519090 research-article2014
VDIXXX10.1177/1040638713519090Detection of App serovars 1-9-11 and 2 by qPCRMarois-Créhan et al.
Brief Research Report
Development of two real-time polymerase chain reaction assays to detect Actinobacillus pleuropneumoniae serovars 1-9-11 and serovar 2
Journal of Veterinary Diagnostic Investigation 2014, Vol. 26(1) 146–149 © 2014 The Author(s) Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/1040638713519090 jvdi.sagepub.com
Corinne Marois-Créhan,1 Sonia Lacouture, Mario Jacques, Nahuel Fittipaldi, Marylène Kobisch, Marcelo Gottschalk
Abstract. Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 104 colony forming units (CFU)/ml and 2.9 × 105 CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia. Key words: Actinobacillus pleuropneumoniae; pigs; real-time polymerase chain reaction; serovars 1-9-11; serovar 2. Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia, a worldwide disease responsible for significant economic losses to the swine industry.5 Fifteen serovars have been described in the A. pleuropneumoniae species. The prevalence and virulence of serovars vary among countries: serovars 2, 9, and 11 are prevalent in European countries and particularly in France, while serovars 1 and 5 are most frequently detected in North America.5 Serovars 1, 9, and 11 (1-9-11) share important epitopes at the lipopolysaccharide level, and they are considered as a group of highly related serovars with similar virulence potential.5 In addition, serological diagnosis of these 3 serovars is usually done simultaneously with the same test.5 Serovar 1 is rarely isolated in Europe, and serovars 9 and 11 have never been reported in North America.5 Infection with A. pleuropneumoniae may become chronic or subclinical without any apparent sign of disease, and these subclinical infections may remain silent. However, outbreaks may suddenly and explosively occur resulting in decimation of the affected herd. The early identification of subclinically infected pig herds is therefore crucial to control carrier pigs and prevent A. pleuropneumoniae transmission between herds, especially from nucleus pig farms to multipliers.5 Usually, serology is used to monitor the presence of subclinical infections in herds.1 However, in some cases, false-negative
results can be obtained.12 Because A. pleuropneumoniae can persist in tonsillar crypts, detection of this pathogen from tonsils of infected herds is also used.3 It is relatively easy to isolate and characterize A. pleuropneumoniae from pneumonic lesions from acute cases, but bacteriological detection is more difficult in chronic infections or in healthy carrier pigs. The presence of A. pleuropneumoniae in tonsils can be revealed by specific end-point polymerase chain reaction (PCR) tests.3,13,14 Because serotyping may also be tedious and requires the use of different serological techniques,11 different PCR tests (including multiplex) have been described in the literature, for example for the identification of A. pleuropneumoniae serovars 2, 5, and 6,6 serovars 3, 6, and 8,18 serovars 1, 7, and From the French Agency for Food, Environmental and Occupational Health & Safety (ANSES), Ploufragan—Plouzané Laboratory, European University of Brittany, Mycoplasmology—Bacteriology unit Ploufragan, France (Marois-Créhan, Kobisch); Faculty of Veterinary Medicine, University of Montreal, St. Hyacinthe, Québec, Canada (Lacouture, Jacques, Gottschalk); and Public Health Ontario, and Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada (Fittipaldi). 1
Corresponding Author: Corinne Marois-Créhan, ANSES, Unité de Mycoplasmologie Bactériologie, BP53, 22440 Ploufragan, France. [email protected]
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
Detection of App serovars 1-9-11 and 2 by qPCR Table 1. Primers used for the 2 real-time polymerase chain reaction assays for the detection of Actinobacillus pleuropneumoniae serovars 1-9-11 and 2. Primers
Sequence (5′ → 3′)
% GC*
Reference
FORF17 RORF17 Ap2F AP2r
aggattatcttggcagga ccatctaggtaatttctc actatggcaatcagtcgattcat cctaatcggaaacgccattctg
44.4 38.9 39.1 50.0
Labrie et al. (2002)9 Jessing et al. (2003)6
* Percentage of guanine-plus-cytosine.
