Letters in Applied Microbiology ISSN 0266-8254
ORIGINAL ARTICLE
Development of ISSR-derived SCAR marker-targeted PCR for identification of Aspergillus section Flavi members S.R. Priyanka, S.R. Uppalapati, J.J. Kingston, H.S. Murali and H.V. Batra Defence Food Research Laboratory, Siddarthnagar, Mysore, Karnataka, India
Significance and Impact of the Study: Identification of Aspergillus section Flavi members is important owing to their impact on human health and economy. The ISSR-based SCAR-PCR developed in this study is superior over the other existing Aspergillus section Flavi detection systems due to its simplicity and minimal requirement of sample handling. This PCR could be a supplementary strategy to time-consuming and rather ambiguous conventional polyphasic detection techniques and a reliable tool for highthroughput sample analysis.
Keywords Aspergillus section Flavi, ISSR, PCR, SCAR marker. Correspondence Harsh Vardhan Batra, Sc ‘H’, Director, Microbiology Division, Defence Food Research Laboratory, Siddarthanagar, Mysore, Karnataka 570011, India. E-mail: [email protected] 2013/2054: received 10 October 2013, revised 21 November 2013 and accepted 29 November 2013 doi:10.1111/lam.12207
Abstract Aspergillus section Flavi is a heterogeneous fungal cluster including some of the most economically important Aspergillus species. The section is comprised of toxigenic and nontoxigenic aspergilli that are phenotypically undistinguishable. The aim of this study was to develop a genetic marker specific to Aspergillus section Flavi on the whole. Based on inter–simple sequence repeat (ISSR) fingerprinting profiles of major Aspergillus section Flavi members, a sequencecharacterized amplified region (SCAR) marker was identified. Primers were designed in the conserved regions of the SCAR marker and were utilized in a PCR for concurrent identification of major members of the section. The detection level of the SCAR-PCR was found to be 01 ng purified DNA, and when applied to 45 naturally contaminated food samples, 28 samples were found infected with Aspergillus section Flavi members. The present SCAR-PCR is rapid and less cumbersome unlike conventional identification techniques.
Introduction Aspergillus is one of the most economically important genera encompassing more than 185 species with varied impact on health of humans, animals and plants (Yu et al. 2005). Majority of the species in the genus are saprophytic moulds utilizing organic debris to recycle nitrogen and carbon. This property has been widely utilized in fermented food and beverage industries, where Aspergillus species ferment complex starchy ingredients into simple sugars (Haines 1995; Machida et al. 2008). On the other hand, a few members of the genus are opportunistic pathogens capable of producing hepatotoxic and carcinogenic aflatoxins. Manifestations of aspergillosis, a major disease caused by pathogenic aspergilli, differ depending on the host immune system. In the immunocompetent individuals, aspergillosis is self-limiting disease with mild symptoms such as aspergilloma and allergic bronchopulmonary 414
aspergillosis. Conversely, in the immunocompromised patients, a dramatic increase in the severity of the disease is observed leading to invasive aspergillosis, a dangerous malady worldwide (Latge 1999). Aspergillus section Flavi (ASF) is a widely distributed heterogeneous group of fungi, which gained attention due to the industrial use and toxigenic potential of its members (Rodrigues et al. 2009). The section is comprised of at least six species that are categorized into two groups. One group includes food-contaminating aflatoxigenic species such as Aspergillus flavus, Aspergillus parasiticus and Aspergillus nomius. The other group consists of nonaflatoxigenic food spoilage saprophytes such as Aspergillus oryzae, Aspergillus sojae and Aspergillus tamarii (Godet and Munaut 2010). Majority of these species commonly inhabit soil, plants, foods and even air. Specific and differential identification of the members of this section is cumbersome due to huge morphological variations and
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
phylogenetic relationships between the isolates of same species and different species, respectively (Pitt and Hocking 2009; Samson and Varga 2009) . In addition, due to changes in environmental conditions such as temperature, humidity, substrate, different members of ASF may have remarkable phenotypic similarities among them and with other aspergilli (Pitt and Hocking 2009). The taxonomy of ASF is complex and is evolving with the frequent discovery of new species, currently, with more than 22 different species that can be grouped into seven clades (Varga et al. 2011). Conventional approaches for the identification of ASF are multivariate involving examination of macroscopic (colony diameter, colour and texture) and microscopic (size and texture of conidia and conidiophores structure) morphological