MOLECULAR REPRODUCTION AND DEVELOPMENT 29:323-336 (1991)

Developmental Regulation of a Serum Response Element Binding Activity in Amphibian Embryos JOEL VARLEY AND SEAN BRENNAN Department of Anatomy, School of Medicine, University of Connecticut, Farmington, Connecticut

ABSTRACT As part of our studies of transcriptional control during early development in vertebrates,we have examined embryos of the amphibian Xenopus laevis for the presence of sequence-specific DNA-binding proteins, using gel electrophoresis mobility-shift assays. Our analysis has focused on sequence elements in the cytoskeletal actin gene, whose embryonic transcription is initially activated at the gastrula stage, approximately 16 hours after fertilization. We detect activities capable of specific binding to two known transcriptional regulatory elements, the serum response element and the GC-box, located in the 5'-flanking region of the cytoskeletal actin gene. Binding activity specific for a region downstream of the transcriptional startsite is also detected, in a region which may be involved in controlling developmental activation of this gene. Serum response element-binding activity, as well as the downstream binding activity, is enriched in extracts from gastrula and neurula stage embryos, compared to egg extracts, suggesting that increased levels of one or both of these activities might play a role in developmentally timed transcriptional activation of the cytoskeletal actin gene in the embryo. Key Words: DNA-binding proteins, Serum response element, GC box, Transcriptional regulation, Cytoskeletal actin gene

INTRODUCTION Regulation of transcription initiation by sequencespecific DNA-binding proteins has received a great deal of attention through recent biochemical and molecular biological analyses (Maniatis et al., 1987; Johnson and McKnight, 1989; Mitchell and Tjian, 1990). In contrast to the wealth of information now available regarding the maintenance of tissue-specific gene expression in differentiated cells, and transcriptional responses of various types of cultured cell to environmental perturbations, very little information has yet been obtained regarding mechanisms of transcriptional regulation in living embryos. Part of the reason for our limited understanding of the biochemistry of embryonic development lies in the difficulty of obtaining adequate amounts of experimental material from embryos and embryonic tissue. Because of their comparatively large size, amphibian embryos represent a uniquely suitable system for biochemical investigations of early developmental regula0 1991 WILEY-LISS, INC.

tory mechanisms. A great deal is known about many of the cellular and molecular aspects of early development in amphibians (Gerhart, 1980), providing a framework for the interpretation of new data, and encouraging the expectation that it may eventually be possible to correlate certain morphological phenomena with their biochemical antecedents. The recent explosion of knowledge concerning growth factor-mediated inductive interactions in amphibian embryos (Brennan, 1987; Smith, 1989; Whitman and Melton, 1989; Dawid et al., 1990) further attests to the suitability of this experimental system for molecular studies of early developmental regulatory processes. This laboratory has been investigating the mechanisms which control the initial transcriptional activation of the Xenopus Zaeuis cytoskeletal actin gene, which occurs at the mid-to-late gastrula stage of development, approximately 16 hours after fertilization (Brennan, 1990; Brennan and Savage, 1990).Our studies are motivated by the knowledge that processes of embryonic differentiation, initiated either by inductive interactions (Nieuwkoop, 1973) or inheritance of cytoplasmic determinants (e.g., Davidson, 19861, will ultiamtely be manifested in differential patterns of transcriptional activation among different embryonic cells (e.g., Rosa, 1989; Ruiz i Altaba and Melton, 1989). Hence, knowledge regarding mechanisms of transcriptional regulation in the embryo will be crucial to an understanding of these developmental processes. In previous experiments we have obtained evidence that the DNA sequences responsible for correct developmental activation of transcription of the cytoskeletal actin gene are situated between 90 nucleotides upstream and 560 nucleotides downstream of the transcriptional startsite (Brennan, 1990; Brennan and Savage, 1990; S. Brennan, 1991, in preparation). To gain further insight into the processes controlling initial transcriptional activation in the embryo, we have searched for DNA-binding proteins in extracts of amphibian embryos, using an electrophoretic mobilityshift assay (Garner and Revzin, 1981; Fried and Crothers, 1981; Varshavsky, 1987). Here, we characterize binding of embryo proteins to two specific promoter elements in the 5'-flanking region of the cyReceived February 11, 1991; accepted March 25, 1991. Address reprint requests to Dr. Sean Brennan, Department of Anatomy, School of Medicine, Univ. of Connecticut, Farmington, CT 06032.