12,1 and serovars 1, 2, and 8.15 In general, and compared with end-point PCR, real-time, or quantitative, PCR (qPCR) tests are usually more sensitive, allowing the detection of as few as 5 copies of a target sequence.8 Moreover, qPCR does not require postamplification manipulations and is extremely fast. Despite these advantages, no real-time serovar-specific PCR test has been developed to date to detect A. pleuropneumoniae. In the present study, the development of 2 qPCR assays for detection of A. pleuropneumoniae serovars 1-9-11 and serovar 2 are described. The 2 qPCR tests targeted the gene encoding a potential rhamnosyltransferase (ORF17) involved in O-antigen biosynthesis in A. pleuropneumoniae serovars 1-9-11 or the genes cps2AB, involved in the biosynthesis of the capsular polysaccharides in A. pleuropneumoniae serovar 2.6,9 For the identification of A. pleuropneumoniae serovars 1-9-11, a commercial qPCR supermix (reaction buffer, 3 mM MgCl2 [pH 8.4], 200 µM of each deoxyribonucleotide triphosphate, SYBR Green I dye, 0.625 units of Taq polymerase, and stabilizers),a 250 nM of each ORF17 primer (Table 1), and 5 µl of the DNA template (volume of the PCR reaction: 25 µl) were used. The reaction conditions were as follows: initial denaturation at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 54°C for 1 min, and extension at 72°C for 30 sec. For the identification of A. pleuropneumoniae serovar 2, the qPCR mixture contained a commercial supermix (as above),a 100 nM of each Ap2 primer (Table 1), and 5 µl of the DNA template (volume: 25 µl). Amplification conditions were: initial denaturation at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 63°C for 1 min, and extension at 72°C for 20 sec. Amplifications were performed with a commercial real-time PCR system.a The specificity of both qPCR assays was tested on a collection of 294 strains, which included 16 reference A. pleuropneumoniae strains (serovars 1–4, 5a, 5b, 6–15), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in France, Spain, Mexico, Argentina, or Canada (species confirmed by nested PCR14) and comprising serovars 1–15 as determined by serological tests,11 and 15 bacterial strains other than A. pleuropneumoniae (Table 2). Strains of A. pleuropneumoniae, Actinobacillus indolicus, and Haemophilus parasuis were cultivated on pleuropneumonia-like
147
organisms (PPLO) agarb supplemented with 10 µg/ml of β-nicotinamide adenine dinucleotide, 1 mg/ml of glucose, and 5% heat-inactivated horse serum. Mycoplasma hyopneumoniae was cultivated as previously described.4 Actinobacillus rossii, Actinobacillus lignieresii, and Pasteurella multocida were cultivated on Columbia agar base supplemented with 5% sheep bloodc. All strains were incubated at 37°C in 5% CO2. Samples were prepared for PCR assays as previously described.7 Briefly, 10 colonies of each bacterial species were placed in 800 µl of lysis solution (10 mM TrisHCle [pH 8.3], 100 mM KCl,e 2.5 mM MgCl2,e 1% [v/v] Tween 20,e 1% [v/v] Triton X-100,e 0.01% [v/v] Nonidet P-40,e and 120 µg/ml of proteinase Ke). The M. hyopneumoniae culture was centrifuged (12,000 × g, 4°C, 20 min), and the pellets were resuspended in 800 µl of lysis solution. Lysates were incubated for 1 hr at 60°C, 10 min at 95°C, and kept at −20°C. DNA was extracted, and the concentration was determined with a spectrophotometer as previously described.10 The DNA detection levels of both qPCR tests were evaluated using ten-fold dilutions of chromosomal DNA from A. pleuropneumoniae serovar 1 reference strain (ATCC [American Type Culture Collection] 27088) or A. pleuropneumoniae serovar 2 reference strain (ATCC 27089; 1 × 107 fg/ µl to 1 fg/µl). The analytical sensitivities of the qPCR tests were also estimated using pure bacterial cultures resuspended in phosphate buffered saline (PBS) and experimentally spiked tonsils, collected from animals originating from a herd known to be free of A. pleuropneumoniae serovars 1–12 on the basis of absence of clinical signs and regular serological monitoring. For the latter experiment, a total of 0.1 g of tonsil materials (usually in the presence of a variety of bacterial species) was reduced to small pieces with a scalpel, added to 1 ml of PBS, vortexed for 3 min, and filtrated through filter paper (type 4).d Serial dilutions (109 to 103 colony-forming units [CFU]/ml) of a suspension of A. pleuropneumoniae serovar 1 (ATCC 27088 strain) were prepared in tonsillar suspensions and in PBS. DNA preparations were performed from 1 ml of suspensions of each series (PBS and tonsillar suspension) containing 108 to 103 CFU/ml.7 The pellets, obtained after 15 min at 12,000 × g, were suspended with 800 µl of lysis solution. The real-time PCR tests were performed with 4 µl of each DNA preparation. These experiments were conducted at least 3 times under the same conditions. Using the conditions described above for the first qPCR test amplifying ORF17, a fluorescence emission of SYBR Green was measured from all A. pleuropneumoniae serovars 1, 9, and 11 strains, including the respective reference strains as well as field strains (Table 2). When performing the second qPCR test targeting a region comprising parts of the cps2AB genes, fluorescence emission was measured from all A. pleuropneumoniae serovar 2 strains, including the reference strain and field strains. Strains of other A. pleuropneumoniae serovars and strains from other bacterial species
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
148
Marois-Créhan et al.