characteristics of cultures grown on different media and extrolite profile analysis (Klich 2002; Rodrigues et al. 2009; Varga et al. 2011). Differentiation of toxigenic strains from nontoxigenic strains in ASF is important because of the economic and public health importance of the group (Nesci and Etcheverry 2002). PCR assays targeting genes encoding key enzymes in aflatoxin biosynthetic pathway viz., aflR, nor1 genes in normal, multiplex or real-time formats (Woloshuk et al. 1994; Godet and Munaut 2010; Rashmi et al. 2013) would partly suffice this necessity, but these assays can detect mycotoxigenic aspergilli, besides A. flavus, A. parasiticus and A. nomius (ASF members), such as Aspergillus fumigatus, Aspergillus niger, Aspergillus carbonarius (non-ASF members). This drawback can be overcome by utilizing a specific marker for ASF along with biosynthetic pathway genes in the PCR assay. On the other hand, nontoxigenic members in the section also stand important in terms of the industrial and food applications, and a method for specific identification of ASF on the whole is still lacking. Owing to ambiguity, time and cost involved in the traditional methods, simpler molecular detection techniques that are rapid, specific and reliable are needed. In this study, with an objective of developing an ASF-specific molecular marker, we attempted to identify an inter simple sequence repeat (ISSR) profile-based sequence-characterized amplified region (SCAR) marker from major species of ASF. We also developed a detection PCR using the primers designed for the SCAR sequence and validated the applicability of the SCAR-PCR in specific identification of ASF group members, concurrently. Results and discussion In the current study, firstly, genetic diversity of ASF members was assessed by ISSR fingerprinting technique. A total of 12 ISSR primers were analysed for their capability to produce polymorphic amplicons on a subset of 15
Aspergillus strains containing representative isolates from major species of ASF: A. flavus (6), A. parasiticus (3), A. nomius (1), A. oryzae (3), A. sojae (1) and A. tamarii (1). Only four primers ((AG)8C, (AG)8G, (GA)6CC and (GTG)5) were found to possess 100% typeability and resulted in robust and reproducible fingerprints for all the strains used in the study as analysed by agarose gel electrophoresis. Band profiles of the PCR amplicons had a lucid pattern of approximately 17 bands (AG)8C (Fig. 1a), 6–15 bands (AG)8G, 7–16 bands (GA)6CC and 5–12 bands (GTG)5 per isolate in average within a range of 100–1000 bp. Dendrograms constructed by UPGMA method based on banding pattern of all the four ISSR amplicons showed clear diversity among the strains used, but could not topologically differentiate between the distinct species (Fig. 1b). Although (GA)8C primer was found to be 100% typeable, it was excluded from the study, because the patterns had only 3–5 bands allowing insufficient discrimination. To determine the discriminatory power of the primers statistically, we estimated Simpson’s (SID) and Shannon’s (H) indices of diversity using Comparing Partitions online tool and primer (AG)8C was found to be highly polymorphic (Table 1). Although performed on a relatively smaller number of strains, the diversity generated by (AG)8C primer among the members of ASF supported two important previous observations. Firstly, strains of A. flavus and A. oryzae isolates were grouped into a single cluster at a percentage similarity of above 70%, which was in concordance with many earlier findings (Klich et al. 1995; Kumeda and Asao 1996; Geiser et al. 2000; Wang et al. 2001; Montiel et al. 2003; Chang and Ehrlich 2010). Secondly, similar to the observations of Yuan et al. (1995), Kumeda and Asao (2001), Rigo et al. (2002), Lee et al. (2006) and many others, in our study, A. tamarii and A. nomius were grouped separately as outliers. It was evident from our results that the phylogenetic diversity by ISSR with (AG)8C primer could be negotiable with the existing literature on molecular typing of ASF strains, and therefore, this technique might replace other cumbersome fingerprinting methods for high-throughput analysis. On overlapping the electropherograms of (AG)8C ISSR band profiles, a common band with almost uniform and highest density was observed at an RF distance of 055 corresponding to approximately 650 bp length in all the lanes. This band was excised from all the lanes, cloned separately into pTZ57R/T vector and sequenced following confirmation of the insert size by PCR with universal vector primers. All the sequences obtained were processed by NCBI Vecscreen (http://www.ncbi.nlm.nih.gov/tools/ vecscreen/ ) to remove the segments of the vector origin. Analysis of the resultant sequences by Basic Local Alignment Search Tool (BLAST) revealed 90–100% identity in
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
415
Aspergillus section Flavi detection
S.R. Priyanka et al.