324

J. VARLEY AND S. BRENNAN

The GC box probe is a 24-nucleotide duplex, repretoskeletal actin gene (the serum response element and the GC box) and also examine binding to sequences senting the sequence from -38 to -51 with respect to immediately downstream of the transcriptional start- the transcription start, with Eco RI ends: site, within the untranslated first exon of the gene. Formation of complexes with the serum response ele-51 -38 ment is developmentally regulated in the embryo, as is 5’AATTC ACT AGGCGGGGCGCGAATT the formation of certain complexes in the first exon. T TAAGTGATCCGCC CCGCGCTTAA5,. These specific protein-DNA interactions may thus be involved in control of initial transcriptional activation It was generated by annealing of two 20-mers to of the cytoskeletal actin gene. produce a duplex with Eco RI ends, which were subsequently labeled by “fill-in” with the Klenow fragment, MATERIALS AND METHODS as described above for the SRE probe. A specific activity Animals of approxiamtely 1 x lo6 cpmipmol was achieved. Probes for regions downstream of the transcriptional Animal care, in vitro fertilization, and culture of embryos have been described (Brennan, 1990). After startsite were obtained from a plasmid containing the dejellying, embryos were cultured in 0.1 X MBS (Gur- first exon of the X . laevis P-type cytoskeletal actin gene don, 1977) until they were harvested for extract prep- plus adjacent upstream and first intron sequences. For aration. Developmental stages were determined ac- convenience in the preparation of appropriate probes, the plasmid used for probe preparation contained a cording to Nieuwkoop and Faber (1967). 3-nucleotide insertion in the first exon of the gene (Brennan, 1990). Probes were prepared by restriction Preparation of Embryo Protein Extracts endonuclease digestion of appropriate plasmids, endThe procedure was based on that initially described by Blow and Laskey (1986). At the appropriate devel- labeling with the Klenow fragment of E. coli DNA opmental stage, groups of several hundred embryos Polymerase I, secondary restriction endonuclease diwere washed several times, on ice, with cold homoge- gestion, and electrophoresis on nondenaturing 5%acrylnization buffer (50 mM Na HEPES, pH 7.5, 50 mM amide gels (0.5 mm thick) in 50 mM Tris-borate, pH KC1,5 mM MgCl,, 5 mM DTT, 40 pgiml PMSF, 50 pgi 8.3,2.5 mM EDTA. Bands were located by autoradiogml TLCK, 50 pgiml leupeptin, 100 pgiml aprotinin). raphy, excised from the gel, and DNA eluted by overWashing was done in a glass petri dish; after the final night incubation of the intact gel slice at 37°C in 0.3 M wash, embryos were transferred to a 1.5 ml microcen- sodium acetate, followed by addition of carrier glycogen trifuge tube, using a wide-bore Pasteur pipette. Inter- and precipitation from ethanol. Specific activities of stitial buffer was removed with a drawn-out Pasteur 1 x l o 7 cpm/pmol DNA fragment were obtained. pipette and the embryos were centrifuged at 10,OOOgfor Binding Reactions 15min at 4°C. The liquid fraction located above the yolk pellet and underneath the fat cake was removed Standard conditions for the assay of protein-DNA and re-centrifuged at 100,OOOg for 30 min at 4°C in a binding were 25 mM Na-HEPES, pH 7.5, 10 mM Beckman TL-100 ultracentrifuge. The S-100 fraction MgC12, 100 mM NaC1, 1 mM DTT, 0.1 mM EDTA, 1% was brought to 10% (viv) glycerol and divided into (v/v) Triton X-100, 1%(wiv) polyethylene glycol 8000, aliquots. These were quick-frozen in liquid nitrogen 0.1 mglml poly(d1-dC):(dI-dC).Amounts of probe and and stored at -75°C. extract protein are given in the figure legends. The final volume of the binding reaction was 10 pl. Extract Preparation and Labeling of Probes was preincubated with all other reaction components in The probe for the Xenopus cytoskeletal actin gene the absence of probe for 10 min at 20°C; after addition serum response element (nucleotides -64 to -89 with of probe, incubation at 20°C was continued for an respect to the transcription start) is a 36-base pair, additional 20 min. The reaction mixture was then double-stranded oligonucleotide with the following se- adjusted to 4% (v/v) glycerol and 0.04% (wiv) brompheno1 blue and immediately subjected to electrophoresis. quence: Electrophoresis was conducted on gels (20 x 20 - 89 - 64 x 0.75 mm) containing 4% (wiv)acrylamide (crosslinking ratio 1:30), 50 mM Tris-borate, pH 8.3, 2.5 mM EDTA. “AATTC AAAGATGCCCATATTTGGCGATCTTCGAATT TT AAGT T T C TACGGGTATAAACCGCTAGAAGCTTAA5,.Running buffer was 50 mM Tris-borate, pH 8.3,2.5 mM EDTA. Gels were prerun for at least 1hour at 100 volts, Two 32-mers were annealed to generate a duplex and electrophoresis of binding reactions was conducted containing Eco RI cohesive ends. The duplex was for approximately 3 hours at 100 volts at room temperlabeled to a specific activity of approximately 1.5 x ature. Gels were fixed in 10% methanol, 7.5% acetic lo7 cpm/pmol by incorporation of dTTP and acid, dried, and subjected to autoradiography using dATP with the Klenow Fragment of Escherichia coli pre-exposed X-ray film and intensifying screens (LasDNA Polymerase I. key, 1980).

DEVELOPMENTAL REGULATION OF SRE Competitors Various unlabeled oligonucleotides and plasmids were used as competitors to characterize the specificity of interactions detected by the electrophoretic mobilityshift assay. The SRE and GC box oligonucleotides described above were used (unlabeled) as competitors in the experiments shown in Figures 1A and 10. The actin gene plasmid (pBA-3)used as competitor contains the entire X . Zaevis cytoskeletal actin gene, including 485 nucleotides of 5’-flanking sequence, cloned into the Bluescript KS’ vector and has been described (Brennan and Savage, 1990). Two mutants of pBA-3, lacking specific upstream sequence motifs, were also used as competitors. SRE rep is identical with pBA-3 except for the replacement of 26 nucleotides constituting the serum response element (Brennan and Savage, 19901, while GC rep contains a 10-nucleotide substitution of the GC box in an otherwise wild-type cytoskeleta1 actin gene (S. Brennan and M. Davis, unpublished). In all cases, the vector was Strategene’s Bluescript KS’ plasmid. RESULTS Serum Response Element-Binding Activity A conserved DNA sequence known as the serum response element (SRE) has been shown to regulate transcriptional activation in both yeast (Hayes et al., 1988) and mammalian cells (Treisman, 1986; Greenberg et al., 1987). Determination of the nucleotide sequence of the Xenopus cytoskeletal actin gene originally revealed the presence of a SRE within the 5‘flanking region of the gene (Mohun et al., 1987; see Fig. 6A of this paper). Other experiments led to the detection of an activity, in oocytes (Mohun et al., 1987) and embryos (Taylor et al., 1989), capable of binding to the cytoskeletal actin SRE. We initially chose to examine binding to the SRE, since a shorter sequence constituting the core of the SRE, known as a CArG box, has been implicated in the transcriptional regulation of muscle-specific actin genes in both mammals (Minty and Kedes, 1986) and amphibians (Mohun et al., 1989). In addition, the established presence of SRE binding activity in the amphibian embryo would serve as a good indicator of the efficacy of our binding assay. Accordingly, we prepared whole-cell extracts from blastula-stage embryos and incubated these extracts with a 36-nucleotide double-stranded oligonucleotide containing sequences located between -64 and -89 with respect to the transcriptional startsite of the X . Zaevis cytoskeletal actin gene, representing the cytoskeletal actin gene SRE (sequence given in “Materials and Methods” and location of SRE shown in Fig. 6A). Typical results are shown in Figure 1. Titration of an extract from blastula-stage embryos shows that formation of two complexes increases in parallel with protein concentration (Fig. 1A: leftmost four lanes). Specificity of the interaction is indicated by the ability of unlabeled SRE