Table 2. Bacterial strains used to test the specificity of the 2 real-time polymerase chain reaction (qPCR) assays for the detection of Actinobacillus pleuropneumoniae serovars 1-9-11 and 2.* qPCR results Species Actinobacillus pleuropneumoniae serovar 1 A. pleuropneumoniae serovar 2 A. pleuropneumoniae serovar 3 A. pleuropneumoniae serovar 4 A. pleuropneumoniae serovar 5 (a and b) A. pleuropneumoniae serovar 6 A. pleuropneumoniae serovar 7 A. pleuropneumoniae serovar 8 A. pleuropneumoniae serovar 9 A. pleuropneumoniae serovar 10 A. pleuropneumoniae serovar 11 A. pleuropneumoniae serovar 12 A. pleuropneumoniae serovar 13 A. pleuropneumoniae serovar 14 A. pleuropneumoniae serovar 15 Pasteurella multocida subsp. multocida Haemophilus parasuis Actinobacillus indolicus Actinobacillus lignieresii Actinobacillus rossii Actinobacillus porcinus Actinobacillus minor Actinobacillus porcitonsillarum Actinobacillus suis Actinobacillus equuli Mycoplasma hyopneumoniae
Strains
No. tested (n = 294)
Serovars 1-9-11
Serovar 2
RS ATCC 27088 and 38 field strains RS ATCC 27089 and 39 field strains RS ATCC 27090 and 2 field strains RS ATCC 33378 and 9 field strains RS ATCC 33377, RS L20, and 30 field strains RS ATCC 33590 and 6 field strains RS WF83 and 34 field strains RS 405 and 39 field strains 56153 and 5 field strains RS 13039 RS CVJ 13261, 14 field strains RS 8329 and 11 field strains RS N-273† and 10 field strains RS 3906 RSHS143 and 26 field strains
39 40 3 10 32
+ – – – –
– + – – –
7 35 40 6 1 15 12 11 1 27
– – – + – + – – – –
– – – – – – – – –
1 1 1 2 1 2 2 1 2 1 1
– – – – – – – – – – –
– – – – – – – – – – –
NCTC 12178 Field strain Field strain ATCC 49236, field strain ATCC 27072 Field strains Field strains CCUG 46996 ATCC 15557, field strain Field strain ATCC 25934
* RS = reference strain; ATCC = American Type Culture Collection, Manassas, VA; NCTC = National Collection of Type Cultures, Public Health England, Salisbury, United Kingdom; CCUG = Culture Collection, University of Göteborg, Sweden. † Reference strains of serovar 13 (strain N-273) and 14 (3906) were kindly provided by Dr. J. P. Nielsen, Denmark, and that of serovar 15 (HS143) was a gift from Dr. J. Frey, Switzerland.
were all negative in both qPCR assays. The threshold lines were set at fluorescence values of 0.13 and 0.11, respectively. Under the described trial conditions (5 µl of DNA extract per assay), the detection limits of the qPCR tests using DNA from pure bacterial cultures were 10 fg/µl for the product specific to the ORF17 (serovars 1-9-11) and for the product specific to the cps2AB gene (serovar 2). Assuming that the genome size of A. pleuropneumoniae is approximately 2,300 kb,2 2.3 fg would correspond approximately to 1 genome copy. Therefore, the estimated detection thresholds of the tests were equivalent to 5 organisms/µl (or equivalent to 22 organisms by assay). The qPCR assays presented herein are thus apparently more sensitive than other previously reported one-step conventional PCR tests.3 However, the tests seem less sensitive than the qPCR test previously described to detect A. pleuropneumoniae, which reported a
sensitivity of 5 CFU/reaction.16 For the ORF17 target, the correlation coefficient (R2) was 0.997. The slope derived from all positive replicates per log-concentration was −3.53 and indicates an amplification efficiency of 92%. For the cps2AB target, the R2 was 0.998; the slope of −3.48 indicates an efficiency of 94%. The melting temperature of the amplified products obtained from the 2 qPCR tests was 81°C. Analysis of the qPCR results obtained from samples prepared from experimentally spiked tonsils with A. pleuropneumoniae serovar 1 revealed a detection threshold of 2.9 × 105 CFU/0.1 g of tonsil. Although acceptable,3 the analytical sensitivities were lower than those obtained with pure cultures. In fact, the determined detection threshold when the sample is prepared from a bacterial suspension in PBS was 2.5 × 104 CFU/ml. These differences were expected and most probably because of interference caused by PCR inhibitors present in tonsils. There are several options to overcome
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
Detection of App serovars 1-9-11 and 2 by qPCR the effects of inhibitors that are not eliminated during DNA extraction. The choice of DNA polymerase can have a large impact on resistance to inhibition.17 In addition, adding less DNA template to the amplification can often improve performance greatly.17 Finally, an internal control could also be added in the PCR to monitor the efficiency of amplification in each reaction, with such internal controls being available from commercial sources.f In conclusion, the 2 qPCR assays described herein are highly specific and sensitive and can be used to serotype field isolates recovered from carrier animals in diagnostic laboratories. In addition, because the analytical sensitivity obtained with these assays using experimentally spiked tonsils offered a good sensitivity, these tests might be eventually used to detect A. pleuropneumoniae serovars 1-9-11 and 2 from carrier animals. A validation in the field using tonsils recovered from animals in subclinically infected as well as noninfected herds should be conducted to validate such a hypothesis. Sources and manufacturers a. b. c. d. e. f.