(a) 0·4
0·3
0·2
0·1 AF1 AF10 AF3 AO2 AO3 AF2 AO1 AP1 AF7 AP3 AS1 AF9 AP2 AN1 AT1
849
379 149 10
33 58
27 59
92
215
278
326
(AG)8 C (b) 0·3
0·2
0·1
0·5 968
241 80 82 996 203 110 246
388
0·4
AO1 AN1 AO2 AP2 AF9 AF3 AF2 AP3 AF1 AF7 AF10 AP1 AS1 AT1 AO3
(GA)6CC
0·3
0·2
0·1
0·3
AN1 AT1 AP2 294 AF3 AP1 388 412 AF7 AF10 490 AF1 634 AS1 589 AO2 AP3 709 860 AO1 AF2 AO3 AF9 (AG)8G
0·2
0·1
654
392 545 997
617
630 539 394
AF9 AO2 AS1 AP3 AF1 AF2 AN1 AF7 AT1 AO3 AF10 AF3 AP2 AP1 AO1
(GTG)5
Figure 1 UPGMA dendrograms based on banding patterns of ISSR profiles of (AG)8C (a) and (AG)8G,(GA)6CC,(GTG)5 (b) for representative ASF members. The scale bar at the top (left) indicates the correlation coefficient.
Table 1 Simpson’s index of diversity (SID) with jackknife pseudo-values at confidence interval of 95% and entropy (H) of each typing method
Method
SID (# partitions)
Jackknife pseudo-values CI (95%)
H
(AG)8C (GA)6CC (AG)8G (GTG)5
0990 0914 0886 0752
0963–1000 0805–1000 0787–0984 0554–0951
3774 3057 274 2013
(14) (10) (8) (5)
A. flavus NRRL 3357 XM_002379510 and XM_002379509 loci and A. oryzae RIB40 XM_001821800 locus, which encode an unknown protein and a small region in diphthamide biosynthesis protein 1. The sequences of all the inserts (SCAR marker) were aligned by ClustalW2, and forward and reverse primers (SCAR-AFF and SCAR-AFR) were designed in the conserved region of the sequences. The SCAR-PCR using 416
the primer pair specifically detected all the strains from ASF group, and agarose gel electrophoresis confirmed the presence of amplicons at the expected molecular weight of approximately 610 bp (Fig. 2a). No spurious amplicons were observed with any other nonspecific fungal strains (Fig. 2b). The sensitivity of the SCAR-PCR was assessed by DNA dilution technique using DNA from A. flavus NCIM 1209, and the minimum detection level of the purified DNA was found to be 01 ng (Fig. 2c). The current PCR was also found to specifically amplify from DNA prepared by thermal lysis technique. DNA was extracted by thermal lysis method from two-day enrichment cultures of forty five natural samples, and when ‘this DNA was’ subjected to SCAR-PCR, twenty-eight samples (6 paddy, 8 ground nut, 10 maize and 4 chickpea) yielded positive amplification, indicating the presence of ASF members (Table 2). Conventional culturing technique using the sample enrichments isolated many fungi belonging to different genera
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
(a)
M ar k AF er 1 AF 2 AF AF3 3 AF 4 AF 5 AF 6 AF 7 AF 8 AF 9 AF 1 AF 0 11 AF 1 AO 2 1 AO AO2 3 AO 4 AP 1 AP 2 AP 3 AP 4 AS 1 AS 2 AT 1 AN 1
S.R. Priyanka et al.
PC M ar ke r
(b)
M ar k AF er 1 AO AP 1 1 AS 1 AT 1 AN i AF u AC AO c AG AF un AA w AC d AA s AC h AC 1 AF i AF s p AF oe AL u FG c FM
~650 bp
~650 bp
140 000
(c)
120 000
Raw volume
Figure 2 Specificity of SCAR-PCR. Gel electrophoresis of PCR amplicons obtained from SCAR-PCR with Aspergillus section Flavi strains (a) and other nonspecific fungal strains (b). (c). Sensitivity of SCAR-PCR. Dilutions of purified total DNA of Aspergillus flavus NCIM 1209 were analysed by SCAR-PCR. Amplicons were run in 12% agarose gel with ethidium bromide and documented, and the raw volume of fluorescent peaks was analysed by Genetools software and plotted.
