Indian Journal of Medical Microbiology, (2015) 33(2): 271-273
1
Original Article
Development of touch down‑multiplex PCR for the diagnosis of toxoplasmosis V Hallur, R Sehgal, *S Khurana
Abstract Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis. Key words: Diagnosis, multiplex, polymerase chain reaction, Toxoplasma
Introduction Toxoplasmosis infects about one‑third of the world population.[1] It usually causes a non‑specific flu‑like illness with lymphadenopathy in immunocompetent individuals. If acquired during pregnancy, the infection might go unnoticed, but it may get transmitted to the foetus causing congenital toxoplasmosis. It may also cause fatal and life‑threatening complications such as encephalitis in immunosuppressed individuals.[2] The diagnosis of toxoplasmosis is particularly challenging as the clinical symptoms are non‑specific. Conventional methods for diagnosis such as parasite culture and immunofluorescence are not universally available and not sensitive enough while serological tests may falsely be negative in early part of infection and in immunosuppressed individuals.[3] Several molecular methods like PCR, LAMP have also been used for the diagnosis of toxoplasmosis. LAMP suffers from issues of false positivity and an inability to target more than one gene sequences i.e. multiplexing.[4,5] PCR also suffers from disadvantage of lower sensitivity *Corresponding author (email: ) Department of Medical Parasitology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Received: 28‑10‑2013 Accepted: 02-09-2014 Access this article online Quick Response Code:
Website: www.ijmm.org
DOI: 10.4103/0255-0857.154874
because of presence of PCR inhibitors in clinical samples. Keeping the above in mind, we designed a multiplex PCR assay using the MPRIMER web utility and combined it the touchdown PCR technique to obtain a rapid diagnosis of toxoplasmosis. We then compared it with conventional PCR targeting B1 gene and multiplex PCR by spiking experiments and in samples from patients suspected of toxoplasmosis. Materials and Methods The study was approved by the institute ethics committee. DNA was extracted from Toxoplasma gondii RH strain being maintained in a Swiss albino mice in the Department of Medical Parasitology, PGIMER, Chandigarh as per standard protocol. Twenty‑four clinical samples over a period of 6 months i.e. 1 December 2013 to 1 June 2014, were obtained from patients with suspected toxoplasmosis. Primer design Primers targeting the human beta globin region (U01317.1) as internal control, the 5s ribosomal RNA of (X75453.1) and B1 gene of T. gondii (AF179871.1) were designed using MPrimer program. This program allowed us to design primers with optimum annealing temperature between 56–59°C. Of the 15 primer set outputs obtained, one set was chosen after insilico testing to rule out secondary structures. The list of the final primers used in the multiplex and conventional PCR assays were B1 F3′‑AACCATGCGCAGCCATCAGCTT‑5′, B1R 3′‑GCATGATTCTGCGTGGTGGGCT‑5′, 5sF 3′‑ TGCACCCCTGGCCGTACCAATA‑5′, 5sR 3′‑ TGTTCACCGTACACGCACAGCC‑5′ and Hum BF 3′‑ AACTGCAAGGTGGCAGTGAGGC‑5′, Hum BR 3′‑ ACCGCAAATGCTGCTGCCTGAT‑5′. All primers were synthesized by Sigma Chemicals Co, USA.