Bio-Rad Laboratories, Marnes-La-Coquette, France. Difco, Cergy Pontoise, France. AES Laboratories, Combourg, France. Whatman International Ltd., Springfield Mill, United Kingdom. Sigma-Aldrich, Saint Quentin Fallavier, France. Applied Biosystems, Courtaboeuf, France.
Declaration of conflicting interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding This work was supported by the Regional Council of Brittany, the “Comité Régional Porcin,” and Boehringer Ingelheim Animal Health France, Fort Dodge Animal Health, Intervet S.A., Pfizer Animal Health, and Schering-Plough Animal Health, as well as the diagnostic service of the Faculty of Veterinary Medicine of the University of Montreal.
References 1. Angen O, Ahrens P, Jessing SG: 2008, Development of a multiplex PCR test for identification of Actinobacillus pleuropneumoniae serovars 1, 7, and 12. Vet Microbiol 132:312–318. 2. Chevallier B, Dugourd D, Tarasiuk K, et al.: 1998, Chromosome sizes and phylogenetic relationships between serotypes of Actino bacillus pleuropneumoniae. FEMS Microbiol Lett 160:209–216. 3. Fittipaldi N, Broes A, Harel J, et al.: 2003, Evaluation and field validation of PCR tests for detection of Actinobacillus
149
pleuropneumoniae in subclinically infected pigs. J Clin Microbiol 41:5085–5093. 4. Friis NF: 1975, Some recommendations concerning primary isolation of Mycoplasma suipneumoniae and Mycoplasma flocculare: a survey. Nord Vet Med 27:337–339. 5. Gottschalk M: 2012, Actinobacillosis. In: Diseases of swine, ed. Karriker L, Ramirez A, Schwartz K, et al., 10th ed., pp. 653–669. Wiley, Hoboken, NJ. 6. Jessing SG, Angen Ø, Inzana TJ: 2003, Evaluation of a multiplex PCR test for simultaneous identification and serotyping of Actinobacillus pleuropneumoniae serotypes 2, 5, and 6. J Clin Microbiol 41:4095–4100. 7. Kellog DE, Kwok S: 1990, Detection of human immunodeficiency virus. In: PCR protocols: a guide to methods and applications, ed. Innis MA, Gelfand DH, Sninsky JJ, White TJ, pp. 339–343. Academic Press, San Diego, CA. 8. Klein D: 2002, Quantification using real-time PCR technology: applications and limitations. Trends Mol Med 8:257–260. 9. Labrie J, Rioux S, Wade MM, et al.: 2002, Identification of genes involved in biosynthesis of Actinobacillus pleuropneumoniae serotype 1 O-antigen and biological properties of rough mutants. J Endotoxin Res 8:27–38. 10. Marois C, Bougeard S, Gottschalk M, Kobisch M: 2004, Multiplex PCR assay for detection of Streptococcus suis species and serotypes 2 and 1/2 in tonsils of live and dead pigs. J Clin Microbiol 42:3169–3175. 11. Mittal KR, Higgins R, Larivière S, Nadeau M: 1992, Serological characterization of Actinobacillus pleuropneumoniae strains isolated from pigs in Quebec. Vet Microbiol 32:135–148. 12. Opriessnig T, Hemann M, Johnson JK, et al.: 2013, Evaluation of diagnostic assays for the serological detection of Actinobacillus pleuropneumoniae on samples of known or unknown exposure. J Vet Diagn Invest 25:61–71. 13. Savoye C, Jobert JL, Berthelot-Hérault F, et al.: 2000, A PCR assay used to study aerosol transmission of Actinobacillus pleuropneumoniae from samples of live pigs under experimental conditions. Vet Microbiol 73:337–347. 14. Schaller A, Djordjevic SP, Eamens GJ, et al.: 2001, Identification and detection of Actinobacillus pleuropneumoniae by PCR based on the gene apxIVA. Vet Microbiol 79:47–62. 15. Schuchert JA, Inzana TJ, Angen Ø, Jessing S: 2004, Detection and identification of Actinobacillus pleuropneumoniae serotypes 1, 2, and 8 by multiplex PCR. J Clin Microbiol 42:4344–4348. 16. Tobias TJ, Bouma A, Klinkenberg D, et al.: 2012, Detection of Actinobacillus pleuropneumoniae in pigs by real-time quantitative PCR for the apxIVA gene. Vet J 193:557–560. 17. Wiedbrauk DL, Werner JC, Drevon AM: 1995, Inhibition of PCR by aqueous and vitreous fluids. J Clin Microbiol 33:2643–2646. 18. Zhou L, Jones SC, Angen Ø, et al.: 2008, Multiplex PCR that can distinguish between immunologically cross-reactive serovar 3, 6, and 8 Actinobacillus pleuropneumoniae strains. J Clin Microbiol 46:800–803.
