Journal of Microbiological Methods 107 (2014) 176–181
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Development of loop-mediated isothermal amplification assays for rapid and easy detection of Coxiella Burnetii Hua-Wei Chen a,b, Wei-Mei Ching a,b,⁎ a b
Naval Medical Research Center, Silver Spring, MD, United States Uniformed Services University of the Health Sciences, Bethesda, MD, United States
a r t i c l e
i n f o
Article history: Received 3 May 2014 Received in revised form 4 July 2014 Accepted 4 July 2014 Available online 22 October 2014 Keywords: Loop-mediated isothermal amplification (LAMP) Coxiella burnetii Rapid detection
a b s t r a c t Q fever is an important worldwide zoonosis that is caused by infection with Coxiella burnetii. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of the transposase gene insertion element IS1111a of C. burnetii. The sensitivity of this LAMP assay is very similar to quantitative PCR (qPCR) method with a detection limit at 25 copies of the gene, the equivalent of about one C. burnetii organism. Several methods for the detection of LAMP product were also performed to show the diverse way of detection which may be used in different settings depending on the user's infrastructure and resource. Published by Elsevier B.V.
1. Introduction Coxiella burnetii, a small Gram-negative bacterium is the causative agent of Q fever which is a worldwide zoonosis. Due to Q fever's worldwide distribution and the high infectivity of C. burnetii, the US military and civilian personnel deployed overseas are at high risk of being infected. Q fever manifests in two forms: acute and chronic infections. The acute Q fever illness most commonly presents as a flu-like illness, pneumonia, or hepatitis; however, asymptomatic infections may occur. Symptoms of Q fever are easily confused with those due to a variety of other pathogens (e.g., dengue and malaria) that may require different treatment regimens. The chronic form of the disease is infrequent (b 5% of patients with acute infection), but the potentially consequent endocarditis is often fatal if left untreated (Rolain et al., 2005; Anderson et al., 2013). Therefore, early diagnosis to guide an appropriate treatment is critical for patient care. Detection and quantification of the bacteria by conventional culturing methods are time consuming and dangerous. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples (Fournier and Raoult, 2003; Turra et al., 2006; Schneeberger et al., 2010). Because PCR method requires specialized equipment and extensive end user training, it is not suitable in resource-constrained areas for routine work.
⁎ Corresponding author at: Naval Medical Research Center, 503 Robert Grant Ave, Silver Spring, MD 20910, United States. Tel.: +1 301 319 7438; fax: +1 301 319 7451. E-mail address: [email protected] (W.-M. Ching).
http://dx.doi.org/10.1016/j.mimet.2014.07.039 0167-7012/Published by Elsevier B.V.
Loop-mediated isothermal amplification (LAMP) assay is a rapid DNA amplification method originally developed by Notomi et al (2000). It has been applied for the detection of several rickettsial pathogens (Paris et al., 2008; Huber et al., 2012; Pan et al., 2013). The method requires a specially designed primer set that recognizes at least six independent regions of the target gene, which increases the specificity as well as the rapidity of the reaction. Since the Bst DNA polymerase used in LAMP allows strand displacement-DNA synthesis, it is an autocycling strand displacement DNA synthesis method that can be performed at a single temperature around 60°–65 °C. LAMP reactions are performed under isothermal conditions using a simple incubator, such as a water bath or a heating block. The results are visualized by turbidity that can be seen by the naked eye (Mori et al., 2001), and optionally by agarose gel electrophoresis or by addition of fluorescent dyes to be visualized under UV light (Qiao et al., 2007; Tomita et al., 2008). We have developed a loop-mediated isothermal amplification assay to detect the presence of C. burnetii in plasma. Five sets of primers were designed using the transposase gene insertion element IS1111a. The amplification reaction mixtures were incubated at 60 °C for 60 min. We were able to detect about 25 copies of bacterial DNA (an equivalent of one organism) in the reaction using DNA extracted from human plasma samples spiked with either DNA plasmid containing the IS1111a or C. burnetii genomic DNA. The sensitivity of the LAMP assay was similar to qPCR. In this study, we also included SYBR green or hydroxy naphthol blue (HNB) in the reaction mixture for product detection. In addition specially labeled primers combined with immune-chromatography test (ICT) provided another easy-to-use detection system. Our results suggest that this assay has the potential to be used as a rapid, robust, and easy-to-perform assay in the endemic regions.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
2. Materials and methods 2.1. Design of primers Oligonucleotide primers used for the LAMP and qPCR assays were designed based on the transposase gene insertion element IS1111a of C. burnetii RSA 493. Five sets of primers were designed using PrimerExplorer V4 (http://primerexplorer.jp/e/). The primers used for the qPCR assay were previously described (Klee et al., 2006). All primers were synthesized by Eurofins MWG Operon (Huntsville, AL) and are described in Table 1. 2.2. Plasmid and genomic DNA template The gene IS1111a of C. burnetii RSA 493 was cloned into a pET24a vector, and the closed circular plasmid (pET24a-IS1111a) was purified using standard Qiagen plasmid mini kit (Qiagen, Stockach, Germany) following the manufacturer's instruction. The pure pET24a-IS1111a was quantified using a Nano-drop 2000 microsample spectrophotometer (Thermo Scientific, Wilmington, DE) and used as a standard in the selection of the best primer combination used in the LAMP assay. The genomic DNA from C. burnetii RSA 493 was used as template in both LAMP and qPCR as described below. The genomic DNA from other phylogenetically closed bacteria (Orientia tsutsugamushi, Rickettsia typhi, Rickettsia conorii, and Rickettsia rickettsi) were used in LAMP to evaluate the assay's specificity. 2.3. LAMP reaction LAMP reactions were carried out as described previously (Notomi et al., 2000). Briefly, a 25 μl reaction mixture contained 1.6 mM of each FIP and BIP primer, 0.8 mM of each LF and LB primer, 0.2 mM of each F3 and B3 primer, 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (SigmaAldrich, St. Louis, MO), 1.4 mM dNTP mixture (New England Biolabs, Beverly, MA), 8 U Bst DNA polymerase (New England Biolabs, Beverly, MA), and DNA template. The reaction mixture was incubated at 60 °C for 60 min. Each reaction was terminated by adding 5 μl of 10X BlueJuice (Invitrogen, Carlsbad, CA) for gel detection. The reaction products were examined by electrophoresis on 2% agarose gel stained with a 1:10,000
177