325

oligonucleotide to inhibit formation of the most slowly migrating band, coupled with the failure of an oligonucleotide containing the sequence of the GC-box to compete (Fig. 1A: rightmost two lanes). The more rapidly migrating band appears to represent a nonspecific protein-DNA association. Additional experiments utilizing an extract from neurula-stage embryos yield four complexes, compared to the two obtained with the gastrula extract. Competition experiments reveal that a plasmid containing an entire cytoskeletal actin gene efficiently inhibits the formation of all four complexes (Fig. lB, lanes 3-5). A vector plasmid competes less efficiently for the three most slowly migrating complexes, but appears to be a more efficient competitor for the most rapidly migrating complex (Fig. lB, lanes 6-8). Thus, three of the four complexes detected appear to represent specific interactions of embryo proteins with the SRE. We confirm below that formation of the two most slowly migrating complexes generated by the neurula extract is developmentally regulated (Fig. 9). We have characterized several parameters of the binding reaction involving the SRE oligonucleotide, including pH and monovalent cation optima, as well as divalent cation requirements. There appears to be little effect of pH, as approximately equivalent levels of the two more slowly migrating bands are detected over the range 6.0 to 9.6, with slightly diminished binding at pH 4.9 (Fig. 2). However, we note that subtle variations in the relative degree of specific and nonspecific binding occur in the lower pH range (e.g., note the absence of the nonspecific complex at pH 4.9 and pH 6). Inclusion of various divalent cations in the binding reaction indicate that specific binding occurs in the absence of divalent cation and in the presence of Mg2+ and Ca2+ (Fig. 3). Binding is also observed,in the presence of Mn2+,but its level is difficult to establish, due to Mn2+-catalyzed degradation of the probe. No binding is detected with Cu2+, Cd2+, Co2+, or Ni2+, while formation of the nonspecific complex and the most rapidly migrating specific complex is enhanced in the presence of Zn2+ (Fig. 3). These results might reflect a disruption of higher-order complexes by Zn2+ ion. Determination of NaCl and KC1 optima revealed that specific complex formation is most efficient at NaCl or KC1 concentrations of 10 mM or below; concentrations of 100 mM or above increased the level of nonspecific binding (data not shown).

GC Box-Binding Activity The GC box is a binding site for the transcription factor Spl (Dynan and ‘I)ian, 1983; Briggs et al., 19861, which is believed to serve as a basal transcription factor for many mammalian genes (Kadonaga et al., 1986). Spl binding to GC box elements has been shown to act in concert with other DNA-protein complexes to direct transcription of mammalian genes for growth hormone (Schaufele et al., 1990) and cardiac actin (Sartorelli et al., 1990). A GC box is located between 41 and 50

326

J. VARLEY AND S. BRENNAN pI of extract:

-

competitor:

- -

molarexcess:

- -

w

1 soecific

10

50

nonsoecific

100 10

50

100

1

SPECIFIC COMPLEXES

-

competitor: pI of extract:

SPECIFIC COMPLEX

+

NONSPECIFIC COMPLEX

+

= Q )

- - . g g 0.51 2

2

2

1

NONSPECIFIC COMPLEXES

try

1I

PROBE

Fig. 1. Specific binding to the serum response element by Xenopus embryo protein. A A 36 base-pair double-stranded oligonucleotide, containing the sequence of the Xenopus cytoskeletal actin gene SRE, was labeled with 32P to a specific activity of 5.7 x lo7 cpmiug and incubated with increasing amounts of a protein extract from blastula stage Xenopus embryos, in the absence or presence of oligonucleotide competitors. Binding reactions contained 83 fmole of probe, corresponding to 1 x lo5 cpm. Homologous competitor was the unlabeled probe, and the heterologous competitor was a 24-nucleotide doublestranded oligonucleotide containing the sequence of the cytoskeletal actin gene GC box. Competitors were present a t a 100-fold molar excess, with respect to probe. Complexes were detected by electrophoresis of the binding reaction on a 4% acrylamide gel. An autoradiograph of the gel is shown. Further details on the probe and binding

reaction conditions are found in “Materials and Methods.” B The same probe was used (at the same concentration) as in A, but extract was from neurula embryos and plasmid competitors were used. Lane 1 contains no extract; all other lanes contain 10 pg of embryo protein. Lane 2 shows complex formation in the absence of competitor; in lanes 3-5, a plasmid containing the entire Xenopus laevis cytoskeletal actin gene (including 485 nucleotides of upstream sequence) was used as competitor, and in lanes 6-8, the competitive ability of a vector plasmid containing no actin sequences is tested. The molar ratios of competitor, with respect to probe, are ten-fold in lanes 3 and 6,50-fold in lanes 4 and 7, and 100-fold in lanes 5 and 8. Note that this extract yields four complexes, compared to the two produced by the blastula extract used in A.

nucleotides upstream of the transcriptional startsite of the Xenopus cytoskeletal actin gene (Fig. 6A). We wished to determine whether GC box binding activity could be detected in Xenopus embryos and, if so, whether it was developmentally regulated. Accordingly, we searched for embryo proteins that interact with this regulatory element, using a 24-base pair, double-stranded oligonucleotide probe (see “Materials and Methods” for sequence and Fig. 6A for location of the GC box). Experiments involving extract titration and competition with various plasmids, similar to those described above for the SRE, were conducted using the GC box oligonucleotide probe (Fig. 4). As shown in lane 2, we

detect activity in embryonic protein extracts capable of binding to the GC box oligonucleotide. Formation of the more slowly migrating of the two complexes is sequence-specific, as shown by the ability of unlabeled wild-type actin gene plasmids to reduce the level of this complex (lanes 3-51, and the failure of vector plasmid to inhibit complex formation (lanes 6-8). In addition, competition by mutant cytoskeletal actin plasmids containing replacements of sequence elements in the 5’-flanking region supports this conclusion. Specifically, an actin gene plasmid whose GC box has been substituted by unrelated sequence (S.Brennan and M. Davis, unpublished) is unable to compete (lanes 10-121, while a replacement mutant of the SRE, whose GC box

DEVELOPMENTAL REGULATION OF SRE

4 f

Fig. 2. Effect of pH on the binding of embryo protein to the SRE oligonucleotide. Binding reactions contained 42 fmole (50,000 cpm) of SRE oligonucleotide and 10 pg of total protein from neurula stage embryos. Binding conditions were as described in “Materials and Methods,” except that Na-HEPES was substituted by various other buffers (each a t 25 mM) and 20 mM KCl was used in place of 100 mM NaCl. Buffers were as follows. Lane 1: Na-acetate, pH 4.9. Lane 2 MES-Cl, pH 6.0. Lane 3 MES-CI, pH 6.5. Lane 4 Na-cacodylate, pH 6.6. Lane 5: Na-MOPS, pH 7.0. Lane 6: Tris-C1, pH 7.6. Lane 7: Tris-acetate, pH 7.9. Lane 8:Tris-C1, pH 8.0. Lane 9 Tris-C1, pH 8.3. Lane 1 0 Na-borate, pH 9.2. Lane 11: Na-glycine, pH 9.6. The pH at which the binding reaction was conducted is indicated above each lane.

is unchanged (Brennan and Savage, 19901, competes efficiently (lanes 13-15). The ability of all four competitors to inhibit formation of the more rapidly migrating complex (Fig. 4) suggests that it is due to nonspecific interaction of embryo protein with the probe. Several biochemical parameters of the GC box binding activity were investigated. Compared to the SRE binding activity, binding to the GC box was slightly more sensitive to extremes of pH, with maximal binding occurring at pH values between 6.6 and 7.9 (Fig. 5) and no complex formation detected at pH 4.9. Binding occurred in the absence of monovalent cation, but was stimulated several-fold at NaCl or KC1 concentrations of 100-200 mM (data not shown). Divalent cation requirements were similar to those determined for the SRE binding activity, with maximal binding occurring in the presence of Mg2+and Ca2+,slightly less binding in the absence of divalent cation, and weak binding in the presence of Mn2+ and Zn2+ (data not shown). No binding is detected when Cu2+,Cd2+,Co2+,or Ni2+ are present as the sole divalent cation in the binding reaction.