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
VDIXXX10.1177/1040638713519090Detection of App serovars 1-9-11 and 2 by qPCRMarois-Créhan et al.
Brief Research Report
Development of two real-time polymerase chain reaction assays to detect Actinobacillus pleuropneumoniae serovars 1-9-11 and serovar 2
Journal of Veterinary Diagnostic Investigation 2014, Vol. 26(1) 146–149 © 2014 The Author(s) Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/1040638713519090 jvdi.sagepub.com
Corinne Marois-Créhan,1 Sonia Lacouture, Mario Jacques, Nahuel Fittipaldi, Marylène Kobisch, Marcelo Gottschalk
Abstract. Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 104 colony forming units (CFU)/ml and 2.9 × 105 CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia. Key words: Actinobacillus pleuropneumoniae; pigs; real-time polymerase chain reaction; serovars 1-9-11; serovar 2. Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia, a worldwide disease responsible for significant economic losses to the swine industry.5 Fifteen serovars have been described in the A. pleuropneumoniae species. The prevalence and virulence of serovars vary among countries: serovars 2, 9, and 11 are prevalent in European countries and particularly in France, while serovars 1 and 5 are most frequently detected in North America.5 Serovars 1, 9, and 11 (1-9-11) share important epitopes at the lipopolysaccharide level, and they are considered as a group of highly related serovars with similar virulence potential.5 In addition, serological diagnosis of these 3 serovars is usually done simultaneously with the same test.5 Serovar 1 is rarely isolated in Europe, and serovars 9 and 11 have never been reported in North America.5 Infection with A. pleuropneumoniae may become chronic or subclinical without any apparent sign of disease, and these subclinical infections may remain silent. However, outbreaks may suddenly and explosively occur resulting in decimation of the affected herd. The early identification of subclinically infected pig herds is therefore crucial to control carrier pigs and prevent A. pleuropneumoniae transmission between herds, especially from nucleus pig farms to multipliers.5 Usually, serology is used to monitor the presence of subclinical infections in herds.1 However, in some cases, false-negative
results can be obtained.12 Because A. pleuropneumoniae can persist in tonsillar crypts, detection of this pathogen from tonsils of infected herds is also used.3 It is relatively easy to isolate and characterize A. pleuropneumoniae from pneumonic lesions from acute cases, but bacteriological detection is more difficult in chronic infections or in healthy carrier pigs. The presence of A. pleuropneumoniae in tonsils can be revealed by specific end-point polymerase chain reaction (PCR) tests.3,13,14 Because serotyping may also be tedious and requires the use of different serological techniques,11 different PCR tests (including multiplex) have been described in the literature, for example for the identification of A. pleuropneumoniae serovars 2, 5, and 6,6 serovars 3, 6, and 8,18 serovars 1, 7, and From the French Agency for Food, Environmental and Occupational Health & Safety (ANSES), Ploufragan—Plouzané Laboratory, European University of Brittany, Mycoplasmology—Bacteriology unit Ploufragan, France (Marois-Créhan, Kobisch); Faculty of Veterinary Medicine, University of Montreal, St. Hyacinthe, Québec, Canada (Lacouture, Jacques, Gottschalk); and Public Health Ontario, and Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada (Fittipaldi). 1
Corresponding Author: Corinne Marois-Créhan, ANSES, Unité de Mycoplasmologie Bactériologie, BP53, 22440 Ploufragan, France. [email protected]
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
Detection of App serovars 1-9-11 and 2 by qPCR Table 1. Primers used for the 2 real-time polymerase chain reaction assays for the detection of Actinobacillus pleuropneumoniae serovars 1-9-11 and 2. Primers
Sequence (5′ → 3′)
% GC*
Reference
FORF17 RORF17 Ap2F AP2r
aggattatcttggcagga ccatctaggtaatttctc actatggcaatcagtcgattcat cctaatcggaaacgccattctg
44.4 38.9 39.1 50.0
Labrie et al. (2002)9 Jessing et al. (2003)6
* Percentage of guanine-plus-cytosine.