272
Indian Journal of Medical Microbiology
DNA extraction DNA from parasite pellet obtained after centrifuging the peritoneal fluid of Toxoplasma‑infected mice and sterile human cerebrospinal fluid was extracted using RBS genomic DNA extraction kit. Briefly, the pellet/fluid was incubated with proteinase K at 56°C for 10 minutes followed by lysis using lysis buffer. DNA released after cell lysis was absorbed on a silica column and eluted using TE buffer. The concentration of DNA was quantified using Nano drop and stored at −20°C till further use. Touchdown PCR and analytical sensitivity To find the analytical sensitivity of single assays, human DNA and parasite DNA was subjected to 10 fold dilutions from 10 ng–1pg. Thus obtained DNA was used as template for different assays of 50 µl each. The final concentration of different components of the master mix were 1X buffer with 1.5 mM of MgCl2, 0.4 mM each of the 4 deoxyribonucleotides (dNTP), 1 unit of Taq polymerase and 0.5 µM of each primer for simple PCR assays. Similar conditions were used for multiplex assay except for increased concentration of dNTP (0.8 mM) and Taq polymerase (2.5 U). The cycling parameters used are given in Table 1. The amplified products were run in 1.5% agarose gel containing ethidium bromide, and visualized in ultra‑violet light in a gel documentation system (AlphaImager 3400, AlphaInnotech, USA). Spiking of human CSF with parasite DNA, specificity testing and evaluation of multilplex PCR in samples of suspected toxoplasmosis Pooled CSF from bacterial and fungal culture negative patients suspected of meningitis, without serological Table 1: Thermocycling conditions used for the multiplex‑touch down PCR Temperature Duration Number 94°C 5 minutes 1 cycle 94°C 30 seconds 20 cycles 67‑57°C 45 seconds 72°C 2 minutes 94°C 30 seconds 20 cycles 57°C 45 seconds 72°C 2 minutes 72°C 5 minutes 1 cycle 4°C Forever Take out samples PCR: Polymerase chain reaction
Test B1 gene simple PCR Multiplex PCR
vol. 33, No. 2
evidence of toxoplasmosis were spiked with DNA from T. gondii, M. tuberculosis, E. coli, K. pneumoniae, and S. aureus. All tests were applied in triplicate, to ensure reproducibility. All primers were also subjected to primer BLAST. Samples received from 24 patients were also subjected to B1 gene PCR and multiplex PCR. Results Product sizes of 106 bp, 284 bp and 411 bp were predicted insilico for the B1 gene, 5s gene and human beta globin gene by the MPrimer software, respectively. Amplicons corresponding to the predicted sizes were obtained following PCR. It was found that simple PCR assays had an analytical sensitivity ranging from 1–10 pg while multiplex PCR had analytical sensitivity of 10 pg for detecting toxoplasmosis and 100 pg for human beta globin. The product sizes obtained after PCR and analytical sensitivities of conventional PCR are given in Table 2. Inhibition of the PCR assays occurred when the concentration of DNA was >200 ng/μl. Only one band corresponding to human beta globin was seen in specimens spiked with DNA from M. tuberculosis, E. coli, K. pneumoniae and S. aureus. Primer specificity was also confirmed on primer BLAST except for 5s gene. Of the 24 samples received (15 vitreous and 9 CSF) from 24 patients, 6 (4 vitreous and 2 CSF) had proven toxoplasmosis on the basis of typical clinical findings, response to treatment, positive serology and radiology (the last two for cerebral toxoplasmosis) which were taken as gold standard. Among the 6 proven cases, 5 were positive by both the assays and 1 was negative by both the assays. The diagnostic sensitivity and specificities are given in the Table 2. Discussion In recent times, molecular methods are being increasingly used for diagnosis of toxoplasmosis and have led to significant improvement in its diagnosis in prenatal period and immunocompromised patients.[2] Several techniques viz. conventional PCR, nested PCR, LAMP and real‑time PCR have been used by different authors. The sensitivity of the different techniques in descending order is real time PCR (qPCR), nested PCR (npcr), LAMP and conventional PCR. Like other authors, we have used small repetitive elements viz. B1 gene, and ribosomal DNA, which have been proposed to increase the sensitivity of the assay.[6,7] A real‑time format although ideal is not practical in a number of laboratories because of the cost factor and need for special analyzers[8] while nested PCR is labour intensive
Table 2: Diagnostic indicators for the PCR assays Sensitivity (95% CI) Specificity (95% CI) Positive predictive value 83.3 (35.9-99.6) 100 (81.5-100) 100 (47.8-100) 83.3 (35.9-99.6) 100 (81.5-100) 100 (47.8-100)
PCR: Polymerase chain reaction, CI: Confidence interval www.ijmm.org
Negative predictive value 94.7 (73.9-99.9) 94.7 (73.9-99.9)
April-June 2015
Khurana, et al.: Multiplex PCR for toxoplasmosis
