European Journal of Pharmacology 746 (2015) 206–212

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Neuropharmacology and analgesia

Dexmedetomidine improves early postoperative cognitive dysfunction in aged mice Xiao-Lan Qian a,b,c, Wei Zhang d, Ming-Zheng Liu e, Yu-Bing Zhou d, Jing-Min Zhang a,b, Li Han a,b, You-Mei Peng a,b, Jin-hua Jiang a, Qing-Duan Wang a,n a Henan Key Laboratory for Pharmacology of Liver Diseases, Academy of Medical and Pharmaceutical Sciences, Zhengzhou University, 40 Daxue Road, Zhengzhou 450052, China b School of Pharmaceutical Sciences, Zhengzhou University, 100 Kexue Avenue, Zhengzhou 450001, China c The Third People Hospital of Henan Province, 98 Funiu Road, Zhengzhou 450052, China d The First Affiliated Hospital, Zhengzhou University, 1 Jianshe East Road, Zhengzhou 450052, China e Fuwai Hospital, National Center for cardiovascular Diseases, 167 Nouth Lishi Road, Beijing 100037, China

art ic l e i nf o

a b s t r a c t

Article history: Received 30 April 2014 Received in revised form 2 November 2014 Accepted 10 November 2014 Available online 20 November 2014

Postoperative cognitive dysfunction (POCD) is a frequent complication following major surgery in the elderly. However, the exact pathogenic mechanisms are still unknown. Dexmedetomidine, a selective alpha 2 adrenal receptor agonist, was revealed anesthesia and brain protective role. The present study aimed to examine whether dexmedetomdine protects against POCD induced by major surgical trauma under general anesthesia in aged mice. In the present study, cognitive function was assessed by Y-maze. Proinflammatory cytokines interleukin-1β (IL-1β) and tumor necrosis factor (TNF-α), apoptosis-related factor caspase-3 and Bax were detected by real-time PCR, Western blot or immunohistochemistry. The results showed that anesthesia alone caused weak cognitive dysfunction on the first day after general anesthesia. Cognitive function in mice with splenectomy under general anesthesia was significantly exacerbated at the first and third days after surgery, and was significantly improved by dexmedetomidine administration. Splenectomy increased the expression of IL-1β, TNF-α, Bax and caspase-3 in hippocampus. These changes were significantly inversed by dexmedetomidine. These results suggest that hippocampal inflammatory response and neuronal apoptosis may contribute to POCD, and selective alpha 2 adrenal receptor excitation play a protective role. & 2014 Elsevier B.V. All rights reserved.

Keywords: Aged Anesthesia Apoptosis Dexmedetomidine Inflammation Postoperative cognitive dysfunction

1. Introduction Postoperative cognitive dysfunction (POCD) is characterized by progressive deterioration of cognitive function, reductions in selfcare, increased hospitalization and delayed recovery. Some POCD cases even develop into permanent cognitive disabilities, such as Alzheimer's disease and dementia, and finally loss of independent living skills. Surgery, especially major surgery, was frequently reported to cause POCD in aged population. However, the neurobiological basis remains unknown. General anesthetics used in major surgery reveal harmful effect on cognitive function. They alter synaptic function through modulating specific ligand-gated ion channels, principally γ-aminobutyric acid (GABA) type A receptor and the N-methyl-D-aspartate (NMDA) subtype of the glutamate receptor (Franks., 2006). These drugs including ketamine, midazolam and isoflurane cause neuronal apoptosis and

n

Corresponding author. Tel./fax: þ 86 371 66658201. E-mail address: [email protected] (Q.-D. Wang).

http://dx.doi.org/10.1016/j.ejphar.2014.11.017 0014-2999/& 2014 Elsevier B.V. All rights reserved.

interfere in neuronal protein expression (Ikonomidou et al., 1999; Young et al., 2005). Co-application of multiple anesthetics (midazolam, nitrous oxide and isoflurane) in 7-day old mice caused widespread apoptosis and degenerative changes in central nervous system and subsequent impairment of learning and memory in their adulthood (Jevtovic-Todorovic et al., 2003). In aged rats, isoflurane anesthesia induced weak and temporary cognitive deficit (He et al., 2012). Surgical trauma plus anesthesia, especially major surgery, causes more severe POCD. Numerous reports showed that splenectomy, which greatly alters circular system and immune system, resulted in severe cognitive dysfunction in elder rats and mice (An et al., 2013; He et al., 2012; Kamer et al., 2012). Thus, splenectomy is frequently used as major surgery trauma in research involving POCD (Wan et al., 2007). Dexmedetomidine, a selective alpha 2 adrenal receptor agonist, is reported to have anesthesia, analgesia and cerebral protective effect. Dexmedetomidine exhibited significant postconditioning properties against oxygen and glucose deprivation-induced injury (Dahmani et al., 2010). Dexmedetomidine improved neuronal apoptosis caused by isoflurane in newborn mice (Sanders et al., 2009) and increased the