C

0 s

a 5 B

8

rs

327

f

Fig. 3. Divalent cation requirements for binding to the SRE. Binding reactions contained 42 fmole of SRE oligonucleotide probe (50,000 cpm) and no extract (lane 1)or 10 pg of extract protein from neurula stage embryos (lanes 2-10). Other conditions were as described in “Materials and Methods,” except that the NaCl concentration was 10 mM and Mg2+was omitted from the binding reaction (lane 3) or replaced by various other divalent cations, each at 10 mM (lanes 4-10), Divalent cations that were substituted for Mg2+are indicated a t the top of the figure. Binding in the absence of added divalent cations is indicated in the lane labeled “0.”

Binding to Downstream Sequences in the Cytoskeletal Actin Gene Our experiments involving in vitro mutagenesis of actin gene plasmids, followed by microinjection into living embryos and functional testing of various mutated genes, suggest that either the SRE or the GC box is necessary, but not sufficient, for correct developmental activation of the gene (Brennan and Savage, 1990; S. Brennan, M. Davis, A. Lekven, and L. Sumoy, unpublished). We therefore wished to examine other regions of the gene for sites of DNA-protein interaction and investigate the developmental specificity of any such interactions we detected. We began by using a DNA fragment containing 70 nucleotides of 5’-flanking sequence, the first exon of the cytoskeletal actin gene (88 nucleotides long for this variant of the gene, see “Materials and Methods”) and the first 19 nucleotides of the first intron, as a probe in gel mobility-shift experiments (probe “A’ in Fig. 6A).

328

J. VARLEY AND S. BRENNAN 0

EXTRACT (hl)

0.5

actin

COMPETITOR

MOLAR EXCESS

COMPLEXES

PROBE

0

0

10 50 100

vector 10 50 100

0

GC rep

SRE rep

10 50 100

10 50 100

[

r L

Fig. 4. Specific binding of embryo protein to a n oligonucleotide bearing the sequence of the cytoskeletal actin gene GC box. Binding reaction conditions were as specified in “Materials and Methods.” Each reaction contained 100 fmole (100,000 cpm) of a 24 base pair, double-stranded oligonucleotide representing the sequence of the Xenopus cytoskeletal actin GC box (see “Materials and Methods” for the sequence), and no extract (lane 1) or 5 kg extract protein from neurula embryos (lanes2-15). Various plasmid DNAs were added to the binding reactions shown in lanes 3-15 to assess the specificity of the interactions detected in lanes 2 and 9. Lanes 3-5 contain

increasing concentrations of a cytoskeletal actin gene plasmid; lanes 6-8 contain increasing amounts of a vector plasmid (nonspecific competitor);in lanes 10-12, a cytoskeletal actin gene plasmid bearing a mutated GC box is used as competitor; lanes 13-15 contain an actin gene plasmid with a mutated SRE. The molar excess of unlabeled competitor to probe is ten-fold in lanes 3,6,10, and 13; 50-fold in lanes 4,7, 11, and 14; and 100-fold in lanes 5, 8, 12, and 15. Positions of migration of free probe and DNA-protein complexes are indicated to the left of the figure.

This 177-nucleotide fragment includes the TATA box and GC box from the upstream region of the gene, but lacks the SRE (Fig. 6A). Using extracts from late gastrulalearly neurula-stage embryos, we detect six complexes on this probe (Fig. 6B, lanes 3-5), all of which are competed by an actin gene plasmid (Fig. 6B, lanes 6-8) but not by vector plasmid (data not shown). Experiments investigating monovalent cation requirements for complex formation show coordinate inhibition of all complexes at NaCl or KCl concentrations above 200 mM (data not shown). Below monovalent cation concentrations of 50 mM, degradation of the

probe is observed, presumably due t o the presence of a salt-sensitive nuclease in the extract. The pH profile for binding to this probe differs from that observed for the two oligonucleotides described above. Below pH 7.0, very little complex formation is observed, while equivalent levels of complex formation are detected at pH values between 7.9 and 9.6 (Fig. 7). Formation of the more slowly migrating complexes appears to be maximally sensitive between pH 6.6 and 7.6. Divalent cation requirements also differ from those observed with the oligonucleotide probes (Fig. 8). For-

DEVELOPMENTAL REGULATION OF SRE

329

Fig. 5. Effect of pH on binding of embryo protein to a GC box oligonucleotide. Binding reactions included 50 fmole (50,000 cpm) of GC box oligonucleotideprobe and 5 pg of extract protein from neurula stage embryos, Other conditions were as specified in “Materials and Methods,” except that other buffers were substituted for Na-HEPES, each a t 25 mM. Buffers were as follows. Lane 1: MES-C1, pH 6.0. Lane 2 MES-C1, pH 6.5. Lane 3 Na-cacodylate, pH 6.6. Lane 4 Na-MOPS,

pH 7.0. Lane 5 Tris-C1, pH 7.6. Lane 6 Tris-acetate, pH 7.9. Lane 7: Tris-C1, pH 8.0. Lane 8: Tris-C1, pH 8.3. Lane 9 Na-borate, pH 9.2. Lane 10: Na-glycine, pH 9.6. The pH at which the binding reaction was conducted is indicated above each lane. A reaction was also conducted in the presence of 25 mM Na acetate, pH 4.9; no binding was observed.

mation of the two most slowly migrating complexes is greatly reduced in the absence of added divalent cation, and is stronger in the presence of Ca2+ than of Mg2+ (Fig. 8). Several novel complexes are also detected in the presence of divalent cations other than Mg2+.For instance, two new complexes (located between the second and third most slowly migrating complexes formed in the presence of Mg2+) are formed in the presence of Ca2+;the more slowly migrating of these two Ca2+-specificcomplexes also appears to be formed in the presence of Zn2+.Another new, rapidly migrating complex is formed in the presence of Zn2+,as well as Cu2+and Cd2+,and is the sole complex formed in the presence of the latter two cations. We also note that, as with the oligonucleotides, Mn2+ ion appears to be capable of catalyzing cleavage of this probe, as evidenced by the presence of a smear of labeled material migrating more rapidly than probe in the Mn2+lane of Figure 8. These results have several implications. First, they suggest that the two most slowly migrating complexes formed on this probe do not involve binding to the GC box (which is present in this probe, Fig. 6A), since binding to a GC box oligonucleotide is relatively insensitive to pH between 6.0 and 9.6 (Fig. 5). Further