and prone to contamination. Although LAMP has the benefit of not requiring a thermocycler, it suffers from the issues of cross contamination and difficulty to be multiplexed.[4,5] Conventional PCR lacks an internal control, which can be circumvented using a multiplex approach. Apart from this, PCR optimization and troubleshooting is a tedious process because of the fussy and often unforeseeable nature of the reactions. Even slight variations in any of the many variables in a given reaction can have a marked effect on the resultant amplicon profile. These issues can be addressed by using the touchdown strategy. This strategy ensures that the first primer‑template hybridization events favour only those reactants with the greatest complementarity i.e. those yielding the desired amplicon. Although in the subsequent reactions annealing temperature may drop down to cause nonspecific hybridizations, the desired amplicon will have already begun its geometric amplification and is thus in an advantageous position to outcompete any nonspecific PCR products. Moreover, it can also compensate for suboptimal buffer composition.[9] Hence, a combined approach, that is, single tube touch‑down multiplex PCR would overcome the above issues. Therefore, we designed a multiplex PCR, which had primers targeting human beta globin gene that would act as internal control, and two primers targeting T. gondii viz. B1 gene and 5s gene, which are repetitive sequences. This was done using the MPrimer program available freely on the internet.[10] Of the genes targeted for multiplex PCR, only 5s gene was not specific for T. gondii and could amplify DNA from Neospra caninum, Sarcocystis spp., Besnoitia besnoiti etc., none of these organisms are pathogenic for man. With this in mind, we then combined it with the touchdown technique in which the reaction is started 10°C above the calculated annealing temperature i.e. 67°C and is then reduced by 1°C/cycle during initial 10 cycles. This is followed by 20 cycles with annealing temperature at 57°C. Usually and as in our case, a decreased analytical sensitivity of multiplex PCR is expected, which could be because of competition between different reagents. However, this was partially circumvented by using reagents in excess and use of touchdown technique. Even with this fall in sensitivity, it was shown that as little as 10 pg DNA of T. gondii could be detected. Rahamatullah et al. in their study used a similar approach for diagnosis of toxoplasmosis using Vibrio cholerae HemM gene as internal control, which would require V. cholerae DNA spiking that may lead to cross contamination.[3] However, we used the human beta globin gene, which is already present in the human samples. This reduces the chances of any cross contamination and helps us rule out presence of inhibitors or a failure of DNA extraction procedure. This in
273
turn would help to reduce the time lost in reconfirming the presence/absence of inhibitors samples following spiking with known DNA or requesting for a repeat sample. We also tried to evaluate the test in samples obtained from patients with proven toxoplasmosis and found that there was no significant difference in the performance of the two tests. Although both tests had the similar sensitivity and specificity, the sample size in the study is small to conclude regarding the significance of the findings. Hence, further studies with larger sample size are required to evaluate the tests. References 1. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: From animals to humans. Int J Parasitol 2000;30:1217‑58. 2. Bastien P. Molecular diagnosis of toxoplasmosis. Trans R Soc Trop Med Hyg 2002;96 Suppl 1:S205‑15. 3. Rahumatullah A, Khoo BY, Noordin R. Triplex PCR using new primers for the detection of Toxoplasma gondii. Exp Parasitol 2012;131:231‑8. 4. Liang C, Chu Y, Cheng S, Wu H, Kajiyama T, Kambara H, et al. Multiplex loop‑mediated isothermal amplification detection by sequence‑based barcodes coupled with nicking endonuclease‑mediated pyrosequencing. Anal Chem 2012;84:3758‑63. 5. Savan R, Kono T, Itami T, Sakai M. Loop‑mediated isothermal amplification: An emerging technology for detection of fish and shellfish pathogens. J Fish Dis 2005;28:573‑81. 6. Jones CD, Okhravi N, Adamson P, Tasker S, Lightman S. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Invest Ophthalmol Vis Sci 2000;41:634‑44. 7. Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii. Parasitology 2010;137:1‑11. 8. Stark D, Beebe N, Marriott D, Ellis J, Harkness J. Evaluation of three diagnostic methods, including real‑time PCR, for detection of Dientamoeba fragilis in stool specimens. J Clin Microbiol 2006;44:232‑5. 9. Roux KH. Single‑step PCR optimization using touchdown and stepdown PCR programming. Methods Mol Biol 2002;192:31‑6. 10. Shen Z, Qu W, Wang W, Lu Y, Wu Y, Li Z, et al. MPprimer: A program for reliable multiplex PCR primer design. BMC Bioinformatics 2010;11:143.
How to cite this article: Hallur V, Sehgal R, Khurana S. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis. Indian J Med Microbiol 2015;33:271-3. Source of Support: Nil, Conflict of Interest: None declared.