dilution of GelRed (Phenix Research Products, Asheville, NC) and visualized by UV light. Other detection methods, such as inclusion of HNB (Wastling et al., 2010) into the reaction mixture was used to visualize the reaction results with naked eyes or inclusion of SYBR green was used to detect the reaction products by a UV light. Furthermore, the inclusion of SYBR green in the reaction mixture also allowed real-time detection with fluorescence measurement systems such as ESEQuant Tube Scanner (Qiagen, Stockach, Germany) and 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA). All detection assays were performed in triplicate. 2.4. Sensitivity of the LAMP assay The serial dilutions of pET24a-IS1111a plasmid were used to determine the limit of detection. Quantitative PCR performed on 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA) was used to confirm the sensitivity of the LAMP assay. Primers designed against IS1111a gene sequence described in previous study were used (Klee et al., 2006) (Table 1). The total volume of each reaction was 20 μl. Each reaction mixture contained 0.5 μM of forward primer, 0.5 μM of reverse primer, 1X RT2 SYBR Green qPCR Mastermix (SA-Biosciences, Frederick, MD) and DNA template. An initial 10 minute activation step at 95 °C was followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. 2.5. Specificity of the LAMP assay Genomic DNA from three major Rickettsia species (R. typhi, R. conorii, and R. rickettsii) and four strains of O. tsutsugamushi (Karp, Kato, Gilliam, and TA763) were used to verify the specificity of the assay. 2.6. Feasibility of LAMP assay for plasma samples Normal human plasma (SeraCare, Milford, MA) spiked with pET24aIS1111a plasmid or C. burnetii genomic DNA were subjected to DNA extraction using QIAamp DNA Mini Kit (Qiagen, Stockach, Germany) according to the manufacturer's manual. A total of 200 μl plasma samples were used for extraction and extracted DNA were eluted in 20 μl volume. Three DNA extractions were performed independently. 2.7. Immuno-chromatography (ICT) strip cassette for amplicon detection
Table 1 List of primer sequences for five LAMP primer sets and qPCR primers (5′-3′). QF1-F3
GACGGGTTAAGCGTGCTC
QF1-B3 QF1-FIP QF1-BIP QF2-F3 QF2-B3 QF2-FIP QF2-BIP QF2-LF QF2-LB QF3-F3 QF3-B3 QF3-FIP QF3-BIP QF3-LB QF4-F3 QF4-B3 QF4-FIP QF4-BIP QF5-F3 QF5-B3 QF5-FIP QF5-BIP QF5-LB QF QR
CTGCGCATCGTTACGATCA GCTCCTCCACACGCTTCCATTGTATCCACCGTAGCCAGTC ATCGGACGTTTATGGGGATGGGACATACGGTTTGACGTGCTG CGTAGCCAGTCTTAAGGTGG GCGCTTGAACGTCTTGTTG GGACTGATCAACTGCGTTGGGAGTGTGGAGGAGCGAACCA CGTAACGATGCGCAGGCGATTTACCCTGCACAAACCGC ACCCATCCCCATAAACGTCCGA AGCTGAAGCGGCTTCCC GTGGCAAAAGCCAATGAGG CCGCGTTTACTAATCCCCAA GCATAAACCGAGAGCGCCGTTATTGTCAACGGGTACAGAGC TCATCGTTCCCGGCAGTTGTCCACCTCCTTATTCCCACTCG GGGTTGGTCCCTCGACAACAT CGGATGAAACGGGTGTTGAA AACTGCCGGGAACGATGA TTGGCTTTTGCCACCGCTTTTGAATTGTTGAACCGGGACGA GTACAGAGCATCCCGGGGGTTCACCCACGCTCGCATAA GGACGAAGCGATTGGTGATT TTCCCACTCGAATGTTGTCG CGTTAAATAACCCACCCCCGGGGTGGCAAAAGCCAATGAGG CGCTCTCGGTTTATGCGAGCGAACCCAATAAACGCCGACA GGGTGACATTCATCAATTTCATCGT GTCTTAAGGTGGGCTGCGTG CCCCGAATCTCATTGATCAGC
Type II BESt Cassettes (BioHelix, Beverly, MA) were used to detect LAMP products in an instrument-free and cross-contamination-proof manner. These cassettes were capable to detect an amplicon that is dual labeled with biotin and fluorescein. BESt cassette consists of two parts: an inner amplicon cartridge and an outer detection chamber. The amplicon cartridge holds running buffer and a reaction tube in place and the detection chamber holds a DNA test strip. We used 5′biotin-labeled QF3-FIP primers and 5′-FAM-labeled QF3-LB primers in the LAMP reactions in a 0.2 ml PCR tube. After amplification reaction, the reaction tube was inserted in an amplicon cartridge next to running buffer and the cassette was closed. The results were read by the presence or absence of the test line after 10 min at room temperature. 3. Results 3.1. Selection of the best primer set The LAMP reactions were performed under isothermal conditions in a range of 58 to 63 °C using pET24a-IS1111a plasmid for 60 min. Among those five sets of primer, primer set-3 performed the best, and it detected 100 copies per reaction at 60 °C (Fig. 1). Primer set-4 did not work at all (not shown). Therefore, the optimized temperature of 60 °C and primer set-3 were used for the rest of experiments.
178
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
A
B
1000 500
200
C
D
1000 500
200
Fig. 1. LAMP results for the serial dilutions of pET24a-IS1111a plasmid with primer set-1 (A), set-2 (B), set-3 (C), and set-5 (D). Reaction mixtures were incubated at 60 °C for 60 min. Lane 1, 100 bp ladder; Lane 2 to 6, reactions with 104, 103, 102, 10, and no copies of plasmid DNA.
3.2. Determine the sensitivity of the LAMP assay The limit of detection was 25 copies of pET24a-IS1111a plasmid as shown in Fig. 2.
samples. Each extracted DNA sample was tested in duplicate in qPCR runs. We observed a detection limit of 32 copies on average per reaction for plasmid samples and 24 copies per reaction for genomic samples based on standard curves obtained from diluted plasmids (Table 2 and 3).
3.3. Specificity of the LAMP assay The specificity of the LAMP assay was evaluated by using the genomic DNA from bacteria that are phylogenetcially close to Coxiella as the template. LAMP reactions containing 106 copies of different strains of O. tsutsugamushi (Karp, Kato, Gilliam, and TA763), R. typhi, R. conorii, and R. rickettsii DNA as template all tested negative (Fig. 3). One thousand copies of genomic DNA of C. burnetii and pET24a-IS1111a plasmid were used as positive controls for the experiment (Fig. 3). 3.4. Feasibility of LAMP assay on blood samples To mimic clinical samples, we spiked normal human plasma with pET24a-IS1111a plasmid or C. burnetii genomic DNA, then performed the LAMP analysis. DNA was extracted from triplicate
3.5. Detection of the LAMP products Agarose gel electrophoresis of the LAMP products displayed the typical ladder-like pattern by GelRed staining (Fig. 1). Alternative detection methods included the change of reaction mixture color due to the decrease of Mg2 + ions concentration by metal ion indicator HNB (Fig. 4A) or the detection of double stranded LAMP products by SYBR green (Fig. 4B). Monitoring the fluorescence signal at realtime with SYBR green presence in the reaction was also performed with a fluorescence measurement system (Fig. 4C). Furthermore, with the biotin-labeled FIP and FAM-labeled LB primers, the LAMP amplicons could be detected by an ICT strip cassette (Fig. 4D). All these methods have the same detection limit at 25 copies per reaction.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
179
1000
500
200
Fig. 2. Determine the sensitivity of the LAMP assay. Primer set-3 was used in the reaction with different copies of pET24a-IS1111a plasmid. Reaction mixtures were incubated at 60 °C for 60 min. Lane 1, 100 bp ladder; Lane 2 to 9, reactions with 500, 250, 100, 50, 25, 10, 5, and no copies of plasmid.