100 000 80 000 60 000 40 000 20 000
including Cladosporium, Trichothecium, Aspergillus, Fusarium, Penicillium, Alternaria and Mycelia sterilia. All the samples found positive to SCAR-PCR yielded at least one ASF member except from paddy sample 8, which may be due to competitive inhibition of growth on PDA agar plate by interfering fungi. Many detection systems have been developed for the detection of members of ASF. McAlpin and Mannarelli (1995) discovered a repetitive DNA probe pAF28 for distinguishing A. flavus isolates. Shapira et al. (1996) identified that PCR targeting versicolorin A dehydrogenase gene (ver-1) could specifically detect A. flavus and A. parasiticus only. Kumeda and Asao (2001) developed a heteroduplex panel analysis utilizing fragments of the internal transcribed spacer regions of the rRNA gene for the identification of interspecific variations in ASF. Godet and Munaut (2010) developed a six-step strategy using a real-time PCR, RAPD, and Sma I digestion-based decision-making tree for simultaneous identification and differentiation at least nine members of ASF. Rodrigues et al. (2011) identified ASF isolates employing a novel approach based on spectral analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
0
100
10
1
0·1
0·01
0·001
DNA dilution (ng µl–1)
(MALDI-TOF ICMS). A comprehensive literature on majority of the detection techniques could be found in the mini-review by Abdin et al. (2010). Although very advantageous, these detection systems involve cumbersome procedures and technical skill to understand the data generated. The SCAR-PCR developed in the current study is superior over the other existing detection systems due to its sheer simplicity and ease of performance. In conclusion, the present PCR can rapidly and reliably identify major members of ASF and when coupled with aflatoxin biosynthetic pathway gene(s), can be utilized in routine food and clinical sample analysis. This PCR, although not a complete substitute for conventional polyphasic detection techniques, if used as a supplementary strategy, can ease the identification of Aspergillus section Flavi members with respect to time and cost. Materials and methods Standard strains and culture conditions All fungal strains used in the study are listed in Table 3. Standard fungal strains were obtained from culture
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
417
Aspergillus section Flavi detection
S.R. Priyanka et al.
Table 2 Application of SCAR-PCR assay to natural food samples. Two-day-old enriched food sample cultures were analysed by SCAR-PCR and subjected to conventional isolation Sample
Sample ID
SCAR-PCR
Conventional isolation
Paddy
P1 P2 P3 P4 P5 P6 P7 P8 P9 G1 G2 G3 G4 G5 G6 G7 G8 G9 G10 G11 G12 G13 M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M11 M12 M13 M14 C1 C2 C3 C4 C5 C6 C7 C8 C9
+ + +
A. flavus, Fusarium sp. A. flavus, A. nomius, Mycelia sterilia A. parasiticus, Cladosporium sp. Fusarium sp., Penicillium sp., Mycelia sterilia A. oryzae, A. nomius, A. sp., Fusarium sp. Penicillium sp., Trichoderma sp., Mycelia sterilia Claviceps sp., Mycelia sterilia Penicillium sp., Fusarium sp. Mycelia sterilia A. tamarii, Mycelia sterilia A. flavus, A. parasiticus Fusarium sp., Mycelia sterilia Trichoderma sp., A. ochraceous A. tamarii, A. nomius, A. niger A. flavus, Mycelia sterilia A. fumigatus, Penicillium sp. Claviceps sp. A. flavus, Alternaria sp., Cladosporium sp., Mycelia sterilia A. niger, Cladosporium sp. A. oryzae, Penicillium sp. A. flavus, A. oryzae A. nomius, Alternaria sp. A. parasiticus A. nomius A. flavus/A. parasiticus, Mycelia sterilia A. parasiticus, Cladosporium sp. A. flavus, A. nomius A. flavus, A. niger, Mycelia sterilia A. oryzae, Mycelia sterilia A. flavus, A. tamarii A. tamarii A. niger, Penicillium sp. A. niger, A. flavus Cladospirum sp., Trichoderma sp., Mycelia sterilia A. fumigatus, A. niger, Rhizopus sp. A. awamori, Penicillium sp. A. oryzae, A. niger, Penicillium sp., Mycelia sterilia Penicillium sp., Mycelia sterilia A. clavatus, Cladosporium sp., Mycelia sterilia A. flavus, A. oryzae, Mycelia sterilia A. flavus, A. tamarii, Mycelia sterilia Fusarium sp. Penicillium sp. A. flavus., Alternaria sp. Claviceps sp., Aspergillus niger A. oryzae, A. niger, Cladosporium sp.
Groundnut
Maize
Chickpea
+
+ + +
+ +
+ + + + + + + + + + + + + +
+
+ +
+ +
collection centres at MTCC (Microbial Type Culture Collection at IMTech, Chandigarh, India) and NCIM (National Collection of Industrial Micro-organisms at NCL, Pune, India). DFR strains were isolated at the Defence Food Research Laboratory, Mysore, from different food and environmental samples. Media and media components were procured from Himedia (Mumbai, India). 418
All the fungal cultures were maintained in potato dextrose agar or potato dextrose broth and incubated at 37°C. DNA extraction Sample preparation for DNA extraction was followed according to Rashmi et al. (2013) with additional
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
Table 3 List of fungal cultures used in the study S. No.