12,1 and serovars 1, 2, and 8.15 In general, and compared with end-point PCR, real-time, or quantitative, PCR (qPCR) tests are usually more sensitive, allowing the detection of as few as 5 copies of a target sequence.8 Moreover, qPCR does not require postamplification manipulations and is extremely fast. Despite these advantages, no real-time serovar-specific PCR test has been developed to date to detect A. pleuropneumoniae. In the present study, the development of 2 qPCR assays for detection of A. pleuropneumoniae serovars 1-9-11 and serovar 2 are described. The 2 qPCR tests targeted the gene encoding a potential rhamnosyltransferase (ORF17) involved in O-antigen biosynthesis in A. pleuropneumoniae serovars 1-9-11 or the genes cps2AB, involved in the biosynthesis of the capsular polysaccharides in A. pleuropneumoniae serovar 2.6,9 For the identification of A. pleuropneumoniae serovars 1-9-11, a commercial qPCR supermix (reaction buffer, 3 mM MgCl2 [pH 8.4], 200 µM of each deoxyribonucleotide triphosphate, SYBR Green I dye, 0.625 units of Taq polymerase, and stabilizers),a 250 nM of each ORF17 primer (Table 1), and 5 µl of the DNA template (volume of the PCR reaction: 25 µl) were used. The reaction conditions were as follows: initial denaturation at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 54°C for 1 min, and extension at 72°C for 30 sec. For the identification of A. pleuropneumoniae serovar 2, the qPCR mixture contained a commercial supermix (as above),a 100 nM of each Ap2 primer (Table 1), and 5 µl of the DNA template (volume: 25 µl). Amplification conditions were: initial denaturation at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 63°C for 1 min, and extension at 72°C for 20 sec. Amplifications were performed with a commercial real-time PCR system.a The specificity of both qPCR assays was tested on a collection of 294 strains, which included 16 reference A. pleuropneumoniae strains (serovars 1–4, 5a, 5b, 6–15), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in France, Spain, Mexico, Argentina, or Canada (species confirmed by nested PCR14) and comprising serovars 1–15 as determined by serological tests,11 and 15 bacterial strains other than A. pleuropneumoniae (Table 2). Strains of A. pleuropneumoniae, Actinobacillus indolicus, and Haemophilus parasuis were cultivated on pleuropneumonia-like
147
organisms (PPLO) agarb supplemented with 10 µg/ml of β-nicotinamide adenine dinucleotide, 1 mg/ml of glucose, and 5% heat-inactivated horse serum. Mycoplasma hyopneumoniae was cultivated as previously described.4 Actinobacillus rossii, Actinobacillus lignieresii, and Pasteurella multocida were cultivated on Columbia agar base supplemented with 5% sheep bloodc. All strains were incubated at 37°C in 5% CO2. Samples were prepared for PCR assays as previously described.7 Briefly, 10 colonies of each bacterial species were placed in 800 µl of lysis solution (10 mM TrisHCle [pH 8.3], 100 mM KCl,e 2.5 mM MgCl2,e 1% [v/v] Tween 20,e 1% [v/v] Triton X-100,e 0.01% [v/v] Nonidet P-40,e and 120 µg/ml of proteinase Ke). The M. hyopneumoniae culture was centrifuged (12,000 × g, 4°C, 20 min), and the pellets were resuspended in 800 µl of lysis solution. Lysates were incubated for 1 hr at 60°C, 10 min at 95°C, and kept at −20°C. DNA was extracted, and the concentration was determined with a spectrophotometer as previously described.10 The DNA detection levels of both qPCR tests were evaluated using ten-fold dilutions of chromosomal DNA from A. pleuropneumoniae serovar 1 reference strain (ATCC [American Type Culture Collection] 27088) or A. pleuropneumoniae serovar 2 reference strain (ATCC 27089; 1 × 107 fg/ µl to 1 fg/µl). The analytical sensitivities of the qPCR tests were also estimated using pure bacterial cultures resuspended in phosphate buffered saline (PBS) and experimentally spiked tonsils, collected from animals originating from a herd known to be free of A. pleuropneumoniae serovars 1–12 on the basis of absence of clinical signs and regular serological monitoring. For the latter experiment, a total of 0.1 g of tonsil materials (usually in the presence of a variety of bacterial species) was reduced to small pieces with a scalpel, added to 1 ml of PBS, vortexed for 3 min, and filtrated through filter paper (type 4).d Serial dilutions (109 to 103 colony-forming units [CFU]/ml) of a suspension of A. pleuropneumoniae serovar 1 (ATCC 27088 strain) were prepared in tonsillar suspensions and in PBS. DNA preparations were performed from 1 ml of suspensions of each series (PBS and tonsillar suspension) containing 108 to 103 CFU/ml.7 The pellets, obtained after 15 min at 12,000 × g, were suspended with 800 µl of lysis solution. The real-time PCR tests were performed with 4 µl of each DNA preparation. These experiments were conducted at least 3 times under the same conditions. Using the conditions described above for the first qPCR test amplifying ORF17, a fluorescence emission of SYBR Green was measured from all A. pleuropneumoniae serovars 1, 9, and 11 strains, including the respective reference strains as well as field strains (Table 2). When performing the second qPCR test targeting a region comprising parts of the cps2AB genes, fluorescence emission was measured from all A. pleuropneumoniae serovar 2 strains, including the reference strain and field strains. Strains of other A. pleuropneumoniae serovars and strains from other bacterial species
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
148
Marois-Créhan et al.