4. Discussion Q fever is a widespread zoonosis, and it is difficult to distinguish from other febrile diseases because of a lack of specific clinical symptoms (Angelakis and Raoult, 2010). The most reliable diagnosis for Q fever is the isolation of the pathogen, but isolation of C. burnetii in cell culture is laborious. It requires specially trained staff and has to be performed in a BSL-3 laboratory, confining C. burnetii culture to a limited number of laboratories. The current diagnosis of Q fever relies mainly on serological methods such as indirect immunofluorescent antibody assay (IFA) and ELISA (Chen et al., 2014). However, IFA or ELISA is not suitable for early diagnosis because high levels of antibody appear late
103
103
106
in the disease. PCR or qPCR offers an alternative to culture for direct detection of C. burnetii in clinical samples. The majority of PCR assays for C. burnetii have targeted the insertion element IS1111 (Fenollar et al., 2004; Klee et al., 2006; Panning et al., 2008; Schneeberger et al., 2010). The IS1111 was selected because of its high conservation of gene sequence among the different strains of C. burnetii and the presence of multiple copies (7 to 110) in the bacteria (Klee et al., 2006), which can lead to a higher sensitivity. qPCR has advantages with respect to quantification, control of contamination and sensitivity, but it requires specialized equipment. Here, we have developed a sensitive and specific LAMP assay targeting the insertion element IS1111a (Hoover et al., 1992). Our
106
106
5
6
106
106
106
106
8
9
10
cp/rxn
1000
500
200
1
2
3
4
7
Fig. 3. Specificity test of LAMP primers. Lane 1, 100 bp ladder; Lane 2, 1000 copies of pET24a-IS1111a plasmid; Lane 3, 1000 copies of C. burnetti genomic DNA; Lane 4 to 10, 106 copies of genomic DNA from O. tsutsugamushi Karp, Kato, Gilliam, and TA763 strains and R. typhi, R. conorii, and R. rickettsii.
180
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
sensitivity (data not shown). We also tested ten patient sera that were confirmed positive by qPCR. The LAMP assay detected eight out of the ten as being positive. The Ct value for the two negative samples by LAMP were 37.5 and 39.4. These numbers were higher than the Ct value of the eight LAMP positive samples (data not shown). The PCR requires repetitive cycling between two or three highly accurate temperatures, which renders it more difficult to adapt to field-deployable devices. High quality DNA is also required as a great range of contaminants inhibit the Taq DNA polymerase activity in PCR amplification. The Bst DNA polymerase is much less sensitive to components in blood products than Taq polymerases used in PCR; thus, DNA need not to be purified to the extent needed for PCR (Grab et al., 2005; Iwata et al., 2006; Ihira et al., 2007). The LAMP assay has been used to detect pathogens directly from serum samples without the DNA extraction step (Iwata et al., 2006; Ihira et al., 2007). Further, DNA detection by conventional PCR requires gel electrophoresis, whereas qPCR requires excitation at a specific fluorescence wavelength range and detection at a second fluorescence wavelength range. While compact PCR devices are in various stages of development and commercialization, a single temperature device with field compatibility, similar sensitivity and specificity to PCR, and a simple visual readout, would pave the way to a much greater use of DNA detection-based field diagnosis. The LAMP assay, which can be carried out in a heating block or water bath, has the potential to be used in a field detection system for C. burnetii. Recently, a LAMP method targeting the htpAB gene of C. burnetii has been published (Pan et al., 2013). In their study, the LAMP products were examined by electrophoresis on stained agarose gel. Our study presents a variety of methods that not only can detect the LAMP products without opening the reaction tubes to avoid laboratory cross contamination problem but also has a shorter reaction time. The advantage of using these detection methods will greatly enhance our ability to quickly diagnose an individual for C. burnetii infection. This will allow
Table 2 Detection limit of IS1111a in normal human plasma spiked with plasmid DNA. Starting material (cp/ml) 200 μl for extraction (cp) Elute in 20 μla (cp/μl) Add 5 μl in LAMP (cp) qPCR quantificationb (cp) LAMP resultc
10,000 2000 100 500 340 pos
5000 1000 50 250 175 pos
2500 500 25 125 78 pos
1000 200 10 50 32 pos
500 100 5 25 12 neg
0 0 0 0 0 neg
a
Assuming 100% recovery for the extraction steps. Copy numbers are based on standard curves obtained from diluted pET24a-IS1111a plasmid. They are the average of three independent experiments. c Pos indicates the presence of a ladder-like banding pattern indicating DNA amplification. Neg shows no sign of bands on 2% agarose gel. b
Table 3 Detection limit of IS1111a in normal human plasma spiked with genomic DNA. Starting material (cp/ml) 200 μl for extraction (cp) Elute in 20 μl (cp/μl)a Add 5 μl in LAMP (cp) qPCR quantificationb (cp) LAMP resultc
5000 1000 50 250 163 pos
2500 500 25 125 69 pos
1000 200 10 50 24 pos
500 100 5 25 10 neg
0 0 0 0 0 neg
a
Assuming 100% recovery for the extraction steps. Copy numbers are based on standard curves obtained from diluted pET24a-IS1111a plasmid. They are the average of three independent experiments. c Pos indicates the presence of a ladder-like banding pattern indicating DNA amplification. Neg shows no sign of bands on 2% agarose gel. b
results have shown that LAMP detects about 25 copies of bacterial DNA (an equivalent of one organism for the majority of isolates) with sensitivity similar to that of qPCR. Temperatures between 58 and 63 °C were tested to determine the optimal incubation temperature for the LAMP reaction. Sixty degrees yielded the highest sensitivity. Also, in an effort to increase the sensitivity of the assay, combinations of different primer sets were included in the reaction but showed no improvement of the
A
100
25
50
10
0
cp/rxn
C 800 600 400 200 0
B
100
1
50
2
25
3