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
1
Original Article
Development of touch down‑multiplex PCR for the diagnosis of toxoplasmosis V Hallur, R Sehgal, *S Khurana
Abstract Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis. Key words: Diagnosis, multiplex, polymerase chain reaction, Toxoplasma
Introduction Toxoplasmosis infects about one‑third of the world population.[1] It usually causes a non‑specific flu‑like illness with lymphadenopathy in immunocompetent individuals. If acquired during pregnancy, the infection might go unnoticed, but it may get transmitted to the foetus causing congenital toxoplasmosis. It may also cause fatal and life‑threatening complications such as encephalitis in immunosuppressed individuals.[2] The diagnosis of toxoplasmosis is particularly challenging as the clinical symptoms are non‑specific. Conventional methods for diagnosis such as parasite culture and immunofluorescence are not universally available and not sensitive enough while serological tests may falsely be negative in early part of infection and in immunosuppressed individuals.[3] Several molecular methods like PCR, LAMP have also been used for the diagnosis of toxoplasmosis. LAMP suffers from issues of false positivity and an inability to target more than one gene sequences i.e. multiplexing.[4,5] PCR also suffers from disadvantage of lower sensitivity *Corresponding author (email: ) Department of Medical Parasitology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Received: 28‑10‑2013 Accepted: 02-09-2014 Access this article online Quick Response Code:
Website: www.ijmm.org
DOI: 10.4103/0255-0857.154874
because of presence of PCR inhibitors in clinical samples. Keeping the above in mind, we designed a multiplex PCR assay using the MPRIMER web utility and combined it the touchdown PCR technique to obtain a rapid diagnosis of toxoplasmosis. We then compared it with conventional PCR targeting B1 gene and multiplex PCR by spiking experiments and in samples from patients suspected of toxoplasmosis. Materials and Methods The study was approved by the institute ethics committee. DNA was extracted from Toxoplasma gondii RH strain being maintained in a Swiss albino mice in the Department of Medical Parasitology, PGIMER, Chandigarh as per standard protocol. Twenty‑four clinical samples over a period of 6 months i.e. 1 December 2013 to 1 June 2014, were obtained from patients with suspected toxoplasmosis. Primer design Primers targeting the human beta globin region (U01317.1) as internal control, the 5s ribosomal RNA of (X75453.1) and B1 gene of T. gondii (AF179871.1) were designed using MPrimer program. This program allowed us to design primers with optimum annealing temperature between 56–59°C. Of the 15 primer set outputs obtained, one set was chosen after insilico testing to rule out secondary structures. The list of the final primers used in the multiplex and conventional PCR assays were B1 F3′‑AACCATGCGCAGCCATCAGCTT‑5′, B1R 3′‑GCATGATTCTGCGTGGTGGGCT‑5′, 5sF 3′‑ TGCACCCCTGGCCGTACCAATA‑5′, 5sR 3′‑ TGTTCACCGTACACGCACAGCC‑5′ and Hum BF 3′‑ AACTGCAAGGTGGCAGTGAGGC‑5′, Hum BR 3′‑ ACCGCAAATGCTGCTGCCTGAT‑5′. All primers were synthesized by Sigma Chemicals Co, USA.