Table 2. Bacterial strains used to test the specificity of the 2 real-time polymerase chain reaction (qPCR) assays for the detection of Actinobacillus pleuropneumoniae serovars 1-9-11 and 2.* qPCR results Species Actinobacillus pleuropneumoniae serovar 1 A. pleuropneumoniae serovar 2 A. pleuropneumoniae serovar 3 A. pleuropneumoniae serovar 4 A. pleuropneumoniae serovar 5 (a and b) A. pleuropneumoniae serovar 6 A. pleuropneumoniae serovar 7 A. pleuropneumoniae serovar 8 A. pleuropneumoniae serovar 9 A. pleuropneumoniae serovar 10 A. pleuropneumoniae serovar 11 A. pleuropneumoniae serovar 12 A. pleuropneumoniae serovar 13 A. pleuropneumoniae serovar 14 A. pleuropneumoniae serovar 15 Pasteurella multocida subsp. multocida Haemophilus parasuis Actinobacillus indolicus Actinobacillus lignieresii Actinobacillus rossii Actinobacillus porcinus Actinobacillus minor Actinobacillus porcitonsillarum Actinobacillus suis Actinobacillus equuli Mycoplasma hyopneumoniae
Strains
No. tested (n = 294)
Serovars 1-9-11
Serovar 2
RS ATCC 27088 and 38 field strains RS ATCC 27089 and 39 field strains RS ATCC 27090 and 2 field strains RS ATCC 33378 and 9 field strains RS ATCC 33377, RS L20, and 30 field strains RS ATCC 33590 and 6 field strains RS WF83 and 34 field strains RS 405 and 39 field strains 56153 and 5 field strains RS 13039 RS CVJ 13261, 14 field strains RS 8329 and 11 field strains RS N-273† and 10 field strains RS 3906 RSHS143 and 26 field strains
39 40 3 10 32
+ – – – –
– + – – –
7 35 40 6 1 15 12 11 1 27
– – – + – + – – – –
– – – – – – – – –
1 1 1 2 1 2 2 1 2 1 1
– – – – – – – – – – –
– – – – – – – – – – –
NCTC 12178 Field strain Field strain ATCC 49236, field strain ATCC 27072 Field strains Field strains CCUG 46996 ATCC 15557, field strain Field strain ATCC 25934
* RS = reference strain; ATCC = American Type Culture Collection, Manassas, VA; NCTC = National Collection of Type Cultures, Public Health England, Salisbury, United Kingdom; CCUG = Culture Collection, University of Göteborg, Sweden. † Reference strains of serovar 13 (strain N-273) and 14 (3906) were kindly provided by Dr. J. P. Nielsen, Denmark, and that of serovar 15 (HS143) was a gift from Dr. J. Frey, Switzerland.
were all negative in both qPCR assays. The threshold lines were set at fluorescence values of 0.13 and 0.11, respectively. Under the described trial conditions (5 µl of DNA extract per assay), the detection limits of the qPCR tests using DNA from pure bacterial cultures were 10 fg/µl for the product specific to the ORF17 (serovars 1-9-11) and for the product specific to the cps2AB gene (serovar 2). Assuming that the genome size of A. pleuropneumoniae is approximately 2,300 kb,2 2.3 fg would correspond approximately to 1 genome copy. Therefore, the estimated detection thresholds of the tests were equivalent to 5 organisms/µl (or equivalent to 22 organisms by assay). The qPCR assays presented herein are thus apparently more sensitive than other previously reported one-step conventional PCR tests.3 However, the tests seem less sensitive than the qPCR test previously described to detect A. pleuropneumoniae, which reported a
sensitivity of 5 CFU/reaction.16 For the ORF17 target, the correlation coefficient (R2) was 0.997. The slope derived from all positive replicates per log-concentration was −3.53 and indicates an amplification efficiency of 92%. For the cps2AB target, the R2 was 0.998; the slope of −3.48 indicates an efficiency of 94%. The melting temperature of the amplified products obtained from the 2 qPCR tests was 81°C. Analysis of the qPCR results obtained from samples prepared from experimentally spiked tonsils with A. pleuropneumoniae serovar 1 revealed a detection threshold of 2.9 × 105 CFU/0.1 g of tonsil. Although acceptable,3 the analytical sensitivities were lower than those obtained with pure cultures. In fact, the determined detection threshold when the sample is prepared from a bacterial suspension in PBS was 2.5 × 104 CFU/ml. These differences were expected and most probably because of interference caused by PCR inhibitors present in tonsils. There are several options to overcome
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
Detection of App serovars 1-9-11 and 2 by qPCR the effects of inhibitors that are not eliminated during DNA extraction. The choice of DNA polymerase can have a large impact on resistance to inhibition.17 In addition, adding less DNA template to the amplification can often improve performance greatly.17 Finally, an internal control could also be added in the PCR to monitor the efficiency of amplification in each reaction, with such internal controls being available from commercial sources.f In conclusion, the 2 qPCR assays described herein are highly specific and sensitive and can be used to serotype field isolates recovered from carrier animals in diagnostic laboratories. In addition, because the analytical sensitivity obtained with these assays using experimentally spiked tonsils offered a good sensitivity, these tests might be eventually used to detect A. pleuropneumoniae serovars 1-9-11 and 2 from carrier animals. A validation in the field using tonsils recovered from animals in subclinically infected as well as noninfected herds should be conducted to validate such a hypothesis. Sources and manufacturers a. b. c. d. e. f.