10
4
0
5
cp/rxn
D
0
1000
2000
3000
4000
100
50
25
10
0
1
2
3
4
cp/rxn
5
Fig. 4. Methods to detect LAMP products. Reaction containing hydroxynaphthol blue (A), or SYBR green (B, C), or biotin-labeled FIP and FAM-labeled LB primers (D) were used to detect LAMP products. Primer set-3 was used in the reaction with different copies of pET24a-IS1111a plasmid. Reactions were carried out at 60 °C for 60 min. Lane 1 to 5, reactions with 100, 50, 25, 10, and no copies of plasmid. (C), reactions with 100 (blue), 50 (red), 25 (green), 10 (gray), and no (purple) copies of plasmid.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
rapid and appropriate treatment of acute Q fever and will lessen the likelihood of future undiagnosed chronic infection. In conclusion, this LAMP assay is rapid, robust, and easy-to-perform and can be used in the endemic regions. In the future, we would like to conduct LAMP assay for different sample matrix such as milk, whole blood and animal tissues. These studies will establish the detection sensitivity for C. burnetii in different natural sample matrix. Acknowledgments This research was supported by Naval Medical Research Center, research work unit 6000.RAD1.J.A0310. The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, or the U.S. Government. Wei-Mei Ching is an employee of the U.S. Government. This work was prepared as part of her official duties. Title 17 U.S.C. §105 provides that ‘Copyright protection under this title is not available for any work of the United States Government.’ Title 17 U.S.C. §101 defines a U.S. Government work as a work prepared by military service member or employee of the U.S. Government as part of that person's official duties. References Anderson, A., Bijlmer, H., Fournier, P.E., Graves, S., Hartzell, J., Kersh, G.J., Limonard, G., Marrie, T.J., Massung, R.F., McQuiston, J.H., Nicholson, W.L., Paddock, C.D., Sexton, D.J., 2013. Diagnosis and management of Q fever United States, 2013: recommendations from CDC and the Q Fever Working Group. MMWR Recomm. Rep. 62 (3), 1–30. Angelakis, E., Raoult, D., 2010. Fever. Vet. Microbiol. 140 (3–4), 297–309. Chen, H.W., Zhang, Z., Glennon, E., Ching, W.M., 2014. Int. J. Bacteriol. http://dx.doi.org/10. 1155/2014/707463. Fenollar, F., Fournier, P.E., Raoult, D., 2004. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J. Clin. Microbiol. 42 (11), 4919–4924. Fournier, P.E., Raoult, D., 2003. Comparison of PCR and serology assays for early diagnosis of acute Q fever. J. Clin. Microbiol. 41 (11), 5094–5098. Grab, D.J., Lonsdale-Eccles, J., Inoue, N., 2005. Lamp for tadpoles. Nat. Methods 2 (9), 635–636. Hoover, T.A., Vodkin, M.H., Williams, J.C., 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion equence. J. Bacteriol. 174 (17), 5540–5548. Huber, E., Ji, D., Howell, L., Zhang, Z., Chen, H.W., Ching, W.M., Chao, C.C., 2012. Loopmediated isothermal amplication assay targeting the 47-kDa gene of Orientia
181
tsutsugamushi: a rapid and sensitive alternative to real-time PCR. J. Med. Microbiol. Diagn. 1, 112. http://dx.doi.org/10.4172/2161-0703.1000112. Ihira, M., Akimoto, S., Miyake, F., Fujita, A., Sugata, K., Suga, S., Ohashi, M., Nishimura, N., Ozaki, T., Asano, Y., Yoshikawa, T., 2007. Direct detection of human herpesvirus 6 DNA in serum by the loop-mediated isothermal amplification method. J. Clin. Virol. 39 (1), 22–26. Iwata, S., Shibata, Y., Kawada, J., Hara, S., Nishiyama, Y., Morishima, T., Ihira, M., Yoshikawa, T., Asano, Y., Kimura, H., 2006. Rapid detection of Epstein–Barr virus DNA by loopmediated isothermal amplification method. J. Clin. Virol. 37 (2), 128–133. Klee, S.R., Tyczka, J., Ellerbrok, H., Franz, T., Linke, S., Baljer, G., Appel, B., 2006. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 6, 2–9. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289 (1), 150–154. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63. Pan, L., Zhang, L., Wang, G., Liu, Q., 2012. Rapid, simple, and sensitive detection of the ompB gene of spotted fever group rickettsiae by loop-mediated isothermal amplification. BMC Infect. Dis. 12, 254. http://dx.doi.org/10.1186/1471-2334-12-254. Pan, L., Zhang, L., Fan, D., Zhang, X., Liu, H., Lu, Q., Xu, Q., 2013. Rapid, simple and sensitive detection of Q fever by loop-mediated isothermal amplification of the htpAB gene. PLoS Negl. Trop. Dis. 7 (5), e2231. Panning, M., Kilwinski, J., Greiner-Fischer, S., Peters, M., Kramme, S., Frangoulidis, D., Meyer, H., Henning, K., Drosten, C., 2008. High throughput detection of Coxiella burnetii by real-time PCR with internal control system and automated DNA preparation. BMC Microbiol. 8, 77–84. Paris, D.H., Blacksell, S.D., Newton, P.N., Day, N.P., 2008. Simple, rapid and sensitive detection of Orientia tsutsugamushi by loo-isothermal DNA amplification. Trans. R. Soc. Trop. Med. Hyg. 102 (12), 1239–1246. Qiao, Y.M., Guo, Y.C., Zhang, X.E., Zhou, Y.F., Zhang, Z.P., Wei, H.P., Yang, R.F., Wang, D.B., 2007. Loop-mediated isothermal amplification for rapid detection of Bacillus anthracis spores. Biotechnol. Lett. 29 (12), 1939–1946. Rolain, J.M., Boulos, A., Mallet, M.N., Raoult, D., 2005. Correlation between ratio of serum doxycycline concentration to MIC and rapid decline of antibody levels during treatment of Q fever endocarditis. Antimicrob. Agents Chemother. 49 (7), 2673–2676. Schneeberger, P.M., Hermans, M.H., van Hannen, E.J., Schellekens, J.J., Leenders, A.C., Wever, P.C., 2010. Real-time PCR with serum samples is indispensable for early diagnosis of acute Q fever. Clin. Vaccine Immunol. 17 (2), 286–290. Tomita, N., Mori, Y., Kanda, H., Notomi, T., 2008. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 3 (5), 877–882. Turra, M., Chang, G., Whybrow, D., Higgins, G., Qiao, M., 2006. Diagnosis of acute Q fever by PCR on sera during a recent outbreak in rural South Australia. Ann. N. Y. Acad. Sci. 1078, 566–569. Wastling, S.L., Picozzi, K., Kakembo, A.S., Welburn, S.C., 2010. LAMP for human African trypanosomiasis: a comparative study of detection formats. PLoS Negl. Trop. Dis. 4 (11), e865.