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

expression of anti-apoptosis protein while reduced the expression of apoptosis-promoting protein in intracerebral hemorrhage rats (Hwang et al., 2013). Experimental and clinical practice have revealed that dexmedetomidine is neuroprotective on delirium, stress and inflammatory response (Yang and Lee, 2014; Bekker et al., 2013; Zhang et al., 2014a, 2014b). Dexmedetomidine treatment converted disordered electroencephalogram waves to normal non-rapid eye movement wave in patients with sleep disorder, an important induction factor of POCD (Huupponen et al., 2008). Dexmedetomidine shortened the onset time of postoperative delirium (Shehabi et al., 2009). These reports suggest that dexmedetomidine play a beneficial role in POCD. Indeed, dexmedetomidine was shown to protect cognitive function after laparoscopic cholecystectomy and laparoscopic surgery for colorectal cancer in elderly patients (Chen et al., 2013; Zhang et al., 2014a, 2014b). The present study was designed to evaluate the effect of dexmedetomidine on POCD in aged mice, which underwent general anesthesia and major surgical trauma. Systemic inflammatory response following surgical trauma play an important role in the POCD (Godbout et al., 2005; Rosczyk et al., 2008). Many studies have shown that high level of proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin-1(IL-1) in blood and brain tissue are associated with the occurrence of POCD (Cibelli et al., 2010; Wright et al., 2006). Thus we investigated whether dexmedetomidine interfered in the expression of these proinflammatory cytokines. Our results revealed that dexmedetomidine protected POCD, and reduced expression of proinflammatory factors and apoptosis trend in hippocampus. These results suggest a new clinical intervention for POCD.

2. Materials and methods 2.1. Animals and surgical procedures Healthy BALB/c mice (20–22 month old, weight 60–70 g) were individually raised at 23 1C in a temperature-controlled room on a 12h light and 12-h dark cycle with ad libitum access to food and water. After 7–10 days' adaptation to their environment, the mice were randomly grouped: control group, anesthesia alone group, splenectomy group, dexmedetomidine alone group, and splenectomy plus dexmedetomidine group. The mice in control group were not given any treatment. The mice in anesthesia group were given 1.5–2% isoflurane under intubation and mechanical ventilation, immediately followed by intraperitoneal injection of ketamine 100 mg/kg. Isoflurane inhalation was continued to maintain anesthesia. The anesthetized mice exhibited surgical analgesia and intact cardiorespiratory function which was reflected by normal arterial blood gas parameters and loss of response to noxious stimuli, respectively. The mice in splenectomy group underwent splenectomy under the same anesthesia as anesthesia group. Briefly, the spleen was exposed through a small incision in the left upper abdominal quadrant, and was then mobilized, isolated and removed before it was infiltrated with 0.25% bupivacaine. All cuts were closed with sterile suture. In dexmedetomidine intervention group, dexmedetomidine (15 or 25 μg/kg) was administered by intraperitoneal injection alone (dexmedetomidine alone group) or 30 min prior to splenectomy described above (splenectomy plus dexmedetomidine group). All experimental procedures were performed in accordance with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals.

207

Y-maze is composed of three arms and one connection. Each arm is laid on a bottom of thin copper rods, which communicate with the stimulating power. The end of each arm is equipped with signal light. Safe zone is indicated when the light is on. Safe zone can be randomly changed. When one arm is a safe zone, the other two arms are power charged. Mice can be trained to actively response and escape to the safe zone. It is considered correct response if the mice directly escape to the safe zone when subjected to electric shock. Vice versa, it is error response. All mice were adapted to the maze environment for 3–5 min before the experiment began. Then clockwise transform the safe zone and the position of the electric shock. Five seconds after the signal light is lit in the safe zone, charge the non-safe zone. When mice ran to safety, ends one training session. Repeat the training until the result of 9 correct responses in 10 consecutive trials was obtained. The total number of trials was recorded. The fewer trials number means better learning and memory ability. Mice were sacrificed after Y-maze tests. One part of mice in each group were anesthetized and decapitated. The hippocampal tissues were quickly removed and immediately cooled in liquid nitrogen and stored at  80 1C until RNA and protein measurement. The remaining mice were used for immunohistochemistry. These mice were killed by CO2 asphyxiation, perfused transcardially with heparinized saline and then PBS solution containing 4% paraformaldehyde. The hippocampus was dissected, fixed in 4% paraformaldehyde solution in PBS, and subsequently embedded in paraffin until use. 2.3. Real-time RT-PCR Total RNAs of hippocampal tissues were extracted with ultra pure RNA extraction kit (Cat no.: CW0581, CWbio. Co. Ltd.). Total RNA was then reversely transcribed into cDNA using HiFi-MMLVcDNA reverse transcript reagent kit (Cat no.: CW0744, CWbio. Co. Ltd.). The resulting cDNA was detected using an ABI 7900 real-time PCR System with SYBR Green. β-tubulin was used as an internal control. The primers sequences for real-time PCR were as follows: IL-1β (sense: TTTCCTCCTTGCCTCTGATG, antisense: GAGAGTGCTGCCTAATGTCC); TNF-α (sense: GCCTCCCTCTCATCAGTTCT, antisense: ACTTGGTGGTTTGCTACGAC). β-tubulin (sense: AACCTACGGAGACCTGAACCATC antisense: TGAAGAAGTGGAGACGTGGGAAT ). After an initial denaturation at 95 1C for 3 min, the PCR cycling was performed as follows: 95 1C for 12 s and 65 1C for 50 s. Amplification was performed for 40 cycles, and all samples were performed in triplicate. Results were presented as the levels of expression following normalization to β-tubulin using the 2 \widehat -ΔΔCT method. Dissolved curve, which was measured immediately after amplification, showed single product peak, indicating good product specificity. 2.4. Western blot analysis Total proteins of hippocampal tissues were extracted with RIPA lysis buffer, quantified using the Bradford method, and separated by SDS-PAGE (12.5%). After transferring to polyvinylidene fluoride membranes, the membranes were blocked by 1–3% BSA or 5% fat dry milk at room temperature or 37 1C for 1–2 h. The membranes were then incubated by primary antibody (1:100–1:3000) overnight at 4 1C. The membranes were incubated with HRP-coupled secondary antibody for 1–2 h at room temperature. The bound proteins were then visualized using ECL and analyzed using BioImaging Systems.