culture code
Strain name
Identifier
Source
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42
AF1 AF2 AF3 AF4 AF5 AF6 AF7 AF8 AF9 AF10 AF11 AF12 AP1 AP2 AP3 AP4 AO1 AO2 AO3 AO4 AS1 AS2 AN1 AT1 ANi Afu AC AOc AG AFun AAw ACd AAs ACh ACl AFis AFp AFoe ALuc FG FM PC
Aspergillus flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. oryzae A. oryzae A. oryzae A. oryzae A. sojae A. sojae A. nomius A. tamarii A. niger A. fumigatus A. carbonarius A. ochraceus A. gigantius A. funiculosus A. awamori A. candidus A. amstelodami A. chevalieri A. clavatus A. fischeri A. flavipes A. foetidus A. luchuensis Fusarium graminearum F. moniliforme Penicillium chrysogenum
NCIM 1209 DFRL AF01 DFRL AF12 DFRL AF13 DFRL AF15 DFRL AF16 DFRL AF18 DFRL AF19 DFRL AF24 DFRL AF28 DFRL AF30 DFRL AF31 NCIM 898 MTCC2796 MTCC2797 DFRL AP 2 NCIM 564 NCIM 640 NCIM 644 MTCC 634 NCIM 1198 MTCC 8779 MTCC 8651 MTCC 8841 MTCC 9687 MTCC 8636 MTCC 2199 MTCC 4893 NCIM 568 NCIM 1029 NCIM 885 NCIM 884 NCIM 1026 NCIM 940 NCIM 1007 NCIM 517 NCIM 1209 NCIM 1027 NCIM 991 MTCC 2089 MTCC 156 MTCC 6479
NCIM*, Pune DFRL†, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore NCIM, Pune MTCC‡, Chandigarh MTCC, Chandigarh DFRL, Mysore NCIM, Pune NCIM, Pune NCIM, Pune MTCC, Chandigarh NCIM, Pune MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh
*NCIM: National Collection Of Industrial Micro-organisms, Pune. †DFRL: Defence Food Research Laboratory, Mysore. ‡MTCC: Microbial Type Culture Collection, Chandigarh.
modifications. Briefly, 7-day-old fungal mycelia, harvested by filtration through Whatman filter paper No. 3, were frozen in liquid nitrogen and pulverized to a fine powder using a sterile pestle and mortar. The mycelial powder was stored at 20°C until further use. Total genomic DNA was isolated using DNeasy plant Minikit (Qiagen, Hilden, Germany) as per manufacturer’s instructions. DNA was eluted in nuclease-free water (Qiagen), and the concentration was estimated by NanoDrop ND-1000 spectrophotometer
(Thermo Scientific, Bengaluru, India). DNA was stored at 80°C until further use. DNA for immediate use was extracted by the thermal lysis method (Cenis 1992). Inter simple sequence repeat PCR analysis A total of 15 ISSR primers were custom-synthesized by Eurofins (Bangalore, India) according to the sequences retrieved from the database of University of British
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
419
Aspergillus section Flavi detection
S.R. Priyanka et al.
Columbia, Canada (Table S1). All the 15 ISSR primers were screened onto a set of 15 random fungal strains of ASF for their typeability and reproducibility of band patterns. PCRs were performed in a volume of 20 ll containing 50 ng genomic DNA, 2 ll 10X buffer, 140 lmol l 1 dNTPs, 3 mmol l 1 MgCl2, 20 pmol l 1 primers and 15 U Taq DNA polymerase (Sigma, Bengaluru, India). The amplifications were performed in Eppendorf Mastercycler gradient thermal cycler (Eppendorf, Hamburg, Germany) with reaction conditions of 94°C initial denaturation for 4 min and 35 cycles of 94°C for 30 s, annealing temperature varying between 40°C and 50°C for 1 min, extension temperature at 72°C for 2 min and a final extension at 72°C for 10 min. To ensure reproducibility and consistency of amplification, all PCRs were performed in triplicate. The amplified products were resolved on 12% agarose gel in 1X TBE buffer at 70 V at room temperature. Gels were stained with ethidium bromide, visualized under UV light and documented using a gel documentation system (G-box, Syngene, Bangalore, India). Agarose gel analysis and dendrogram construction The documented gel photographs were appended with each other and imported to GENESYS image acquisition software as inverted 8-bit grey-scale TIF images. Each image was processed for the spectral analysis to determine the band density using rolling disc background subtraction. ISSR profiles/bands were scored manually for each individual lane from the gel photograph and electropherograms were generated. The unambiguously scored bands were recorded to binary data with the presence of band as ‘1’ or absence as ‘0’. Matrix of binary data was constructed with rows equal to accessions and columns equal to distinct bands. Dendrograms were constructed by unweighted pair group method with arithmetic mean (UPGMA) using TREECONW software (Van de Peer and De Wachter 1994). Band-based diversity indices Diversity indices measure the discriminatory ability of typing systems. In the current study, based on dendrograms constructed, we calculated Simpson’s (SID) and Shannon’s indices (H or entropy) using comparing partitions online tool (http://darwin.phyloviz.net/ComparingPartitions/index.php? link=Tool). Confidence intervals (CIs) of Simpson’s index were also measured to improve the unbiased assessment of the discriminatory power of typing techniques. Sequence-characterized amplified region marker Electropherograms generated by GeneSys image acquisition software from band profiles of (AG)8C ISSR were 420