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Development of loop-mediated isothermal amplification assays for rapid and easy detection of Coxiella Burnetii Hua-Wei Chen a,b, Wei-Mei Ching a,b,⁎ a b
Naval Medical Research Center, Silver Spring, MD, United States Uniformed Services University of the Health Sciences, Bethesda, MD, United States
a r t i c l e
i n f o
Article history: Received 3 May 2014 Received in revised form 4 July 2014 Accepted 4 July 2014 Available online 22 October 2014 Keywords: Loop-mediated isothermal amplification (LAMP) Coxiella burnetii Rapid detection
a b s t r a c t Q fever is an important worldwide zoonosis that is caused by infection with Coxiella burnetii. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of the transposase gene insertion element IS1111a of C. burnetii. The sensitivity of this LAMP assay is very similar to quantitative PCR (qPCR) method with a detection limit at 25 copies of the gene, the equivalent of about one C. burnetii organism. Several methods for the detection of LAMP product were also performed to show the diverse way of detection which may be used in different settings depending on the user's infrastructure and resource. Published by Elsevier B.V.
1. Introduction Coxiella burnetii, a small Gram-negative bacterium is the causative agent of Q fever which is a worldwide zoonosis. Due to Q fever's worldwide distribution and the high infectivity of C. burnetii, the US military and civilian personnel deployed overseas are at high risk of being infected. Q fever manifests in two forms: acute and chronic infections. The acute Q fever illness most commonly presents as a flu-like illness, pneumonia, or hepatitis; however, asymptomatic infections may occur. Symptoms of Q fever are easily confused with those due to a variety of other pathogens (e.g., dengue and malaria) that may require different treatment regimens. The chronic form of the disease is infrequent (b 5% of patients with acute infection), but the potentially consequent endocarditis is often fatal if left untreated (Rolain et al., 2005; Anderson et al., 2013). Therefore, early diagnosis to guide an appropriate treatment is critical for patient care. Detection and quantification of the bacteria by conventional culturing methods are time consuming and dangerous. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples (Fournier and Raoult, 2003; Turra et al., 2006; Schneeberger et al., 2010). Because PCR method requires specialized equipment and extensive end user training, it is not suitable in resource-constrained areas for routine work.
⁎ Corresponding author at: Naval Medical Research Center, 503 Robert Grant Ave, Silver Spring, MD 20910, United States. Tel.: +1 301 319 7438; fax: +1 301 319 7451. E-mail address: [email protected] (W.-M. Ching).
http://dx.doi.org/10.1016/j.mimet.2014.07.039 0167-7012/Published by Elsevier B.V.
Loop-mediated isothermal amplification (LAMP) assay is a rapid DNA amplification method originally developed by Notomi et al (2000). It has been applied for the detection of several rickettsial pathogens (Paris et al., 2008; Huber et al., 2012; Pan et al., 2013). The method requires a specially designed primer set that recognizes at least six independent regions of the target gene, which increases the specificity as well as the rapidity of the reaction. Since the Bst DNA polymerase used in LAMP allows strand displacement-DNA synthesis, it is an autocycling strand displacement DNA synthesis method that can be performed at a single temperature around 60°–65 °C. LAMP reactions are performed under isothermal conditions using a simple incubator, such as a water bath or a heating block. The results are visualized by turbidity that can be seen by the naked eye (Mori et al., 2001), and optionally by agarose gel electrophoresis or by addition of fluorescent dyes to be visualized under UV light (Qiao et al., 2007; Tomita et al., 2008). We have developed a loop-mediated isothermal amplification assay to detect the presence of C. burnetii in plasma. Five sets of primers were designed using the transposase gene insertion element IS1111a. The amplification reaction mixtures were incubated at 60 °C for 60 min. We were able to detect about 25 copies of bacterial DNA (an equivalent of one organism) in the reaction using DNA extracted from human plasma samples spiked with either DNA plasmid containing the IS1111a or C. burnetii genomic DNA. The sensitivity of the LAMP assay was similar to qPCR. In this study, we also included SYBR green or hydroxy naphthol blue (HNB) in the reaction mixture for product detection. In addition specially labeled primers combined with immune-chromatography test (ICT) provided another easy-to-use detection system. Our results suggest that this assay has the potential to be used as a rapid, robust, and easy-to-perform assay in the endemic regions.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
2. Materials and methods 2.1. Design of primers Oligonucleotide primers used for the LAMP and qPCR assays were designed based on the transposase gene insertion element IS1111a of C. burnetii RSA 493. Five sets of primers were designed using PrimerExplorer V4 (http://primerexplorer.jp/e/). The primers used for the qPCR assay were previously described (Klee et al., 2006). All primers were synthesized by Eurofins MWG Operon (Huntsville, AL) and are described in Table 1. 2.2. Plasmid and genomic DNA template The gene IS1111a of C. burnetii RSA 493 was cloned into a pET24a vector, and the closed circular plasmid (pET24a-IS1111a) was purified using standard Qiagen plasmid mini kit (Qiagen, Stockach, Germany) following the manufacturer's instruction. The pure pET24a-IS1111a was quantified using a Nano-drop 2000 microsample spectrophotometer (Thermo Scientific, Wilmington, DE) and used as a standard in the selection of the best primer combination used in the LAMP assay. The genomic DNA from C. burnetii RSA 493 was used as template in both LAMP and qPCR as described below. The genomic DNA from other phylogenetically closed bacteria (Orientia tsutsugamushi, Rickettsia typhi, Rickettsia conorii, and Rickettsia rickettsi) were used in LAMP to evaluate the assay's specificity. 2.3. LAMP reaction LAMP reactions were carried out as described previously (Notomi et al., 2000). Briefly, a 25 μl reaction mixture contained 1.6 mM of each FIP and BIP primer, 0.8 mM of each LF and LB primer, 0.2 mM of each F3 and B3 primer, 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (SigmaAldrich, St. Louis, MO), 1.4 mM dNTP mixture (New England Biolabs, Beverly, MA), 8 U Bst DNA polymerase (New England Biolabs, Beverly, MA), and DNA template. The reaction mixture was incubated at 60 °C for 60 min. Each reaction was terminated by adding 5 μl of 10X BlueJuice (Invitrogen, Carlsbad, CA) for gel detection. The reaction products were examined by electrophoresis on 2% agarose gel stained with a 1:10,000
177