support for this conclusion comes from the observation that an actin gene with a mutant GC box is able to compete all specific complexes on this probe (data not shown) and a GC box oligonucleotide fails to compete the two most slowly migrating complexes (data not shown). Second, the failure to resolve complexes by differential salt sensitivity may indicate that the six retarded bands represent different higher-order complexes formed on the same DNA site. A likely candidate for such a site is the TATA Box, for it has been shown that, after initial binding of the transcription factor TFIID to this site, preinitiation complexes consisting of up to five proteins can be assembled (Reinberg and Roeder, 1987; Buratowski et al., 1989). If the binding of Xenopus TFIID protein to the actin gene TATA box were sensitive to salt concentrations above 200 mM, and all other complexes were built onto the TFIID-TATA binary complex, it would explain the results observed here. Although certain complexes appear to exhibit differential response to variations in pH and divalent cations, it is possible that these two reaction parameters are affecting protein-protein interactions, especially since it is the most slowly migrating complexes (presumably containing the greatest number of proteins) which are

330

J. VARLEY AND S. BRENNAN

--.

.-CAAT CAAT

A

SRE

GC

TATA

Start

t

t

177A ntds

pgof competitor: PI of extract:

COMPLEXES

- - - - 0

0.5

1

2

4

0.5 1.0 2.0

4

4

4

[

PROBE +

B Fig. 6 . Binding of embryo proteins to sequences in the vicinity of the transcription startsite. A The map on the top line shows the location of sequence elements in the 5’-flanking region of the Xenopus cytoskeletal actin gene that are homologous to known regulatory elements in other genes. These include two CAAT boxes, a SRE, a GC box, and a TATA box. The open box represents the first exon, with the arrow indicating the site and direction of transcription initiation. Numerals refer to distance, in nucleotide pairs, from the transcriptional startsite. The extent of gene sequence covered by the two restriction fragments used as probes is indicated beneath the map.

most sensitive to divalent cation and pH. The variations in complex formation induced by divalent cation substitution, combined with the more subtle pH dependence of formation of certain complexes, may eventually be exploited to determine the identity and composition of the complexes formed on this probe. Binding experiments using another fragment from the same plasmid, consisting exclusively of vector sequences, showed no evidence for specific complex formation (data not shown).

Developmental Regulation of DNA-Binding Activity We attempted to test whether any of the DNAprotein complexes we have detected might be involved in the developmentally timed transcriptional activation of the cytoskeletal actin gene, which occurs at the mid-to-late gastrula stage (Brennan, 1990, 1991). To this end, we prepared extracts from unfertilized eggs, mid-gastrula embryos (stage l l V 2 , Nieuwkoop and Faber, 19671, and late neurula embryos (stage 20). We then compared these extracts for their ability t o bind to

B: Binding reactions were conducted with the probe labeled “A’ in the map above and protein extract from late gastrula stage embryos. Four fmoles of probe (25,000cpm) was incubated with various concentrations of extract under conditions described in “Materials and Methods,” except that the binding buffer lacked polyethylene glycol and 20 mM KCI was used instead of 100 mM NaC1. The protein concentration of the extract used in this experiment was 6 mgiml and the competitor was a plasmid containing the entire Xenopus laevis cytoskeletal actin gene, including 485 nucleotides of 5‘-flanking sequence.

the SRE and GC box probes. Several developmentspecific differences in the binding of the SRE oligonucleotide can be detected (Fig. 9). First, formation of the most slowly migrating complex is greatly enhanced in the gastrula extract, compared to unfertilized eggs (Fig. 9, compare lanes E and G in the absence of competitor). Second, the SRE probe enters a unique shifted band in the presence of neurula extract (Fig. 9, compare lane N with lanes E and G in the absence of competitor). Formation of both the gastrula-enriched and the neurula-specific complexes is competed by the SRE oligonucleotide and by an actin gene plasmid, while a GC box oligonucleotide and a vector plasmid fail to compete (Fig. 9), indicating that these complexes result from a specific interaction of an embryo protein with the SRE. The level of the most slowly migrating complex is reduced in neurula extracts, compared to gastrula extracts (Fig. 9, compare lanes G and N in the absence of competitor); it is possible that the most slowly migrating complex formed with the gastrula extract represents a precursor to the neurula-specific complex.

DEVELOPMENTAL REGULATION OF SRE

331

Fig. 7. Effect of pH on the binding of embryo proteins to sequences in the vicinity of the transcriptional startsite. In this experiment, 20 fmole (50,000cpm) ofprobe A (as defined in Fig. 6A) was incubated with 20 pg of extract protein from neurula stage embryos. Binding conditions were as described in “Materials and Methods,” except that Na-HEPES was substituted by other buffers, each at 25 mM. Buffers were as follows. Lane 1: Na-acetate, pH 4.9. Lane 2: MES-CI, pH 6.0.

Lane 3: MES-Cl, pH 6.5. Lane 4 Na-cacodylate, pH 6.6. Lane 5: PIPES-CI, pH 7.0. Lane 6 Na-MOPS, pH 7.0. Lane 7: Tris-CI, pH 7.6. Lane 8: Tris-acetate, pH 7.9. Lane 9 ‘his-C1, pH 8.0. Lane 10 Tris-CI, pH 8.3. Lane 11: Na-borate, pH 9.2. Lane 12 Na-glycine, pH 9.6. The pH at which the binding reaction was conducted is indicated above each lane.

In similar experiments utilizing the GC box oligonucleotide as probe, we detected neither qualitative nor quantitative differences in binding activity among the three extracts (data not shown). The egg, gastrula, and neurula extracts were also incubated with a restriction fragment probe that is slightly shorter than that used above, lacking all upstream sequences and the proximal region of the first exon (probe B, see Fig. 6A), so that factors which bind to the GC box and TATA box will not be detected. We detect the formation of several complexes using this probe (Fig. lo), two of which (indicated by arrows) are enriched in extracts from gastrula and neurula embryos compared to unfertilized eggs (Fig. 10, compare lane E with lanes G and N in the absence of competitor). Unexpectedly, formation of these two developmental stage-specific complexes is competed by both SRE and GC box oligonucleotides (Fig. lo), even though the probe contains neither of these sequence elements. We speculate that the two most slowly migrating bands may represent multiprotein complexes which contain, among their protein components, the factors which bind to the upstream SRE and GC box sequences. Competition with either the SRE or GC box oligonucleotide might thus be expected to remove the cognate protein from the complex, leading either to the forma-

tion of more rapidly migrating complexes containing fewer proteins, or to dissociation of the complex. Support for this speculation is provided by the appearance of additional complexes of higher mobility (presumably containing fewer proteins) in binding reactions containing SRE or GC box competitors (in the region indicated by the bracket in Fig. 10). Further experiments, involving the use of agents which dissociate multiprotein complexes (e.g., Baeuerle and Baltimore, 1988;Bagchi,et al., 1990),will be required to clarify the nature of these apparently development-specific complexes. Nonetheless, it is clear that there are developmentally regulated differences in the ability of embryo proteins to bind to this region of the gene.