overlapped onto each other (Figure S1). Putative marker that was found common in all the lanes was excised from agarose gel with sterile gel slicer and purified using GenElute Gel Extraction kit (Sigma). Purified amplicons were ligated into a pTZ57RT vector using InsTAclone PCR Cloning Kit (Thermo Scientific) following the supplier’s instructions. The ligated vector was transformed into competent Escherichia coli DH5a strain (Sambrook et al. 1989) and plated onto LB-ampicillin agar. Distinct colonies were confirmed to possess the insert by colony PCR, and recombinant plasmids from positive clones were isolated using GenElute Plasmid extraction kit (Sigma). Sequencing of the insert was performed at Eurofins Genomics pvt. Ltd., Bengaluru, India. Primer design and SCAR-PCR conditions The obtained SCAR sequences were aligned by CLUSTALW, and the resultant alignment file was searched for conserved region in Jalview applet. A pair of SCAR primers (SCAR-AFF: 5′ATGACTAGCGACAGCGGGTC 3′ and SCARAFR: 5′GAGAGAGCTGGGATACTGCC 3′) was designed for the most conserved region among all the sequences (Data S1). The primers used in the study were custom-synthesized by Eurofins. SCAR-PCR was optimized in 20-ll reaction mixture containing 50 ng of DNA, 2 ll of 10 9 PCR buffer, 15 mmol l 1 MgCl2, 100 lmol l 1 dNTPs mixture, 5 pmol l 1 each primer and 1 U of Taq polymerase. The PCR amplification included an initial denaturation step at 94°C for 4 min, followed by 35 cycles of 94°C for 1 min, 56°C for 1 min and 72°C for 1 min followed by a final extension at 72°C for 5 min. The amplification products were resolved on 12% agarose gel stained with ethidium bromide. Specificity and Sensitivity The cross-reactivity (specificity) of the SCAR primers was analysed by performing the optimized PCR on the different fungal species listed in Table 3. Sensitivity was estimated using different DNA dilutions from the DNA extracted from A. flavus NCIM 1209. SCAR-PCR with naturally contaminated food samples A total of forty-five natural samples (paddy (9), groundnut (13), maize (14) and chickpea (9)) were collected from various retail markets in Mysore. These samples were surface-disinfected by washing them sequentially with 70% ethanol, 2% sodium hypochlorite and sterile distilled water. The surface-sterilized samples were ground and inoculated into 50 ml PDB and incubated for 2 days at 25°C. Two millilitres of culture supernatant was
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
centrifuged at 10 000 9 g for 5 min, and the pellet obtained was resuspended in 100 ll distilled water and further subjected to DNA isolation by the thermal lysis method. For analysis, 1 ll of each sample was included in PCR assay. In parallel, fungal species were isolated from the infected maize, groundnut, paddy and chick pea samples. Isolations were made by placing the surface-sterilized infected grains on to potato dextrose agar plates. The plates were incubated at 28°C for 5–7 days. Each of the grown fungi was subcultured onto a fresh PDA slant in a 15-ml slant bottle to obtain a pure culture. Each pure culture was characterized and identified on the basis of their morphological and microscopic characteristics using the key of Pitt and Hocking (2009) , and single spore cultures were lyophilized and maintained at DFRL repository. Acknowledgements We thank Dr. Ramana MV for his assistance in fungal isolation. Conflict of interest The authors declare no conflict of interest. References Abdin, M.Z., Malik, M. and Javed, A.S. (2010) Advances in molecular detection of Aspergillus: an update. Arch Microbiol 192, 409–425. Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res 20, 2380. Chang, P.K. and Ehrlich, K.C. (2010) What does genetic diversity of Aspergillus flavus tell us about Aspergillus oryzae? Int J Food Microbiol 138, 189–199. Geiser, D.M., Dorner, J.W., Horn, B.W. and Taylor, J.W. (2000) The phylogenetics of mycotoxin and sclerotium production in Aspergillus flavus and Aspergillus oryzae. Fungal Genet Biol 31, 169–179. Godet, M. and Munaut, F. (2010) Molecular strategy for identification in Aspergillus section Flavi. FEMS Microbiol Lett 304, 157–168. Haines, J. (1995) Aspergillus in compost: straw man or fatal flaw. Biocycle 6, 32–35. Klich, M.A. (2002) Identification of Common Aspergillus Species. Utrecht, the Netherlands: Centra albureau voor Schimmelcultures. 116 p. Klich, M.A., Yu, J., Chang, P.K., Mullaney, E.J., Bhatnagar, D. and Cleveland, T.E. (1995) Hybridization of genes involved in aflatoxin biosynthesis to DNA of aflatoxigenic and non aflatoxigenic aspergilli. Appl Microbiol Biotechnol 44, 439–443. Kumeda, Y. and Asao, T. (1996) Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA
internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl Environ Microbiol 62, 2947– 2952. Kumeda, Y. and Asao, T. (2001) Heteroduplex panel analysis a novel method for genetic identification of Aspergillus section Flavi strains. Appl Environ Microbiol 67, 4084– 4090. Latge, J.P. (1999) Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev 12, 310–350. Lee, C.Z., Liou, G.Y. and Yuan, G.F. (2006) Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152, 161–170. Machida, M., Yamada, O. and Gomi, K. (2008) Genomics of Aspergillus oryzae: learning from the history of koji mold and exploration of its future. DNA Res 15, 173–183. McAlpin, C.E. and Mannarelli, B. (1995) Construction and characterization of a DNA probe for distinguishing strains of Aspergillus flavus. Appl Environ Microbiol 61, 1068–1072. Montiel, D., Dickinson, M.J., Lee, H.A., Dyer, P.S., Jeenes, D.J., Roberts, I.N., James, S., Fuller, L.J. et al. (2003) Genetic differentiation of the Aspergillus section Flavi complex using AFLP fingerprintings. Mycol Res 107, 1427– 1434. Nesci, A. and Etcheverry, M. (2002) Aspergillus section Flavi populations from field maize in Argentina. Lett Appl Microbiol 34, 343–348. Pitt, J.I. and Hocking, A.D. (2009) Fungi and Food Spoilage, 3rd edn. London: Springer. Rashmi, R., Ramana, M.V., Shylaja, R., Uppalapati, S.R., Murali, H.S. and Batra, H.V. (2013) Evaluation of a multiplex PCR assay for concurrent detection of four major mycotoxigenic fungi from foods. J Appl Microbiol 114, 819–827. Rigo, K., Varga, J., Toth, B., Teren, J., Mesterhazy, A. and Kozakiewicz, Z. (2002) Evolutionary relationships within Aspergillus section Flavi based on sequences of the intergenic transcribed spacer regions and the 5.8S rRNA gene. J Gen Appl Microbiol 48, 9–16. Rodrigues, P., Venancio, A., Kozakiewicz, Z. and Lima, N. (2009) A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi. Int J Food Microbiol 129, 187–193. Rodrigues, P., Santos, C., Venancio, A. and Lima, N. (2011) Species identification of Aspergillus section Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and molecular approaches. J Appl Microbiol 111, 877–892. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) MolecularCloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Samson, R.A. and Varga, J. (2009) What is a species in Aspergillus? Med Mycol 47, S13–S20. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A. and Salomon, R. (1996) Detection of aflatoxigenic molds in grains by PCR. Appl Environ Microbiol 62, 3270–3273.
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
421
Aspergillus section Flavi detection
S.R. Priyanka et al.
Van de Peer, Y. and De Wachter, Y. (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10, 569–570. Varga, J., Frisvad, J.C. and Samson, R.A. (2011) Two new aflatoxin producing species, and an overview of Aspergillus section Flavi. Stud Mycol 69, 58–80. Wang, L., Yokoyama, K., Takahasi, H., Kase, N., Hanya, Y., Yashiro, K., Miyaji, M. and Nishimura, K. (2001) Identification of species in Aspergillus section Flavi based on sequencing of the mitochondrial cytochrome b gene. Int J Food Microbiol 71, 75–86. Woloshuk, C.P., Foutz, K.R., Brewer, J.F., Bhatnagar, D., Cleveland, T.E. and Payne, G.A. (1994) Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Appl Environ Microbiol 60, 2408–2414. Yu, J., Cleveland, T., Nierman, W. and Bennett, J. (2005) Aspergillus flavus genomics: gateway to human and animal health, food safety, and crop resistance to diseases. Rev Iberoam Micol 22, 194–202. Yuan, G.F., Liu, C.S. and Chen, C.C. (1995) Differentiation of Aspergillus parasiticus from Aspergillus sojae by random
422
amplification of polymorphic DNA. Appl Environ Microbiol 61, 2384–2387.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1 List of ISSR primers used in the study. Figure S1 Overlay of the fifteen individual UV electropherograms of ISSR AG8C band patterns showing the conspicuous and conserved band (red arrow). Data S1 ClustalW multiple sequence alignment of SCAR sequences from 15 fungal cultures used in the study. The forward and reverse primer sequences are highlighted. A: Aspergillus flavus NCIM 1209; B: A. flavus DFR AF28; C: A. flavus DFR AF12; D: A. flavus DFR AF1; E: A. flavus DFR AF18; F: A. flavus DFR AF24; G: Aspergillus oryzae NCIM 640; H: A. oryzae NCIM 644; I: A. oryzae NCIM 564; J: Aspergillus parasiticus NCIM 898; K: A. parasiticus MTCC 2797; L: A. parasiticus MTCC 2796; M: Aspergillus sojae NCIM 1198; N: Aspergillus nomius MTCC 86519; O: Aspergillus tamarii MTCC 8841.