2.2. Cognitive function testing

2.5. Immunohistochemistry

Hippocampal-dependent place learning and memory were evaluated by Y-maze on days 1 and 3 after different interventions.

The paraffin-embedded hippocampal tissues were cut into 4-μm sections. Sections were deparaffinized, rehydrated and

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

antigen repaired. After endogenous peroxidase was quenched with 0.3% H2O2 and nonspecific binding was blocked with normal nonimmune serum, the sections were incubated with primary antibody for 60 min. Sections were then incubated with biotinylated secondary antibody for 10 min, followed by streptavidin-HRP complex for 10 min. Immunohistochemical reaction was revealed by using 0.05% 3,30-diaminobenzidine and 0.03% H2O2 as chromogen. After each incubation, sections were thoroughly washed with PBS. The sections were stained by hematoxylin (Cat no.: CW0127) for 3–7 min, and were dehydrated with gradient alcohol, cleared with xylene, dried and covered with glass before microcopy. 2.6. Statistical analysis All data were analyzed with SPSS 17. Statistical data are expressed as mean 7sem. Group comparisons were performed using one-way ANOVA followed by a Bonferroni comparison. P o0.05 is considered statistically significant.

3. Results 3.1. Cognitive function evaluation Y-maze test, a widely used method in evaluation of spatial learning and memory, was applied to evaluate the effects of interventions on cognitive function. In this test, when 9 correct escape responses appeared in 10 consecutive trials, the total trial number was recorded. The fewer trials number means better learning and memory ability. In group comparison as shown in Fig. 1, the mice in anesthesia group exhibited decreased spatial learning and memory ability on day 1 after anesthesia, as compared to that in control mice (Po 0.05). At day 3 after anesthesia, spatial learning and memory ability did not reveal significantly different with control. Dexmedetomidine alone did not change the learning and memory ability at two different doses (15 and 25 μg/ kg) on day 1 and 3 after dexmedetomidine treatment. Anesthesia plus splenectomy significantly decreased learning and memory ability on day 1 and 3 after surgery, as compared to control (P o0.05). The decreased learning and memory ability by splenectomy were improved by dexmedetomidine treatment prior to splenectomy, with significant improvement by 25 μg/kg of dexmedetomidine on day 3 (Po 0.05). These results demonstrate that dexmedetomidine pretreatment protects against the impairment of spatial learning and memory caused by anesthetic plus major surgical trauma.

80 60

Another important proinflammatory factor TNF-α was measured to further decide the role of inflammatory response. Consistent with the results of IL-1β, anesthesia itself did not alter TNF-α mRNA and protein levels in hippocampus at two time points, as compared to the controls. However, splenectomy significantly increased the mRNA and protein expression of TNF-α (P o0.01), which was significantly inversed by dexmedetomidine pretreatment. These results of IL-1β and TNF-α demonstrate that dexmedetomidine improve inflammatory response caused by surgical trauma (Fig. 3). 3.4. Expression of caspase 3 and Bax We next elucidated whether the protective effect of dexmedetomidine is related with neuronal apoptosis. Pro-apoptosis related factor caspase-3 and Bax in hippocampus were measured by Western blot and immunohistochemistry. In Western blot analysis, anesthesia alone and anesthesia plus splenectomy significantly increased caspase 3 level (Fig. 4A, P o0.01). The effect in anesthesia plus splenectomy groups was more markedly. The increased caspase 3 expression by splenectomy was significantly reduced by dexmedetomidine (P o0.05 and o0.01 by 15 and 25 μg/kg, respectively). In immunohistochemistry, there were sporadic caspase 3 positive neurons in control group (437 14, Fig. 4B). The numbers were increased 100 731 and 75718 (P o0.05) on days 1 and 3 after anesthesia, respectively. Splenectomy further increased the number of caspase 3 positive cells to 1907 35 and 150 731 on day 1 and 3, respectively (Po 0.01). Dexmedetomidine