DISCUSSION The acquisition of form and pattern during embryonic development occurs through the coordination and integration of a series of molecular, biochemical, cellular, and extracellular events. In previous work from this laboratory, we have studied some of the molecular requirements for temporally controlled transcriptional regulation in the amphibian embryo (Brennan, 1990; Brennan and Savage, 1990). Here, we begin to investigate the biochemical basis of this regulation. Several models for biochemical mechanisms regulat-

332

J. VARLEY AND S. BRENNAN

Fig. 8. Effects of different divalent cations on binding of embryo proteins to sequences in the vicinity of the transcriptional startsite. Binding reactions contained 20 fmole (50,000 cpm) of probe A (see Fig. 6A) and no extract (lane 1) or 20 pg of extract protein from neurula stage embryos (lanes 2-10). Other conditions were as described in “Materials and Methods,” except that the NaCl concentration was 10 mM and Mg2+was omitted from the binding reaction (lane 3) or replaced by various other divalent cations, each at 10mM (lanes 4-10), Divalent cations that were substituted for Mg2+are indicated at the top of the figure. Binding in the absence of added divalent cations is indicated in the lane labeled “0.”

ing developmentally timed gene transcription in the embryo may be considered. A positively acting factor controlling activation of a gene or group of genes might be synthesized or activated at a particular time in development, leading shortly thereafter to transcriptional activation. Alternatively, the initial transcription of a gene in the embryo may have to await the production of sufficient amounts of one or more basal transcription factors. In this case, gene activation would be regulated by the rate of accumulation of such basal factors. Yet another possibility is that genespecific temporal activating factors (as in the first example above) exert their developmental effects via interaction with basal promoter elements. We are

attempting to distinguish among these (or other) possibilities by examining embryo extracts for the presence of proteins which bind in the vicinity of the transcriptional startsite of the Xenopus laeuis cytoskeleta1 actin gene, which undergoes developmentally timed transcriptional activation during gastrulation in the Xenopus embryo. We have studied the binding of embryo proteins to two specific upstream sequences (the SRE and the GC box), and we have also searched for novel sites of protein binding downstream of the transcriptional startsite. We find that embryos contain large amounts of proteins which bind to the two upstream promoter elements (the serum response element and the GC box). Binding is specific, as shown by competition experiments (Fig. 1 for SRE, Fig. 4 for GC box) and both qualitative and quantitative changes in SRE binding activity occur as the embryo develops (Fig. 9). We have not eliminated the possibility that the SRE-binding protein responsible for the formation of the most slowly migrating complex undergoes limited proteolysis in the neurula extract, leading to the production of the novel complex obtained with neurula extracts. If this is the case, it might indicate that only quantitative changes in SRE-binding ability are occurring during early development. Alternatively, developmentally regulated proteolysis of an SRE-binding protein might be occurring in vivo and may influence the regulatory properties of the protein. Others have demonstrated the existence of a factor in oocytes (i.e., prior to fertilization) capable of binding to the cytoskeletal actin SRE (Mohun et al., 1987). Additional work from the same laboratory has shown that an activity capable of binding to the “CArG box,” a SRE-related sequence in the cardiac muscle actin gene, is present in neurula-stage embryos and is able to bind to the SRE, making it likely that both binding activities reside in the same protein (Taylor et al., 1989). These authors reported not more that a two-fold variation in levels (our estimate from the published autoradiogram) and no qualitative differences in CArG box-binding activity at all stages from fertilized egg through neurula (Mohun et al., 1989). Although we confirm the existence of SRE-binding activity at all stages of early development, we detect greater variation in its activity. In particular, we observe increased levels of specific binding activity in gastrula-stage embryos, compared to unfertilized eggs, and we observe a unique complex formed with extracts from neurula embryos, that is not present in binding reactions containing egg or gastrula extracts (Fig. 9). It is possible that the discrepancy between our results and theirs reflects the different probes used in the binding analyses: a CArG box in one case (Mohun et al., 1989) and a SRE in the other (this work). If this is so, it would imply that two binding activities of a single protein are differentially regulated during development; i.e., CArG box binding activity remains constant, while SRE binding activity increases. Alternatively, the differ-

DEVELOPMENTAL REGULATION OF SRE

EXTRACT

SRE

None

COMPETITOR: .

E

G

GCbox

orso N

E

G

actin

orso

N

E

G

vector

Qene

N

E

G

333

N

E

G

N

Fig. 9. Developmental regulation of SRE-binding activity. Binding reactions were conducted as described in “Materials and Methods,” with 42fmole of SRE oligonucleotide probe (50,000cpm) and no extract (leftmost lane), 10 pg extract protein from unfertilized eggs (lanes labeled “E”), 10 pg of extract protein from gastrula embryos (lanes “G”),or 10 pg of extract protein from neurula embryos (lanes “N”). In the leftmost four lanes, binding reactions were performed in the absence of competitor; for the remainder of the experiment, a

100-fold molar excess of unlabeled competitor was included. The identity of the competitor included in each series of binding reactions is indicated a t the top of the figure, above the exact designations. Note the increase in SRE binding activity between egg and gastrula stages, and the appearance of a new complex at the neurula stage. Formation of the new complex is competed by the SRE oligonucleotide and the complete actin gene, but not by GC box oligonucleotide or vector plasmid.

ences in our results could be explained by differences in extract preparation. Formation of multiple complexes on an SRE oligonucleotide (such as we observe in Figs. 1 and 9) has been shown, in a mammalian system, to reflect the binding of multiple proteins to the SRE. Specifically, binary complexes containing the 67 kD SRF protein (Treisman, 1987) bound t o the SRE can be resolved from ternary complexes containing SRE DNA, the 67 kD SRF protein, and a 62 kD protein (Shaw et al., 1989). A binary complex of the 62 kD protein with the SRE is never detected, suggesting that the substrate for 62 kD protein-binding is the SRE-SRF complex (Shaw et al., 1989). The multiple bands which we observe on mobility-shift gels, when using the SRE oligonucleotide as probe, might reflect the formation of similar higherorder complexes. In terms of the models for transcriptional activation discussed above, our results are compatible with the idea that constant amounts of a p67 SRF-like activity are present at all stages of development, while levels of a second, p62-like protein increase and are responsible for the formation of one or both of the gastrula-enriched and the neuruka-specific complexes. If this is true, it is possible that developmentally

timed transcriptional activation of the actin gene may be regulated by levels of a p62-like protein. Another finding relevant to this point is our observation that, when extracts are fractionated on a heparin-agarose column, a decrease in complex formation‘ on the SRE oligonucleotide is observed with fractions that are retained by the column (J. Varley and S. Brennan, unpublished). It is interesting to note that Shaw et al. (1989) and Ryan et al. (1989)both state that the non-DNA-binding, 62 kD protein mentioned above is not retained on heparin-agarose. Loss of an accessory binding protein might therefore explain the loss of SRE binding we observe with material retained on heparinagarose. Previous experiments from this laboratory have presented evidence that the upstream SRE is not necessary for correct developmental regulation of the cytoskeletal actin gene in the embryo (Brennan and Savage, 1990). At first sight, those previous results appear incompatible with the observation of increased SRE binding activity during the developmental period when the gene is first transcribed. However, there are several possible explanations for this seeming discrepancy. If the upstream SRE is, in fact, involved in developmental