dilution of GelRed (Phenix Research Products, Asheville, NC) and visualized by UV light. Other detection methods, such as inclusion of HNB (Wastling et al., 2010) into the reaction mixture was used to visualize the reaction results with naked eyes or inclusion of SYBR green was used to detect the reaction products by a UV light. Furthermore, the inclusion of SYBR green in the reaction mixture also allowed real-time detection with fluorescence measurement systems such as ESEQuant Tube Scanner (Qiagen, Stockach, Germany) and 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA). All detection assays were performed in triplicate. 2.4. Sensitivity of the LAMP assay The serial dilutions of pET24a-IS1111a plasmid were used to determine the limit of detection. Quantitative PCR performed on 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA) was used to confirm the sensitivity of the LAMP assay. Primers designed against IS1111a gene sequence described in previous study were used (Klee et al., 2006) (Table 1). The total volume of each reaction was 20 μl. Each reaction mixture contained 0.5 μM of forward primer, 0.5 μM of reverse primer, 1X RT2 SYBR Green qPCR Mastermix (SA-Biosciences, Frederick, MD) and DNA template. An initial 10 minute activation step at 95 °C was followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. 2.5. Specificity of the LAMP assay Genomic DNA from three major Rickettsia species (R. typhi, R. conorii, and R. rickettsii) and four strains of O. tsutsugamushi (Karp, Kato, Gilliam, and TA763) were used to verify the specificity of the assay. 2.6. Feasibility of LAMP assay for plasma samples Normal human plasma (SeraCare, Milford, MA) spiked with pET24aIS1111a plasmid or C. burnetii genomic DNA were subjected to DNA extraction using QIAamp DNA Mini Kit (Qiagen, Stockach, Germany) according to the manufacturer's manual. A total of 200 μl plasma samples were used for extraction and extracted DNA were eluted in 20 μl volume. Three DNA extractions were performed independently. 2.7. Immuno-chromatography (ICT) strip cassette for amplicon detection
Table 1 List of primer sequences for five LAMP primer sets and qPCR primers (5′-3′). QF1-F3
GACGGGTTAAGCGTGCTC
QF1-B3 QF1-FIP QF1-BIP QF2-F3 QF2-B3 QF2-FIP QF2-BIP QF2-LF QF2-LB QF3-F3 QF3-B3 QF3-FIP QF3-BIP QF3-LB QF4-F3 QF4-B3 QF4-FIP QF4-BIP QF5-F3 QF5-B3 QF5-FIP QF5-BIP QF5-LB QF QR
CTGCGCATCGTTACGATCA GCTCCTCCACACGCTTCCATTGTATCCACCGTAGCCAGTC ATCGGACGTTTATGGGGATGGGACATACGGTTTGACGTGCTG CGTAGCCAGTCTTAAGGTGG GCGCTTGAACGTCTTGTTG GGACTGATCAACTGCGTTGGGAGTGTGGAGGAGCGAACCA CGTAACGATGCGCAGGCGATTTACCCTGCACAAACCGC ACCCATCCCCATAAACGTCCGA AGCTGAAGCGGCTTCCC GTGGCAAAAGCCAATGAGG CCGCGTTTACTAATCCCCAA GCATAAACCGAGAGCGCCGTTATTGTCAACGGGTACAGAGC TCATCGTTCCCGGCAGTTGTCCACCTCCTTATTCCCACTCG GGGTTGGTCCCTCGACAACAT CGGATGAAACGGGTGTTGAA AACTGCCGGGAACGATGA TTGGCTTTTGCCACCGCTTTTGAATTGTTGAACCGGGACGA GTACAGAGCATCCCGGGGGTTCACCCACGCTCGCATAA GGACGAAGCGATTGGTGATT TTCCCACTCGAATGTTGTCG CGTTAAATAACCCACCCCCGGGGTGGCAAAAGCCAATGAGG CGCTCTCGGTTTATGCGAGCGAACCCAATAAACGCCGACA GGGTGACATTCATCAATTTCATCGT GTCTTAAGGTGGGCTGCGTG CCCCGAATCTCATTGATCAGC
Type II BESt Cassettes (BioHelix, Beverly, MA) were used to detect LAMP products in an instrument-free and cross-contamination-proof manner. These cassettes were capable to detect an amplicon that is dual labeled with biotin and fluorescein. BESt cassette consists of two parts: an inner amplicon cartridge and an outer detection chamber. The amplicon cartridge holds running buffer and a reaction tube in place and the detection chamber holds a DNA test strip. We used 5′biotin-labeled QF3-FIP primers and 5′-FAM-labeled QF3-LB primers in the LAMP reactions in a 0.2 ml PCR tube. After amplification reaction, the reaction tube was inserted in an amplicon cartridge next to running buffer and the cassette was closed. The results were read by the presence or absence of the test line after 10 min at room temperature. 3. Results 3.1. Selection of the best primer set The LAMP reactions were performed under isothermal conditions in a range of 58 to 63 °C using pET24a-IS1111a plasmid for 60 min. Among those five sets of primer, primer set-3 performed the best, and it detected 100 copies per reaction at 60 °C (Fig. 1). Primer set-4 did not work at all (not shown). Therefore, the optimized temperature of 60 °C and primer set-3 were used for the rest of experiments.
178
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
A
B
1000 500
200
C
D
1000 500
200
Fig. 1. LAMP results for the serial dilutions of pET24a-IS1111a plasmid with primer set-1 (A), set-2 (B), set-3 (C), and set-5 (D). Reaction mixtures were incubated at 60 °C for 60 min. Lane 1, 100 bp ladder; Lane 2 to 6, reactions with 104, 103, 102, 10, and no copies of plasmid DNA.
3.2. Determine the sensitivity of the LAMP assay The limit of detection was 25 copies of pET24a-IS1111a plasmid as shown in Fig. 2.
samples. Each extracted DNA sample was tested in duplicate in qPCR runs. We observed a detection limit of 32 copies on average per reaction for plasmid samples and 24 copies per reaction for genomic samples based on standard curves obtained from diluted plasmids (Table 2 and 3).
3.3. Specificity of the LAMP assay The specificity of the LAMP assay was evaluated by using the genomic DNA from bacteria that are phylogenetcially close to Coxiella as the template. LAMP reactions containing 106 copies of different strains of O. tsutsugamushi (Karp, Kato, Gilliam, and TA763), R. typhi, R. conorii, and R. rickettsii DNA as template all tested negative (Fig. 3). One thousand copies of genomic DNA of C. burnetii and pET24a-IS1111a plasmid were used as positive controls for the experiment (Fig. 3). 3.4. Feasibility of LAMP assay on blood samples To mimic clinical samples, we spiked normal human plasma with pET24a-IS1111a plasmid or C. burnetii genomic DNA, then performed the LAMP analysis. DNA was extracted from triplicate
3.5. Detection of the LAMP products Agarose gel electrophoresis of the LAMP products displayed the typical ladder-like pattern by GelRed staining (Fig. 1). Alternative detection methods included the change of reaction mixture color due to the decrease of Mg2 + ions concentration by metal ion indicator HNB (Fig. 4A) or the detection of double stranded LAMP products by SYBR green (Fig. 4B). Monitoring the fluorescence signal at realtime with SYBR green presence in the reaction was also performed with a fluorescence measurement system (Fig. 4C). Furthermore, with the biotin-labeled FIP and FAM-labeled LB primers, the LAMP amplicons could be detected by an ICT strip cassette (Fig. 4D). All these methods have the same detection limit at 25 copies per reaction.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
179
1000
500
200
Fig. 2. Determine the sensitivity of the LAMP assay. Primer set-3 was used in the reaction with different copies of pET24a-IS1111a plasmid. Reaction mixtures were incubated at 60 °C for 60 min. Lane 1, 100 bp ladder; Lane 2 to 9, reactions with 500, 250, 100, 50, 25, 10, 5, and no copies of plasmid.