100

*

*

40 20 0

Day 3

80

*

60 40

**

20 0

SP S P +D SP 15 +D 25

an C e s on th es ia D 15 D 25

3.3. TNF-α expression

SP S P +D S P 15 +D 25

Day 1

We next examined whether the change of cognitive function was reflected by inflammatory response in hippocampus. The level of proinflammatory factor IL-1β in hippocampus was measured by real-time PCR and Western blot. As shown in Fig. 2, anesthesia alone did not change the mRNA and protein levels of IL-1β at two time points on day1 and 3 after anesthesia, as compared to the control. Splenectomy significantly increased IL-1β mRNA expression on day 1 (P o0.01) and 3 (Po 0.05) after surgery (Fig. 2A). Splenectomy also significantly increased IL-1β protein expression on day 1 and 3 (P o0.01, Fig. 2B). The splenectomy-elevated mRNA and protein expression of IL-1β on day 3 was significantly decreased by dexmedetomidine at 15 and 25 μg/kg (Po 0.05) to the levels almost same as those in control group.

Number of trials

Number of trials

100

3.2. IL-1β expression

an C e s on th es ia D 15 D 25

208

Fig. 1. Cognitive function evaluation. Cognitive function was evaluated with Y-maze. Y-maze was performed on day 1 and 3 following different interventions. The total trial number was recorded and shown when 9 correct responses were gained in 10 consecutive trials. Con: control. D15, D25: dexmedetomidine treatment (15, 25 μg/kg). SP: splenectomy plus anesthesia. SP þD: dexmedetomidine treatment prior to splenectomy. nPo 0.05 vs Con. nnPo 0.05 vs splenectomy.

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

209

Fig. 2. IL-1β expression in hippocampus. IL-1β expression was measured by real-time PCR (A) and Western blot (B). Con: control. A1, A3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia alone. SP1, SP3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia and splenectomy. SP3 þ D: hippocampal sample was obtained on day 3 after mice were treated by dexmedetomidine (15 or 25 μg/kg) and splenectomy. nPo 0.05, #Po 0.01 vs Con. nnPo 0.05 vs SP3.

Fig. 3. TNF-α expression in hippocampus. TNF-α expression was measured by real-time PCR (A) and Western blot (B). Con: control. A1, A3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia alone. SP1, SP3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia and splenectomy. SP3 þ D: hippocampal sample was obtained on day 3 after mice were treated by dexmedetomidine (15 or 25 μg/kg) and splenectomy. # P o 0.05 vs Con. nn P o0.01 vs SP3.

treatment significantly decreased the increased number of positive neurons by splenectomy to 76 721 (Po 0.05) and 50718 (P o0.01) on day 3 at 15 and 25 μg/kg, respectively. A similar change pattern was seen in Bax (Fig. 5). Anesthesia alone slightly increased the number of Bax positive neurons. Splenectomy markedly increased the number. Dexmedetomidine treatment significantly decreased the increased number of positive neurons by splenectomy. These results suggest dexmedetomidine decrease neuronal apoptosis caused by anesthesia and surgical trauma.

4. Discussion In the present study, we observed that anesthetics and surgical trauma triggered cognitive dysfunction in aged mice. We also found anesthetics and surgical trauma caused increased expression of proinflammatory cytokine and neuronal apoptosis factors in the hippocampus. The results demonstrate that anesthetics plus surgery contribute to cognitive dysfunction. Our results also showed that dexmedetomidine, a selective alpha 2 adrenal

receptor agonist, improved the anesthetics plus surgery-induced POCD and attenuated inflammatory response and neuronal apoptosis in hippocampus. Thus, these results suggest a protective role of dexmedetomidine in POCD in elderly. In our study, exposure of aged mice to the anesthetic ketamine and isoflurane induced neuronal apoptosis as reflected by Bax and caspase 3 positive immunostaining and increased expression in Western blotting analysis. This means that anesthetics themselves may result in the deleterious effects on learning and memory function. General anesthetics caused profound depression of neuronal activity by manipulating a specific ligand-gated ion channel, primarily GABAA receptor and NMDA receptor, thereby altering the function of synapses and synaptic plasticity (Franks., 2006). Meanwhile general anesthetics caused abnormal central neurotransmitter and receptor systems and affected neurotransmitter generation, storage, release and disappearing procedures, which can lead to postoperative changes of learning, memory and other cognitive functions (Culley et al., 2003, 2004). GABAA and NMDA receptors and their agonists are essential for migration of neurons to the appropriate regions, dendritic filopodia stabilization, synaptic development, and stabilization (Komuro and Rakic.,

210

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

Con

A1

A3

SP3

SP+D15

SP+D25

SP1

Fig. 4. Caspase-3 expression in hippocampus. Caspase-3 expression was measured by Western blot (A) and immunohistochemistry (B). Con: control. A1, A3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia alone. SP1, SP3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia and splenectomy. SP3 þ D: hippocampal sample was obtained on day 3 after mice were treated by dexmedetomidine (15 or 25 μg/kg) and splenectomy. nPo 0.05, # P o0.01 vs Con.!Po 0.05, nnPo 0.01 vs SP3.

