsy, percutaneous needle biopsy or endoscopy biopsy. When initial thoracentesis and cytology were non-diagnostic for suspected malignant PE, repeated thoracenteses and cytology or pleural biopsy were pursued as clinical dictated. All patients with ‘suspicious’ pleural fluid cytology were defined as cytologic negativity. Malignant PEs were diagnosed by either pleural fluid cytology positivity or malignant cells identified in a pleural biopsy specimen. The study was proved by the Ethics Committee of the Affiliated Hospital of Jiangsu University and written informed consent was obtained from all participants.
Specimen processing Pleural fluids were collected by diagnostic thoracentesis before the patients received any therapy. Each fluid specimen was centrifuged in 50-ml tubes at 1500 rpm for 10 min at 48C, Then, cell pellets were pooled together, washed once and centrifuged again at 1500 rpm for 10 min at 48C. The cell pellets were stored at 808C until use. Meanwhile, PE specimens were taken to the clinical laboratory for routine biochemical tests and carcinoembrgynic antigen (CEA) and cytokeratin 19 fragment (Cyfra211) assay, and pathologic department for cytology examination.
Quantitative real-time PCR Total RNA was extracted from the cell pellets using TRIZOL Reagent (Invitrogen, Carslbad, CA) following the manufacturer’s instructions. The RNA concentration was measured by UV absorption at 260 and 28 nm. The A260/A280 ratio was calculated to assess RNA quality and purity. First-strand cDNA was produced from total RNA by using an RNA PCR Kit version 3.0 (TakaRa Bio Inc., Tokyo, Japan), according to manufacturer’s instructions. QRT-PCR of the target MUC1 and EpCAM mRNA and b-actin as internal control was performed on an ABI 7500 thermal cycler real-time PCR system (Applied Biosystems, Foster City, CA), using the SYBR-Green I Chemistry. Amplification primers of the two genes were synthesized by Shanghai Invitrogen Biotechnology Co, Ltd, in China. The primer sequences, annealing temperatures and expected length of synthesis fragment were shown in Table 1. The cycling conditions were as follows: a denaturation step at 958C for 30 s,
Downloaded from by guest on September 12, 2015
higher than that of other tumor markers.8–15 However, false-positive results of the two tumor markers may weaken their diagnostic value16; thus, there is no consensus of these results with regard to which markers are most effective at differentiating malignant from benign PE. Mucine 1 (MUC1) is a cell surface glycoprotein and expressed at a based level by normal ductal epithelial cells of secretory organs.17 As a tumorassociated antigen, MUC1 is overexpressed on various carcinomas of epithelial origin, including lung, breast, ovary and colon cancer.18 Studies have demonstrated that an elevated level of MUC1 protein plays a role in tumor progression, especially in the process of metastasis.19 Epithelial cell adhesion molecule (EpCAM) is also a transmembrane glycoprotein that is expressed on the basolateral surface of most normal epithelial tissue.20 Likewise, EpCAM can now be considered to be one of the most frequently and most intensely expressed tumorassociated antigens known. It is overexpressed to varying digress in most human carcinomas.20,21 The diagnostic and prognostic characteristics of EpCAM have been reported by many investigators.20–22 Recently, we have used quantitative real-time PCR (QRT-PCR) method to detect the expression of MUC1 and EpCAM mRNA in peripheral blood of patients with non-small cell lung cancer (NSCLC) and have demonstrated that blood MUC1 and EpCAM mRNA are predictive and prognostic markers in NSCLC patients who undergo curative surgery.23 MUC1 and EpCAM are considered as two oncogenes and involved in intercellular adhesion, proliferation, survival, carcinogenesis and metastasis formation.19-23 Because MUC1 and EpCAM genes are thought to be restricted to epithelial cells, they have been used for the detection of micrometastatic tumor cell in blood, bone marrow and lymph node of patients with numerous solid tumors.23–27 However, relatively few studies have been undertaken to investigate the diagnostic utility of pleural fluid MUC1 and EpCAM mRNA in patients with malignant PE.28,29 In this study, we evaluated the efficiency of pleural fluid MUC1 and EpCAM mRNA QRT-PCR assay in identification of the origin of PE and examined these test as potentially useful in assisting the diagnosis of malignant PE.
Pleural fluid MUC1 and EpCAM mRNA Table 1 Sequences and features of the primers used for QRT-PCR mRNA
Primer sequence (50 -30 )
Annealing temperature
Length (bp)
MUC1
AATGAATGGCTCAAAACTTGG CAGTAGGTTCTCACTCGCTCAG AGTTGTTAGGGTTCTGGTCAT GCTCTTGGTAGTCGGTGCT TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG
568C
203
588C
213
608C
205
EpCAM b-actin
Statistical analysis Statistical analysis was performed with SPSS software 13.0 (SPSS Inc., Chicago, IL). Data were expressed as the median (min–max) for each tumor marker because of its non-normally distributed variable. Comparisons between groups used the MannWhitney’s U-test for continuous variable, and the Fisher’s exact test for categorical variable. The correlation between the presence of malignancy and all variable was determined by logistic regression. The diagnostic performance of each tumor marker to distinguish malignant from benign PE was evaluated with the receiver operating characteristic (ROC) curve analysis. According to the optimum cutoff point provided by ROC curve analysis, sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and accuracy were calculated. Statistical significance was defined by a P value