272
Indian Journal of Medical Microbiology
DNA extraction DNA from parasite pellet obtained after centrifuging the peritoneal fluid of Toxoplasma‑infected mice and sterile human cerebrospinal fluid was extracted using RBS genomic DNA extraction kit. Briefly, the pellet/fluid was incubated with proteinase K at 56°C for 10 minutes followed by lysis using lysis buffer. DNA released after cell lysis was absorbed on a silica column and eluted using TE buffer. The concentration of DNA was quantified using Nano drop and stored at −20°C till further use. Touchdown PCR and analytical sensitivity To find the analytical sensitivity of single assays, human DNA and parasite DNA was subjected to 10 fold dilutions from 10 ng–1pg. Thus obtained DNA was used as template for different assays of 50 µl each. The final concentration of different components of the master mix were 1X buffer with 1.5 mM of MgCl2, 0.4 mM each of the 4 deoxyribonucleotides (dNTP), 1 unit of Taq polymerase and 0.5 µM of each primer for simple PCR assays. Similar conditions were used for multiplex assay except for increased concentration of dNTP (0.8 mM) and Taq polymerase (2.5 U). The cycling parameters used are given in Table 1. The amplified products were run in 1.5% agarose gel containing ethidium bromide, and visualized in ultra‑violet light in a gel documentation system (AlphaImager 3400, AlphaInnotech, USA). Spiking of human CSF with parasite DNA, specificity testing and evaluation of multilplex PCR in samples of suspected toxoplasmosis Pooled CSF from bacterial and fungal culture negative patients suspected of meningitis, without serological Table 1: Thermocycling conditions used for the multiplex‑touch down PCR Temperature Duration Number 94°C 5 minutes 1 cycle 94°C 30 seconds 20 cycles 67‑57°C 45 seconds 72°C 2 minutes 94°C 30 seconds 20 cycles 57°C 45 seconds 72°C 2 minutes 72°C 5 minutes 1 cycle 4°C Forever Take out samples PCR: Polymerase chain reaction
Test B1 gene simple PCR Multiplex PCR
vol. 33, No. 2
evidence of toxoplasmosis were spiked with DNA from T. gondii, M. tuberculosis, E. coli, K. pneumoniae, and S. aureus. All tests were applied in triplicate, to ensure reproducibility. All primers were also subjected to primer BLAST. Samples received from 24 patients were also subjected to B1 gene PCR and multiplex PCR. Results Product sizes of 106 bp, 284 bp and 411 bp were predicted insilico for the B1 gene, 5s gene and human beta globin gene by the MPrimer software, respectively. Amplicons corresponding to the predicted sizes were obtained following PCR. It was found that simple PCR assays had an analytical sensitivity ranging from 1–10 pg while multiplex PCR had analytical sensitivity of 10 pg for detecting toxoplasmosis and 100 pg for human beta globin. The product sizes obtained after PCR and analytical sensitivities of conventional PCR are given in Table 2. Inhibition of the PCR assays occurred when the concentration of DNA was >200 ng/μl. Only one band corresponding to human beta globin was seen in specimens spiked with DNA from M. tuberculosis, E. coli, K. pneumoniae and S. aureus. Primer specificity was also confirmed on primer BLAST except for 5s gene. Of the 24 samples received (15 vitreous and 9 CSF) from 24 patients, 6 (4 vitreous and 2 CSF) had proven toxoplasmosis on the basis of typical clinical findings, response to treatment, positive serology and radiology (the last two for cerebral toxoplasmosis) which were taken as gold standard. Among the 6 proven cases, 5 were positive by both the assays and 1 was negative by both the assays. The diagnostic sensitivity and specificities are given in the Table 2. Discussion In recent times, molecular methods are being increasingly used for diagnosis of toxoplasmosis and have led to significant improvement in its diagnosis in prenatal period and immunocompromised patients.[2] Several techniques viz. conventional PCR, nested PCR, LAMP and real‑time PCR have been used by different authors. The sensitivity of the different techniques in descending order is real time PCR (qPCR), nested PCR (npcr), LAMP and conventional PCR. Like other authors, we have used small repetitive elements viz. B1 gene, and ribosomal DNA, which have been proposed to increase the sensitivity of the assay.[6,7] A real‑time format although ideal is not practical in a number of laboratories because of the cost factor and need for special analyzers[8] while nested PCR is labour intensive
Table 2: Diagnostic indicators for the PCR assays Sensitivity (95% CI) Specificity (95% CI) Positive predictive value 83.3 (35.9-99.6) 100 (81.5-100) 100 (47.8-100) 83.3 (35.9-99.6) 100 (81.5-100) 100 (47.8-100)
PCR: Polymerase chain reaction, CI: Confidence interval www.ijmm.org
Negative predictive value 94.7 (73.9-99.9) 94.7 (73.9-99.9)
April-June 2015
Khurana, et al.: Multiplex PCR for toxoplasmosis