Con

SP3

A1

SP3+D15

A3

SP1

SP3+D25

Fig. 5. Bax expression in hippocampus. Bax expression was measured by Western blot (A) and immunohistochemistry (B). Con: control. A1, A3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia alone. SP1, SP3: hippocampal sample was obtained on day 1 or 3 after mice were treated by anesthesia and splenectomy. SP3 þD: hippocampal sample was obtained on day 3 after mice were treated by dexmedetomidine (15 or 25 μg/kg) and splenectomy.nP o0.05, #P o0.01 vs Con. nn P o0.01 vs SP3.

1993; Rajan and Cline., 1998; Verhage et al., 2000). Any interventions including anesthetics affecting GABAA and NMDA-mediated synaptic transmission are not favorable for normal neuronal development, especially for aging whose central nervous system is experiencing degenerative changes. The modulation of NMDA receptor and GABA receptor has the potential in inducing apoptosis (Ma et al., 2007). Possibly, these modulatory effects may induce changes in neurotrophin activation, and in turn, dysregulate the intracellular proapoptotic and antiapoptotic balance, such as the

Bax/Bcl-2 ratio (Ma et al., 2005). This hypothesis is supported by a previous study in which constant ketamine administration to monkey cerebral cortex slices led to apoptotic neurodegeneration (Wang et al., 2006). Low-dose of ketamine also resulted in continuous memory and working memory impairment (Morgan et al., 2004; Honey et al., 2003; Pfenninger et al., 2002). Furthermore, cellular ionic and neurotrophin homeostasis is also crucial for normal neuronal survival. Isoflurane could activate the endoplasmic reticulum membrane 1,4,5-trisphosphate receptor (Wei et

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

al., 2008), cause excessive calcium release and reduce tissue-type plasminogen activator release (Head et al., 2009) to start endogenous apoptosis. In the present study, ketamine plus isoflurane increased Bax and caspase-3 expression. This is consistent with previous findings in vitro (Xie et al., 2006) and in vivo (Culley et al., 2004; Bianchi et al., 2008; Valentim et al., 2008), in which isoflurane was revealed to be cytotoxic, and isoflurane inhalation was reported to impair memory in aged rats (Culley et al., 2003). The increase in proinflammatory cytokines in the hippocampus may be an important risk factor in cognitive decline after surgery, as demonstrated clearly by the present study and other reports (Wan et al., 2007; Rosczyk et al., 2008; Cibelli et al., 2010). Surgical trauma not only activates the immune response of peripheral but also activates that of the central nervous system. It has been postulated that over-expression of central inflammatory cytokines may lead to profound disturbances in sensory-motor coordination and cognition (Barrientos et al., 2006). Considerable evidences show that the release of proinflammatory cytokines within the hippocampus interferes with cognitive function and development of long-term potentiation. POCD is a complicated clinical syndrome, and mainly appears in elder patients with massive bleeding, long surgery time and strong stress response in surgery. Sham operation alone is not enough to cause POCD (Rosczyk et al., 2008). Splenectomy under general anesthesia is a major surgery, which was easy to trigger POCD in aged mice (Wan et al., 2007). Thus, splenectomy under general anesthesia was used in this study to examine the effect of dexmedetomidine. Proinflammatory factors, especially IL-1β are p38MAPK signal activation factor. p38MAPK, an important member of the MAPKs family, is involved in cell proliferation, apoptosis and differentiation, and plays an important role in the apoptosis process. In the present study, the increased expression of IL-1β and TNF-α in hippocampal neurons in splenectomized mice may underlie the neuronal apoptosis as reflected by caspase-3 and Bax. Given the inevitable harm of cognitive function by general anesthesia and major surgical trauma in elderly population, searching an effective treatment or prediction is significant. This study has uncovered a plausible and promising novel drug that significantly attenuated the harm. In the present study, dexmedetomidine significantly improved POCD in aged mice, and decreased the expression of IL-1β, TNF-α, caspase-3 and Bax. Especially, the pretreatment of dexmedetomidine significantly improved the detected parameters (cognitive function, proinflammatory factors, and apoptosis factors) to the similar levels in control mice. The protective role of dexmedetomidine in cognitive function may be the results of reduction of inflammatory response and neuronal apoptosis. Indeed, dexmedetomidine was reported anti-inflammatory effect through reducing LPS-induced systemic release of TNF-α and IL-1β (Xiang et al., 2014). Further mechanism involving the neuroprotective role of dexmedetomidine is considered by two. First, dexmedetomidine increases the tyrosine phosphorylation of focal adhesion kinase, a key cellular enzyme, through stimulation of the alpha 2 adrenoceptor subtype and plays a vital role in cell plasticity and survival (Dahmani et al., 2005; Paris et al., 2006). Second, dexmedetomidine increases extracellular signal regulated kinases (ERK)1/2 phosphorylation, a key mitogen-activated protein kinase involved in cell survival and memory by the activation of protein kinase C, and probably imidazoline receptors (Dahmani et al., 2008; Xue et al., 2000). Dexmedetomidine also increases the expression of growth factors such as epidermal growth factor and brain-derived neurotrophic factors, and then participates in neuroprotection. These molecular properties of dexmedetomidine may underlie its anti-inflammatory and anti-apoptotic effect. Indeed, recent reports have shown that dexmedetomidine exerted both preconditioning and postconditioning effects against ischemic injury in hippocampal