Bio-Rad Laboratories, Marnes-La-Coquette, France. Difco, Cergy Pontoise, France. AES Laboratories, Combourg, France. Whatman International Ltd., Springfield Mill, United Kingdom. Sigma-Aldrich, Saint Quentin Fallavier, France. Applied Biosystems, Courtaboeuf, France.
Declaration of conflicting interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding This work was supported by the Regional Council of Brittany, the “Comité Régional Porcin,” and Boehringer Ingelheim Animal Health France, Fort Dodge Animal Health, Intervet S.A., Pfizer Animal Health, and Schering-Plough Animal Health, as well as the diagnostic service of the Faculty of Veterinary Medicine of the University of Montreal.
References 1. Angen O, Ahrens P, Jessing SG: 2008, Development of a multiplex PCR test for identification of Actinobacillus pleuropneumoniae serovars 1, 7, and 12. Vet Microbiol 132:312–318. 2. Chevallier B, Dugourd D, Tarasiuk K, et al.: 1998, Chromosome sizes and phylogenetic relationships between serotypes of Actino bacillus pleuropneumoniae. FEMS Microbiol Lett 160:209–216. 3. Fittipaldi N, Broes A, Harel J, et al.: 2003, Evaluation and field validation of PCR tests for detection of Actinobacillus
149
pleuropneumoniae in subclinically infected pigs. J Clin Microbiol 41:5085–5093. 4. Friis NF: 1975, Some recommendations concerning primary isolation of Mycoplasma suipneumoniae and Mycoplasma flocculare: a survey. Nord Vet Med 27:337–339. 5. Gottschalk M: 2012, Actinobacillosis. In: Diseases of swine, ed. Karriker L, Ramirez A, Schwartz K, et al., 10th ed., pp. 653–669. Wiley, Hoboken, NJ. 6. Jessing SG, Angen Ø, Inzana TJ: 2003, Evaluation of a multiplex PCR test for simultaneous identification and serotyping of Actinobacillus pleuropneumoniae serotypes 2, 5, and 6. J Clin Microbiol 41:4095–4100. 7. Kellog DE, Kwok S: 1990, Detection of human immunodeficiency virus. In: PCR protocols: a guide to methods and applications, ed. Innis MA, Gelfand DH, Sninsky JJ, White TJ, pp. 339–343. Academic Press, San Diego, CA. 8. Klein D: 2002, Quantification using real-time PCR technology: applications and limitations. Trends Mol Med 8:257–260. 9. Labrie J, Rioux S, Wade MM, et al.: 2002, Identification of genes involved in biosynthesis of Actinobacillus pleuropneumoniae serotype 1 O-antigen and biological properties of rough mutants. J Endotoxin Res 8:27–38. 10. Marois C, Bougeard S, Gottschalk M, Kobisch M: 2004, Multiplex PCR assay for detection of Streptococcus suis species and serotypes 2 and 1/2 in tonsils of live and dead pigs. J Clin Microbiol 42:3169–3175. 11. Mittal KR, Higgins R, Larivière S, Nadeau M: 1992, Serological characterization of Actinobacillus pleuropneumoniae strains isolated from pigs in Quebec. Vet Microbiol 32:135–148. 12. Opriessnig T, Hemann M, Johnson JK, et al.: 2013, Evaluation of diagnostic assays for the serological detection of Actinobacillus pleuropneumoniae on samples of known or unknown exposure. J Vet Diagn Invest 25:61–71. 13. Savoye C, Jobert JL, Berthelot-Hérault F, et al.: 2000, A PCR assay used to study aerosol transmission of Actinobacillus pleuropneumoniae from samples of live pigs under experimental conditions. Vet Microbiol 73:337–347. 14. Schaller A, Djordjevic SP, Eamens GJ, et al.: 2001, Identification and detection of Actinobacillus pleuropneumoniae by PCR based on the gene apxIVA. Vet Microbiol 79:47–62. 15. Schuchert JA, Inzana TJ, Angen Ø, Jessing S: 2004, Detection and identification of Actinobacillus pleuropneumoniae serotypes 1, 2, and 8 by multiplex PCR. J Clin Microbiol 42:4344–4348. 16. Tobias TJ, Bouma A, Klinkenberg D, et al.: 2012, Detection of Actinobacillus pleuropneumoniae in pigs by real-time quantitative PCR for the apxIVA gene. Vet J 193:557–560. 17. Wiedbrauk DL, Werner JC, Drevon AM: 1995, Inhibition of PCR by aqueous and vitreous fluids. J Clin Microbiol 33:2643–2646. 18. Zhou L, Jones SC, Angen Ø, et al.: 2008, Multiplex PCR that can distinguish between immunologically cross-reactive serovar 3, 6, and 8 Actinobacillus pleuropneumoniae strains. J Clin Microbiol 46:800–803.
Downloaded from vdi.sagepub.com at University of Southern Queensland on March 15, 2015