and prone to contamination. Although LAMP has the benefit of not requiring a thermocycler, it suffers from the issues of cross contamination and difficulty to be multiplexed.[4,5] Conventional PCR lacks an internal control, which can be circumvented using a multiplex approach. Apart from this, PCR optimization and troubleshooting is a tedious process because of the fussy and often unforeseeable nature of the reactions. Even slight variations in any of the many variables in a given reaction can have a marked effect on the resultant amplicon profile. These issues can be addressed by using the touchdown strategy. This strategy ensures that the first primer‑template hybridization events favour only those reactants with the greatest complementarity i.e. those yielding the desired amplicon. Although in the subsequent reactions annealing temperature may drop down to cause nonspecific hybridizations, the desired amplicon will have already begun its geometric amplification and is thus in an advantageous position to outcompete any nonspecific PCR products. Moreover, it can also compensate for suboptimal buffer composition.[9] Hence, a combined approach, that is, single tube touch‑down multiplex PCR would overcome the above issues. Therefore, we designed a multiplex PCR, which had primers targeting human beta globin gene that would act as internal control, and two primers targeting T. gondii viz. B1 gene and 5s gene, which are repetitive sequences. This was done using the MPrimer program available freely on the internet.[10] Of the genes targeted for multiplex PCR, only 5s gene was not specific for T. gondii and could amplify DNA from Neospra caninum, Sarcocystis spp., Besnoitia besnoiti etc., none of these organisms are pathogenic for man. With this in mind, we then combined it with the touchdown technique in which the reaction is started 10°C above the calculated annealing temperature i.e. 67°C and is then reduced by 1°C/cycle during initial 10 cycles. This is followed by 20 cycles with annealing temperature at 57°C. Usually and as in our case, a decreased analytical sensitivity of multiplex PCR is expected, which could be because of competition between different reagents. However, this was partially circumvented by using reagents in excess and use of touchdown technique. Even with this fall in sensitivity, it was shown that as little as 10 pg DNA of T. gondii could be detected. Rahamatullah et al. in their study used a similar approach for diagnosis of toxoplasmosis using Vibrio cholerae HemM gene as internal control, which would require V. cholerae DNA spiking that may lead to cross contamination.[3] However, we used the human beta globin gene, which is already present in the human samples. This reduces the chances of any cross contamination and helps us rule out presence of inhibitors or a failure of DNA extraction procedure. This in
273
turn would help to reduce the time lost in reconfirming the presence/absence of inhibitors samples following spiking with known DNA or requesting for a repeat sample. We also tried to evaluate the test in samples obtained from patients with proven toxoplasmosis and found that there was no significant difference in the performance of the two tests. Although both tests had the similar sensitivity and specificity, the sample size in the study is small to conclude regarding the significance of the findings. Hence, further studies with larger sample size are required to evaluate the tests. References 1. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: From animals to humans. Int J Parasitol 2000;30:1217‑58. 2. Bastien P. Molecular diagnosis of toxoplasmosis. Trans R Soc Trop Med Hyg 2002;96 Suppl 1:S205‑15. 3. Rahumatullah A, Khoo BY, Noordin R. Triplex PCR using new primers for the detection of Toxoplasma gondii. Exp Parasitol 2012;131:231‑8. 4. Liang C, Chu Y, Cheng S, Wu H, Kajiyama T, Kambara H, et al. Multiplex loop‑mediated isothermal amplification detection by sequence‑based barcodes coupled with nicking endonuclease‑mediated pyrosequencing. Anal Chem 2012;84:3758‑63. 5. Savan R, Kono T, Itami T, Sakai M. Loop‑mediated isothermal amplification: An emerging technology for detection of fish and shellfish pathogens. J Fish Dis 2005;28:573‑81. 6. Jones CD, Okhravi N, Adamson P, Tasker S, Lightman S. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Invest Ophthalmol Vis Sci 2000;41:634‑44. 7. Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii. Parasitology 2010;137:1‑11. 8. Stark D, Beebe N, Marriott D, Ellis J, Harkness J. Evaluation of three diagnostic methods, including real‑time PCR, for detection of Dientamoeba fragilis in stool specimens. J Clin Microbiol 2006;44:232‑5. 9. Roux KH. Single‑step PCR optimization using touchdown and stepdown PCR programming. Methods Mol Biol 2002;192:31‑6. 10. Shen Z, Qu W, Wang W, Lu Y, Wu Y, Li Z, et al. MPprimer: A program for reliable multiplex PCR primer design. BMC Bioinformatics 2010;11:143.
How to cite this article: Hallur V, Sehgal R, Khurana S. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis. Indian J Med Microbiol 2015;33:271-3. Source of Support: Nil, Conflict of Interest: None declared.
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