211

organotypic slice cultures (Dahmani et al., 2010), and downregulated apoptosis-promoting protein (Engelhard et al., 2003). A large body of experimental models and clinical setting support dexmedetomidine's neuroprotective properties, including attenuating delirium, preserving sleep architecture, preserving ventilatory drive and decreasing sympathetic tone and inflammatory response (Yang and Lee, 2014; Bekker et al., 2013; Zhang et al., 2014a, 2014b). Our findings in POCD add dexmedetomidine a new neuroprotective property. In conclusion, the present study demonstrates a neuroprotective role of dexmedetomidine in POCD in aged mice. This protective role may be resulted from the decreased inflammatory response and neuronal apoptosis in the hippocampus. This study suggests a good choice for clinical prevention of POCD in elderly.

Acknowledgments This work was supported by Medicine Science Technology Plan of Henan Province of China (No. 201304073). We thank Shengli Zhang from Laboratory in Zhengzhou University for assisting with experiments. We appreciate Prof. Lirong Zhang and Prof. Guoqiang Zhao from Zhengzhou University for providing helpful advice and invaluable support on experiments.

References An, L.N., Yue, Y., Guo, W.Z., Miao, Y.L., Mi, W.D., Zhang, H., Lei, Z.L., Han, S.J., Dong, L., 2013. Surgical trauma induces iron accumulation and oxidative stress in a rodent model of postoperative cognitive dysfunction. Biol. Trace Elem. Res. 151, 277–283. Bekker, A., Haile, M., Kline, R., Didehvar, S., Babu, R., Martiniuk, F., Urban, M., 2013. The effect of intraoperative infusion of dexmedetomidine on the quality of recovery after major spinal surgery. J. Neurosurg. Anesthesiol. 25, 16–24. Barrientos, R.M., Higgins, E.A., Biedenkapp, J.C., Sprunger, D.B., Wright-Hardesty, K. J., Watkins, L.R., Rudy, J.W., Maier, S.F., 2006. Peripheral infection and aging interact to impair hippocampal memory consolidation. Neurobiol. Aging 27, 723–732. Bianchi, S.L., Tran, T., Liu, C., Lin, S., Li, Y., Keller, J.M., Eckenhoff, R.G., Eckenhoff, M.F., 2008. Brain and behavior changes in 12-month-old Tg2576 and nontransgenic mice exposed to anesthetics. Neurobiol. Aging 29, 1002–1010. Chen, J., Yan, J., Han, X., 2013. Dexmedetomidine may benefit cognitive function after laparoscopic cholecystectomy in elderly patients. Exp. Ther. Med. 5, 489–494. Cibelli, M., Fidalgo, A.R., Terrando, N., Ma, D., Monaco, C., Feldmann, M., Takata, M., Lever, I.J., Nanchahal, J., Fanselow, M.S., Maze, M., 2010. Role of interleukin1beta in postoperative cognitive dysfunction. Ann. Neurol. 68, 360–368. Culley, D.J., Baxter, M., Yukhananov, R., Crosby, G., 2003. The memory effects of general anesthesia persist for weeks in young and aged rats. Anesth. Analg. 96, 1004–1009 (table of contents). Culley, D.J., Baxter, M.G., Yukhananov, R., Crosby, G., 2004. Long-term impairment of acquisition of a spatial memory task following isoflurane-nitrous oxide anesthesia in rats. Anesthesiology 100, 309–314. Dahmani, S., Rouelle, D., Gressens, P., Mantz, J., 2010. Characterization of the postconditioning effect of dexmedetomidine in mouse organotypic hippocampal slice cultures exposed to oxygen and glucose deprivation. Anesthesiology 112, 373–383. Dahmani, S., Rouelle, D., Gressens, P., Mantz, J., 2005. Effects of dexmedetomidine on hippocampal focal adhesion kinase tyrosine phosphorylation in physiologic and ischemic conditions. Anesthesiology 103, 969–977. Dahmani, S., Paris, A., Jannier, V., Hein, L., Rouelle, D., Scholz, J., Gressens, P., Mantz, J., 2008. Dexmedetomidine increases hippocampal phosphorylated extracellular signal-regulated protein kinase 1 and 2 content by an alpha 2-adrenoceptorindependent mechanism: evidence for the involvement of imidazoline I1 receptors. Anesthesiology 108, 457–466. Engelhard, K., Werner, C., Eberspacher, E., Bachl, M., Blobner, M., Hildt, E., Hutzler, P., Kochs, E., 2003. The effect of the alpha 2-agonist dexmedetomidine and the N-methyl-D-aspartate antagonist S( þ )-ketamine on the expression of apoptosis-regulating proteins after incomplete cerebral ischemia and reperfusion in rats. Anesth. Analg. 96, 524–531 (table of contents). Franks, N.P., 2006. Molecular targets underlying general anaesthesia. Br. J. Pharmacol. 147 (Suppl 1), S72–S81. Godbout, J.P., Chen, J., Abraham, J., Richwine, A.F., Berg, B.M., Kelley, K.W., Johnson, R.W., 2005. Exaggerated neuroinflammation and sickness behavior in aged mice following activation of the peripheral innate immune system. FASEB J. 19, 1329–1331.