334

J. VARLEY AND S. BRENNAN COMPETITOR:

None E

G

N

E

SRE

GC box

diso

o&P

G

N

E

G

N

Fig. 10. Developmentally regulated DNA-binding activity specific for sequences in the first exon of the cytoskeletal actin gene. Binding reactions were performed as described in “Materials and Methods,” using 4.5 fmole (50,000 cpm) per reaction of probe B (see Fig. 6A). The lane on the far left contained no extract. Lanes labeled “E” contained

40 pg of unfertilized egg extract, those labeled “G” contained 10 pg of protein from gastrula-stage embryos, and those labeled “N”contained 10 pg of neurula extract. SRE and GC box oligonucleotidecompetitors were included a t 50-fold molar excess to probe.

activation of transcription, its function may be redundant. This would imply the existence of some other sequence element whose binding protein would also be expected to increase during early development. From the data we have obtained, we know that, if such another sequence exists, it cannot be the GC box, since we do not detect increases in its binding activity during the time when SRE binding is increasing (J.Varley and S. Brennan, unpublished). An alternative possibility is that the developmentally regulated complexes that form on the SRE oligonucleotide in vitro reflect the existence of a protein (or proteins) that binds with much greater affinity, in vivo, to a related sequence located elsewhere in the gene. Under normal intracellular conditions, such a protein would bind preferentially to this other sequence to mediate developmental activation; under the conditions of our experiment, in which there is no competition by its normal binding site, binding to the SRE is detected. We have some support for this idea, as we observe competition of SRE oligonucleotide binding with actin gene mutants lacking the upstream SRE (J. Varley and s. Brennan, unpublished). We have also obtained evidence for the existence of multiple protein-DNA complexes on a DNA fragment

consisting of sequences downstream of the transcriptional startsite, containing most of the first (untranslated) exon and a small portion of the first intron of the gene. Once again, certain of the complexes observed with this probe are more abundant in gastrula and neurula stage embryos, compared to unfertilized eggs (Fig. 10).It is now important to map the sites of binding in this region more precisely, and compare the locations of protein-binding sites to important developmental regulatory sequences identified by in vitro mutagenesis (S. Brennan, in preparation; S. Brennan, M. Davis, A. Lekven, and L. Sumoy, unpublished). In addition, we plan to prepare extracts from a wider range of developmental stages, to determine more precisely when the increases in binding activity are occurring. Proteins regulating various aspects of embryonic transcription have recently been studied in several other systems. Investigations of the regulation of epidermal keratin gene expression in Xenopus embryos have recently identified a protein that may play a role in developmental regulation of keratin gene transcription (Snape et al., 1990). In addition, studies of transcriptional regulation in the sea urchin embryo have revealed the existence of a protein, whose activity is restricted to ectodermal tissue, that binds within the

DEVELOPMENTAL REGULATION OF SRE first exon of the ectoderm-specific Spec 1 gene (Tomlinson et al., 1990) and may therefore be involved in regional regulation of its expression. Finally, a plethora of protein-DNA interactions between sea urchin embryo nuclear proteins and a sea urchin cytoskeletal actin gene has been described (Calzone et al., 1988; Theze et al., 19901,and the contribution of each of these interactions to the temporal and regional regulation of gene activity is beginning to be addressed (Franks et al., 1990; Hough-Evans et al., 1990). Further work in this laboratory will focus on the nature and composition of the developmentally regulated complexes formed within the first exon of the Xenopus cytoskeletal actin gene, and will explore in greater detail the developmental regulation of serum response element binding activity.