4. Discussion Q fever is a widespread zoonosis, and it is difficult to distinguish from other febrile diseases because of a lack of specific clinical symptoms (Angelakis and Raoult, 2010). The most reliable diagnosis for Q fever is the isolation of the pathogen, but isolation of C. burnetii in cell culture is laborious. It requires specially trained staff and has to be performed in a BSL-3 laboratory, confining C. burnetii culture to a limited number of laboratories. The current diagnosis of Q fever relies mainly on serological methods such as indirect immunofluorescent antibody assay (IFA) and ELISA (Chen et al., 2014). However, IFA or ELISA is not suitable for early diagnosis because high levels of antibody appear late
103
103
106
in the disease. PCR or qPCR offers an alternative to culture for direct detection of C. burnetii in clinical samples. The majority of PCR assays for C. burnetii have targeted the insertion element IS1111 (Fenollar et al., 2004; Klee et al., 2006; Panning et al., 2008; Schneeberger et al., 2010). The IS1111 was selected because of its high conservation of gene sequence among the different strains of C. burnetii and the presence of multiple copies (7 to 110) in the bacteria (Klee et al., 2006), which can lead to a higher sensitivity. qPCR has advantages with respect to quantification, control of contamination and sensitivity, but it requires specialized equipment. Here, we have developed a sensitive and specific LAMP assay targeting the insertion element IS1111a (Hoover et al., 1992). Our
106
106
5
6
106
106
106
106
8
9
10
cp/rxn
1000
500
200
1
2
3
4
7
Fig. 3. Specificity test of LAMP primers. Lane 1, 100 bp ladder; Lane 2, 1000 copies of pET24a-IS1111a plasmid; Lane 3, 1000 copies of C. burnetti genomic DNA; Lane 4 to 10, 106 copies of genomic DNA from O. tsutsugamushi Karp, Kato, Gilliam, and TA763 strains and R. typhi, R. conorii, and R. rickettsii.
180
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
sensitivity (data not shown). We also tested ten patient sera that were confirmed positive by qPCR. The LAMP assay detected eight out of the ten as being positive. The Ct value for the two negative samples by LAMP were 37.5 and 39.4. These numbers were higher than the Ct value of the eight LAMP positive samples (data not shown). The PCR requires repetitive cycling between two or three highly accurate temperatures, which renders it more difficult to adapt to field-deployable devices. High quality DNA is also required as a great range of contaminants inhibit the Taq DNA polymerase activity in PCR amplification. The Bst DNA polymerase is much less sensitive to components in blood products than Taq polymerases used in PCR; thus, DNA need not to be purified to the extent needed for PCR (Grab et al., 2005; Iwata et al., 2006; Ihira et al., 2007). The LAMP assay has been used to detect pathogens directly from serum samples without the DNA extraction step (Iwata et al., 2006; Ihira et al., 2007). Further, DNA detection by conventional PCR requires gel electrophoresis, whereas qPCR requires excitation at a specific fluorescence wavelength range and detection at a second fluorescence wavelength range. While compact PCR devices are in various stages of development and commercialization, a single temperature device with field compatibility, similar sensitivity and specificity to PCR, and a simple visual readout, would pave the way to a much greater use of DNA detection-based field diagnosis. The LAMP assay, which can be carried out in a heating block or water bath, has the potential to be used in a field detection system for C. burnetii. Recently, a LAMP method targeting the htpAB gene of C. burnetii has been published (Pan et al., 2013). In their study, the LAMP products were examined by electrophoresis on stained agarose gel. Our study presents a variety of methods that not only can detect the LAMP products without opening the reaction tubes to avoid laboratory cross contamination problem but also has a shorter reaction time. The advantage of using these detection methods will greatly enhance our ability to quickly diagnose an individual for C. burnetii infection. This will allow
Table 2 Detection limit of IS1111a in normal human plasma spiked with plasmid DNA. Starting material (cp/ml) 200 μl for extraction (cp) Elute in 20 μla (cp/μl) Add 5 μl in LAMP (cp) qPCR quantificationb (cp) LAMP resultc
10,000 2000 100 500 340 pos
5000 1000 50 250 175 pos
2500 500 25 125 78 pos
1000 200 10 50 32 pos
500 100 5 25 12 neg
0 0 0 0 0 neg
a
Assuming 100% recovery for the extraction steps. Copy numbers are based on standard curves obtained from diluted pET24a-IS1111a plasmid. They are the average of three independent experiments. c Pos indicates the presence of a ladder-like banding pattern indicating DNA amplification. Neg shows no sign of bands on 2% agarose gel. b
Table 3 Detection limit of IS1111a in normal human plasma spiked with genomic DNA. Starting material (cp/ml) 200 μl for extraction (cp) Elute in 20 μl (cp/μl)a Add 5 μl in LAMP (cp) qPCR quantificationb (cp) LAMP resultc
5000 1000 50 250 163 pos
2500 500 25 125 69 pos
1000 200 10 50 24 pos
500 100 5 25 10 neg
0 0 0 0 0 neg
a
Assuming 100% recovery for the extraction steps. Copy numbers are based on standard curves obtained from diluted pET24a-IS1111a plasmid. They are the average of three independent experiments. c Pos indicates the presence of a ladder-like banding pattern indicating DNA amplification. Neg shows no sign of bands on 2% agarose gel. b
results have shown that LAMP detects about 25 copies of bacterial DNA (an equivalent of one organism for the majority of isolates) with sensitivity similar to that of qPCR. Temperatures between 58 and 63 °C were tested to determine the optimal incubation temperature for the LAMP reaction. Sixty degrees yielded the highest sensitivity. Also, in an effort to increase the sensitivity of the assay, combinations of different primer sets were included in the reaction but showed no improvement of the
A
100
25
50
10
0
cp/rxn
C 800 600 400 200 0
B
100
1
50
2
25
3
10
4
0
5
cp/rxn
D
0
1000
2000
3000
4000
100
50
25
10
0
1
2
3
4
cp/rxn
5
Fig. 4. Methods to detect LAMP products. Reaction containing hydroxynaphthol blue (A), or SYBR green (B, C), or biotin-labeled FIP and FAM-labeled LB primers (D) were used to detect LAMP products. Primer set-3 was used in the reaction with different copies of pET24a-IS1111a plasmid. Reactions were carried out at 60 °C for 60 min. Lane 1 to 5, reactions with 100, 50, 25, 10, and no copies of plasmid. (C), reactions with 100 (blue), 50 (red), 25 (green), 10 (gray), and no (purple) copies of plasmid.