212

X.-L. Qian et al. / European Journal of Pharmacology 746 (2015) 206–212

Head, B.P., Patel, H.H., Niesman, I.R., Drummond, J.C., Roth, D.M., Patel, P.M., 2009. Inhibition of p75 neurotrophin receptor attenuates isoflurane-mediated neuronal apoptosis in the neonatal central nervous system. Anesthesiology 110, 813–825. Honey, R.A., Turner, D.C., Honey, G.D., Sharar, S.R., Kumaran, D., Pomarol-Clotet, E., McKenna, P., Sahakian, B.J., Robbins, T.W., Fletcher, P.C., 2003. Subdissociative dose ketamine Produces a deficit in manipulation but not maintenance of the contents of working memory. Neuropsychopharmacology 28 (11), 2037–2042. Huupponen, E., Maksimow, A., Lapinlampi, P., Sarkela, M., Saastamoinen, A., Snapir, A., Scheinin, H., Scheinin, M., Merilainen, P., Himanen, S.L., Jaaskelainen, S., 2008. Electroencephalogram spindle activity during dexmedetomidine sedation and physiological sleep. Acta Anaesthesiol. Scand. 52, 289–294. He, H.J., Wang, Y., Le, Y., Duan, K.M., Yan, X.B., Liao, Q., Liao, Y., Tong, J.B., Terrando, N., Ouyang, W., 2012. Surgery upregulates high mobility group box-1 and disrupts the blood-brain barrier causing cognitive dysfunction in aged rats. CNS Neurosci. Ther. 18, 994–1002. Hwang, L., Choi, I.Y., Kim, S.E., Ko, I.G., Shin, M.S., Kim, C.J., Kim, S.H., Jin, J.J., Chung, J. Y., Yi, J.W., 2013. Dexmedetomidine ameliorates intracerebral hemorrhageinduced memory impairment by inhibiting apoptosis and enhancing brainderived neurotrophic factor expression in the rat hippocampus. Int. J. Mol. Med. 31, 1047–1056. Ikonomidou, C., Bosch, F., Miksa, M., Bittigau, P., Vockler, J., Dikranian, K., Tenkova, T. I., Stefovska, V., Turski, L., Olney, J.W., 1999. Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 283, 70–74. Jevtovic-Todorovic, V., Hartman, R.E., Izumi, Y., Benshoff, N.D., Dikranian, K., Zorumski, C.F., Olney, J.W., Wozniak, D.F., 2003. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J. Neurosci. 23, 876–882. Kamer, A.R., Galoyan, S.M., Haile, M., Kline, R., Boutajangout, A., Li, Y.S., Bekker, A., 2012. Meloxicam improves object recognition memory and modulates glial activation after splenectomy in mice. Eur. J. Anaesthesiol. 29, 332–337. Komuro, H., Rakic, P., 1993. Modulation of neuronal migration by NMDA receptors. Science 260, 95–97. Ma, D., Hossain, M., Chow, A., Arshad, M., Battson, R., Sanders, R.D., Mehmet, M., Edwards, D., Franks, N.P., Maze, M., 2005. Xenon and hypothermia combine synergistically to provide potent and long-lasting neuroprotection from neonatal asphyxia by attenuating apoptotic cell death. Ann. Neurol. 58, 182–193. Ma, D., Williamson, P., Januszewski, A., Nogaro, M.C., Hossain, M., Ong, L.P., Shu, Y., Franks, N.P., Maze, M., 2007. Xenon mitigates isoflurane-induced neuronal apoptosis in the developing rodent brain. Anesthesiology 106, 746–753. Morgan, C.J., Mofeez, A., Brandner, B., Bromley, L., Curran, H.V., 2004. Acute effects of ketamine on memory systems and psychotic symptoms in healthy volunteers. Neuropsychopharmacology 29, 208–218. Paris, A., Mantz, J., Tonner, P.H., Hein, L., Brede, M., Gressens, P., 2006. The effects of dexmedetomidine on perinatal excitotoxic brain injury are mediated by the alpha2A-adrenoceptor subtype. Anesth. Analg. 102, 456–461. Pfenninger, E.G., Durieux, M.E., Himmelseher, S., 2002. Cognitive impairment after small-dose ketamine isomers in comparison to equianalgesic racemic ketamine in human volunteers. Anesthesiology 96, 357–366. Rajan, I., Cline, H.T., 1998. Glutamate receptor activity is required for normal development of tectal cell dendrites in vivo. J. Neurosci. 18, 7836–7846. Rosczyk, H.A., Sparkman, N.L., Johnson, R.W., 2008. Neuroinflammation and cognitive function in aged mice following minor surgery. Exp. Gerontol. 43, 840–846.