335

discriminate between different promoters recognized by RNA polymerase 11. Cell 32:669-680. Franks RR, Anderson R, Moore JG, Hough-Evans BR, Britten RJ, Davidson EH (1990): Competitive titration in living sea urchin embryos of regulatory factors required for expression of the CyIIIa actin gene. Development 110:3140. Fried M, Crothers DM (1981):Equilibria and kinetics of lac repressoroperator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res 9:6505-6525. Garner MM, Revzin A (1981): A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: applications to components of the Escherichia coli lactose operon regulatory system. Nucleic Acids Res 9:3047-3060. Gerhart JC (1980): Mechanisms regulating pattern formation in the amphibian egg and early embryo. In R Goldberger (ed): “Biological Regulation and Development,” Vol. 2. New York: Plenum Press, pp. 133-316. Greenberg ME, Siegfried Z, Ziff EB (1987): Mutation of the c-fos gene dyad symmetry element inhibits serum inducibility of transcription in vivo and the nuclear regulatory factor binding in vitro. Mol Cell Biol 7:1217-1225. ACKNOWLEDGMENTS Gurdon J B (1977): Methods for nuclear transplantation in Amphibia. In G Stein, J Stein, and W Kleinsmith (eds): “Methods in Cell Joel Varley was a participant in the College Summer Biology,” Vol. 16. New York: Academic Press, pp. 125-139. Fellowship Program of the University of Connecticut Hayes TE, Sengupta P, Cochran BH (1988): The human c-fos serum Health Center and was supported by funds from the response factor and the yeast factors GRMiPRTF have related Health Center Research Advisory Committee and the DNA-binding specificities. Genes Dev 2:1713-1722. Department of Anatomy. We thank M. Deutscher, S. Hough-Evans BR, Franks RR, Zeller RW, Britten RJ, Davidson EH (1990): Negative spatial regulation of the lineage specific CyIIIa Eisenberg, and T.V. Rajan for comments on the manuactin in the sea urchin embryo. Development 110:41-50. script. This research was supported by an Emergency Johnsongene PF, McKnight SL (1989): Eukaryotic transcriptional regulaGrant from the University of Connecticut Health Centory proteins. Annu Rev Biochem 58:799-839. ter Research Advisory Committee. Kadonaga JT, Jones KA, Tjian R (1986): Promoter-specific activation of RNA polymerase I1 transcription by Spl. Trends Biochem Sci 11:20-23. REFERENCES Laskey RA (1980): The use of intensifying screens or orgaic scintillaBaeuerle PA, Baltimore D (1988):Activation of DNA-binding activity tors for visualizing radioactive molecules resolved by gel electroin an apparently cytoplasmic precursor of the NF-KBtranscription phoresis. In L Grossman and K Moldave (eds): “Methods in Enzyfactor. Cell 53:211-217. mology,” Vol. 65. New York: Academic Press, pp 363-371. Bagchi S, Raychaudhuri P, Nevins J R (1990): Adenovirus E1A Maniatis T, Goodbourn S, Fischer J A (1987): Regulation of inducible proteins can dissociate heteromeric complexes involving the E2F and tissue-specific gene expression. Science 236: 1237-1245. transcription factor: a novel mechanism for E1A trans-activation. Minty A, Kedes L (1986): Upstream regions of the human cardiac Cell 62:659-669. actin gene that modulate its transcription in muscle cells: Presence Blow JJ, Laskey RA (1986): Initiation of DNA replication in nuclei of an evolutionarily conserved repeated motif. Mol Cell Biol6:2125and purified DNA by a cell-free extract of Xenopus eggs. Cell 2136. 47577-581. Mitchell PJ, Tjian R (1989):Transcriptional regulation in mammalian Brennan S (1987): Molecular approaches to the study of mesoderm cells by sequence-specific DNA-binding proteins. Science 245:371formation in amphibians. Bioessays 652-57. 378. Brennan S (1990):Transcription of endogenous and injected cytoskel- Mohun T, Garrett N, Treisman R (1987):Xenopus cytoskeletal actin eta1 actin genes during early embryonic development in Xenopus and human c-fos gene promoters share a conserved protein-binding lueuis. Differentiation 44:111-121. site. EMBO J 6:667-673. Brennan S (1991): Morphogenetic and molecular correlates of terato- Mohun TJ, Taylor MV, Garrett N, Gurdon J B (1989): The CArG genesis in the amphibian embryo. Teratology 43:341-353. promoter sequence is necessary for muscle-specific transcription of Brennan S, Savage R (1990): Embryonic transcriptional activation of the cardiac actin gene in Xenopus embryos. EMBO J 8:1153-1161. a Xenopus cytoskeletal actin gene does not require a serum response Nieuwkoop PD (1973): The “Organization Center” of the amphibian element. Rouxs Arch Dev Biol 199:89-96. embryo: Its origin, spatial organization, and morphogenetic action. Briggs MR, Kadonaga JT, Bell SP, Tjian R (1986): Purification and In M Abercrombie, J Brachet and T King (eds): “Advances in biochemical characterization of the promoter-specific transcription Morphogenesis,” Vol. 10. New York: Academic Press, pp 1-39. factor, Spl. Science 234:47-52. Nieuwkoop PD, Faber J (1967): “Normal Table of Xenopus lueuis Buratowski S, Hahn S, Guarente L, Sharp PA (1989): Five interme(Daudin),”Second Edition. Amsterdam: North Holland. diate complexes in transcription initiation by RNA polymerase 11. Reinberg D, Roeder R (1987): Factors involved in specific transcripCell 56549-561. tion in mammalian RNA polymerase 11: Functional analysis of Calzone FJ, Theze N, Thiebaud, P, Hill RL, Britten RJ,Davidson EH initiation factors IIA and IID and identification of a new factor (1988): Developmental appearance of factors that bind specifically operating at sequences downstream of the initiation site. J Biol to cis-regulatory sequences of a gene expressed in the sea urchin Chem 262:3322-3330. embryo. Genes Dev 21074-1088. Davidson E (1986): “Gene Activity in Early Development,” 3rd Rosa F (1989): Mix. 1, a homeobox mRNA inducible by mesoderm inducers, is expressed mostly in the presumptive endodermal cells of edition. Orlando: Academic Press, pp 411-513. Xenopus embryos. Cell 57:965-974. Dawid IB, Sargent TD, Rosa F (1990): The role of growth factors in embryonic induction in amphibians. In M Nilsen-Hamilton (ed): Ruiz i Altaba A, Melton DA (1989): Interaction between peptide growth factors and homeobox genes in the establishment of antero“Current Topics in Developmental Biology,” Vol. 24. San Diego: posterior polarity in frog embryos. Nature 341:33-38. Academic Press, pp 261-288. Dynan WS, Tjian R (1983): Isolation of transcription factors that Ryan WA, Franza BR, J r , Gilman MZ (1989): Two distinct cellular

336

J. VARLEY AND S. BRENNAN

phosphoproteins bind to the c-fos serum response element. EMBO J 811785-1792. Sartorelli V, Webster KA, Kedes L (1990):Muscle-specific expression of the cardiac a-actin gene requires MyoD1, CArG-box binding factor, and Spl. Genes Dev 4:1811-1822. Schaufele F, West BL, Reudelhuber TL (1990): Overlapping Pit-1 and Spl binding sites are both essential to full rat growth hormone promoter activity despite mutually exclusive Pit-1 and S p l binding. J Biol Chem 265:17,189-17,196. Shaw PE, Schroter H, Nordheim A (1989): The ability of a ternary complex to form over the Serum Response Element correlates with serum inducibility of the human c-fos promoter. Cell 56563-572. Smith J C (1989): Mesoderm induction and mesoderm inducing factors in early amphibian development. Development 105:665-677. Snape AM, Jonas EA, Sargent TD (1990): KTF-1, a transcriptional activator of Xenopus embryonic keratin expression. Development 109:157-165. Taylor M, Treisman R, Garrett N, Mohun T (1989): Muscle-specific (CArG) and serum-responsive (SRE) promoter elements are functionally interchangeable in Xenopus embryos and mouse fibroblasts. Development 106:67-78.

Theze N, Calzone FJ, Thiebaud P, Hill RL, Britten RJ, Davidson EH (1990):Sequences of the CyIIIa actin gene regulatory domain bound specifically by sea urchin embryo nuclear proteins. Mol Reprod Dev 25:llO-122. Tomlinson CR, Kozlowski MT, Klein WH (1990): Ectoderm nuclei from sea urchin embryos contain a Spec-DNA binding protein similar to the vertebrate transcription factor USF. Development 110:259-272. Treisman R (1986): Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46567-574. Treisman R (1987): Identification and purification of a polypeptide that binds to the c-fos serum response element. EMBO J 6:27112717. Varshavsky A (1987): Electrophoretic assay for DNA-binding proteins. In MM Gottesman (ed): “Methods in Enzymology,” Vol. 151. San Diego: Academic Press, pp 551-565. Whitman M, Melton DA (1989): Growth factors in early embryogenesis. Annu Rev Cell Biol 593-117.