H.-W. Chen, W.-M. Ching / Journal of Microbiological Methods 107 (2014) 176–181
rapid and appropriate treatment of acute Q fever and will lessen the likelihood of future undiagnosed chronic infection. In conclusion, this LAMP assay is rapid, robust, and easy-to-perform and can be used in the endemic regions. In the future, we would like to conduct LAMP assay for different sample matrix such as milk, whole blood and animal tissues. These studies will establish the detection sensitivity for C. burnetii in different natural sample matrix. Acknowledgments This research was supported by Naval Medical Research Center, research work unit 6000.RAD1.J.A0310. The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, or the U.S. Government. Wei-Mei Ching is an employee of the U.S. Government. This work was prepared as part of her official duties. Title 17 U.S.C. §105 provides that ‘Copyright protection under this title is not available for any work of the United States Government.’ Title 17 U.S.C. §101 defines a U.S. Government work as a work prepared by military service member or employee of the U.S. Government as part of that person's official duties. References Anderson, A., Bijlmer, H., Fournier, P.E., Graves, S., Hartzell, J., Kersh, G.J., Limonard, G., Marrie, T.J., Massung, R.F., McQuiston, J.H., Nicholson, W.L., Paddock, C.D., Sexton, D.J., 2013. Diagnosis and management of Q fever United States, 2013: recommendations from CDC and the Q Fever Working Group. MMWR Recomm. Rep. 62 (3), 1–30. Angelakis, E., Raoult, D., 2010. Fever. Vet. Microbiol. 140 (3–4), 297–309. Chen, H.W., Zhang, Z., Glennon, E., Ching, W.M., 2014. Int. J. Bacteriol. http://dx.doi.org/10. 1155/2014/707463. Fenollar, F., Fournier, P.E., Raoult, D., 2004. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J. Clin. Microbiol. 42 (11), 4919–4924. Fournier, P.E., Raoult, D., 2003. Comparison of PCR and serology assays for early diagnosis of acute Q fever. J. Clin. Microbiol. 41 (11), 5094–5098. Grab, D.J., Lonsdale-Eccles, J., Inoue, N., 2005. Lamp for tadpoles. Nat. Methods 2 (9), 635–636. Hoover, T.A., Vodkin, M.H., Williams, J.C., 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion equence. J. Bacteriol. 174 (17), 5540–5548. Huber, E., Ji, D., Howell, L., Zhang, Z., Chen, H.W., Ching, W.M., Chao, C.C., 2012. Loopmediated isothermal amplication assay targeting the 47-kDa gene of Orientia
181
tsutsugamushi: a rapid and sensitive alternative to real-time PCR. J. Med. Microbiol. Diagn. 1, 112. http://dx.doi.org/10.4172/2161-0703.1000112. Ihira, M., Akimoto, S., Miyake, F., Fujita, A., Sugata, K., Suga, S., Ohashi, M., Nishimura, N., Ozaki, T., Asano, Y., Yoshikawa, T., 2007. Direct detection of human herpesvirus 6 DNA in serum by the loop-mediated isothermal amplification method. J. Clin. Virol. 39 (1), 22–26. Iwata, S., Shibata, Y., Kawada, J., Hara, S., Nishiyama, Y., Morishima, T., Ihira, M., Yoshikawa, T., Asano, Y., Kimura, H., 2006. Rapid detection of Epstein–Barr virus DNA by loopmediated isothermal amplification method. J. Clin. Virol. 37 (2), 128–133. Klee, S.R., Tyczka, J., Ellerbrok, H., Franz, T., Linke, S., Baljer, G., Appel, B., 2006. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 6, 2–9. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289 (1), 150–154. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63. Pan, L., Zhang, L., Wang, G., Liu, Q., 2012. Rapid, simple, and sensitive detection of the ompB gene of spotted fever group rickettsiae by loop-mediated isothermal amplification. BMC Infect. Dis. 12, 254. http://dx.doi.org/10.1186/1471-2334-12-254. Pan, L., Zhang, L., Fan, D., Zhang, X., Liu, H., Lu, Q., Xu, Q., 2013. Rapid, simple and sensitive detection of Q fever by loop-mediated isothermal amplification of the htpAB gene. PLoS Negl. Trop. Dis. 7 (5), e2231. Panning, M., Kilwinski, J., Greiner-Fischer, S., Peters, M., Kramme, S., Frangoulidis, D., Meyer, H., Henning, K., Drosten, C., 2008. High throughput detection of Coxiella burnetii by real-time PCR with internal control system and automated DNA preparation. BMC Microbiol. 8, 77–84. Paris, D.H., Blacksell, S.D., Newton, P.N., Day, N.P., 2008. Simple, rapid and sensitive detection of Orientia tsutsugamushi by loo-isothermal DNA amplification. Trans. R. Soc. Trop. Med. Hyg. 102 (12), 1239–1246. Qiao, Y.M., Guo, Y.C., Zhang, X.E., Zhou, Y.F., Zhang, Z.P., Wei, H.P., Yang, R.F., Wang, D.B., 2007. Loop-mediated isothermal amplification for rapid detection of Bacillus anthracis spores. Biotechnol. Lett. 29 (12), 1939–1946. Rolain, J.M., Boulos, A., Mallet, M.N., Raoult, D., 2005. Correlation between ratio of serum doxycycline concentration to MIC and rapid decline of antibody levels during treatment of Q fever endocarditis. Antimicrob. Agents Chemother. 49 (7), 2673–2676. Schneeberger, P.M., Hermans, M.H., van Hannen, E.J., Schellekens, J.J., Leenders, A.C., Wever, P.C., 2010. Real-time PCR with serum samples is indispensable for early diagnosis of acute Q fever. Clin. Vaccine Immunol. 17 (2), 286–290. Tomita, N., Mori, Y., Kanda, H., Notomi, T., 2008. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 3 (5), 877–882. Turra, M., Chang, G., Whybrow, D., Higgins, G., Qiao, M., 2006. Diagnosis of acute Q fever by PCR on sera during a recent outbreak in rural South Australia. Ann. N. Y. Acad. Sci. 1078, 566–569. Wastling, S.L., Picozzi, K., Kakembo, A.S., Welburn, S.C., 2010. LAMP for human African trypanosomiasis: a comparative study of detection formats. PLoS Negl. Trop. Dis. 4 (11), e865.