Sanders, R.D., Xu, J., Shu, Y., Januszewski, A., Halder, S., Fidalgo, A., Sun, P., Hossain, M., Ma, D., Maze, M., 2009. Dexmedetomidine attenuates isoflurane-induced neurocognitive impairment in neonatal rats. Anesthesiology 110, 1077–1085. Shehabi, Y., Grant, P., Wolfenden, H., Hammond, N., Bass, F., Campbell, M., Chen, J., 2009. Prevalence of delirium with dexmedetomidine compared with morphine based therapy after cardiac surgery: a randomized controlled trial (dexmedetomidine compared to morphine-DEXCOM study). Anesthesiology 111, 1075–1084. Valentim, A.M., Alves, H.C., Silva, A.M., Olsson, I.A., Antunes, L.M., 2008. Effects of depth of isoflurane anaesthesia on a cognition task in mice. Br. J. Anaesth. 101, 434–435. Verhage, M., Maia, A.S., Plomp, J.J., Brussaard, A.B., Heeroma, J.H., Vermeer, H., Toonen, R.F., Hammer, R.E., van den Berg, T.K., Missler, M., Geuze, H.J., Sudhof, T. C., 2000. Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science 287, 864–869. Wan, Y., Xu, J., Ma, D., Zeng, Y., Cibelli, M., Maze, M., 2007. Postoperative impairment of cognitive function in rats: a possible role for cytokinemediated inflammation in the hippocampus. Anesthesiology 106, 436–443. Wang, C., Sadovova, N., Hotchkiss, C., Fu, X., Scallet, A.C., Patterson, T.A., Hanig, J., Paule, M.G., Slikker Jr., W., 2006. Blockade of N-methyl-D-aspartate receptors by ketamine produces loss of postnatal day 3 monkey frontal cortical neurons in culture. Toxicol. Sci. 91, 192–201. Wei, H., Liang, G., Yang, H., Wang, Q., Hawkins, B., Madesh, M., Wang, S., Eckenhoff, R.G., 2008. The common inhalational anesthetic isoflurane induces apoptosis via activation of inositol 1,4,5-trisphosphate receptors. Anesthesiology 108, 251–260. Wright, C.B., Sacco, R.L., Rundek, T., Delman, J., Rabbani, L., Elkind, M., 2006. Interleukin-6 is associated with cognitive function: the Northern Manhattan Study. J. Stroke Cerebrovasc. Dis. 15, 34–38. Xie, Z., Dong, Y., Maeda, U., Alfille, P., Culley, D.J., Crosby, G., Tanzi, R.E., 2006. The common inhalation anesthetic isoflurane induces apoptosis and increases amyloid beta protein levels. Anesthesiology 104, 988–994. Xue, L., Murray, J.H., Tolkovsky, A.M., 2000. The Ras/phosphatidylinositol 3-kinase and Ras/ERK pathways function as independent survival modules each of which inhibits a distinct apoptotic signaling pathway in sympathetic neurons. J. Biol. Chem. 275, 8817–8824. Xiang, H., Hu, B., Li, Z., Li, J., 2014. Dexmedetomidine Controls Systemic Cytokine Levels through the Cholinergic Anti-inflammatory Pathway. Inflammation 37, 1763–1770. Yang, S., Lee, H., 2014. A dose-finding study of preoperative intravenous dexmedetomidine in children's emergence delirium after epiblepharon surgery. Eur. J. Ophthalmol. 24, 417–423. Young, C., Jevtovic-Todorovic, V., Qin, Y.Q., Tenkova, T., Wang, H., Labruyere, J., Olney, J.W., 2005. Potential of ketamine and midazolam, individually or in combination, to induce apoptotic neurodegeneration in the infant mouse brain. Br. J. Pharmacol. 146, 189–197. Zhang, X., Wang, J., Qian, W., Zhao, J., Sun, L., Qian, Y., Xiao, H., 2014a. Dexmedetomidine inhibits tumor necrosis factor-alpha and interleukin 6 in lipopolysaccharide-stimulated astrocytes by suppression of c-Jun N-terminal kinases. Inflammation 37, 942–949. Zhang, Y., Xing, Z., Xu, Y., Xu, S., 2014b. Effects of different doses of dexmedetomidine on cognitive dysfunction in elderly patients early after laparoscopic surgery for colorectal cancer. Nan. Fang Yi Ke Da Xue Xue Bao 34, 743–746.