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
ORIGINAL ARTICLE
Development of ISSR-derived SCAR marker-targeted PCR for identification of Aspergillus section Flavi members S.R. Priyanka, S.R. Uppalapati, J.J. Kingston, H.S. Murali and H.V. Batra Defence Food Research Laboratory, Siddarthnagar, Mysore, Karnataka, India
Significance and Impact of the Study: Identification of Aspergillus section Flavi members is important owing to their impact on human health and economy. The ISSR-based SCAR-PCR developed in this study is superior over the other existing Aspergillus section Flavi detection systems due to its simplicity and minimal requirement of sample handling. This PCR could be a supplementary strategy to time-consuming and rather ambiguous conventional polyphasic detection techniques and a reliable tool for highthroughput sample analysis.
Keywords Aspergillus section Flavi, ISSR, PCR, SCAR marker. Correspondence Harsh Vardhan Batra, Sc ‘H’, Director, Microbiology Division, Defence Food Research Laboratory, Siddarthanagar, Mysore, Karnataka 570011, India. E-mail: [email protected] 2013/2054: received 10 October 2013, revised 21 November 2013 and accepted 29 November 2013 doi:10.1111/lam.12207
Abstract Aspergillus section Flavi is a heterogeneous fungal cluster including some of the most economically important Aspergillus species. The section is comprised of toxigenic and nontoxigenic aspergilli that are phenotypically undistinguishable. The aim of this study was to develop a genetic marker specific to Aspergillus section Flavi on the whole. Based on inter–simple sequence repeat (ISSR) fingerprinting profiles of major Aspergillus section Flavi members, a sequencecharacterized amplified region (SCAR) marker was identified. Primers were designed in the conserved regions of the SCAR marker and were utilized in a PCR for concurrent identification of major members of the section. The detection level of the SCAR-PCR was found to be 01 ng purified DNA, and when applied to 45 naturally contaminated food samples, 28 samples were found infected with Aspergillus section Flavi members. The present SCAR-PCR is rapid and less cumbersome unlike conventional identification techniques.
Introduction Aspergillus is one of the most economically important genera encompassing more than 185 species with varied impact on health of humans, animals and plants (Yu et al. 2005). Majority of the species in the genus are saprophytic moulds utilizing organic debris to recycle nitrogen and carbon. This property has been widely utilized in fermented food and beverage industries, where Aspergillus species ferment complex starchy ingredients into simple sugars (Haines 1995; Machida et al. 2008). On the other hand, a few members of the genus are opportunistic pathogens capable of producing hepatotoxic and carcinogenic aflatoxins. Manifestations of aspergillosis, a major disease caused by pathogenic aspergilli, differ depending on the host immune system. In the immunocompetent individuals, aspergillosis is self-limiting disease with mild symptoms such as aspergilloma and allergic bronchopulmonary 414
aspergillosis. Conversely, in the immunocompromised patients, a dramatic increase in the severity of the disease is observed leading to invasive aspergillosis, a dangerous malady worldwide (Latge 1999). Aspergillus section Flavi (ASF) is a widely distributed heterogeneous group of fungi, which gained attention due to the industrial use and toxigenic potential of its members (Rodrigues et al. 2009). The section is comprised of at least six species that are categorized into two groups. One group includes food-contaminating aflatoxigenic species such as Aspergillus flavus, Aspergillus parasiticus and Aspergillus nomius. The other group consists of nonaflatoxigenic food spoilage saprophytes such as Aspergillus oryzae, Aspergillus sojae and Aspergillus tamarii (Godet and Munaut 2010). Majority of these species commonly inhabit soil, plants, foods and even air. Specific and differential identification of the members of this section is cumbersome due to huge morphological variations and
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
phylogenetic relationships between the isolates of same species and different species, respectively (Pitt and Hocking 2009; Samson and Varga 2009) . In addition, due to changes in environmental conditions such as temperature, humidity, substrate, different members of ASF may have remarkable phenotypic similarities among them and with other aspergilli (Pitt and Hocking 2009). The taxonomy of ASF is complex and is evolving with the frequent discovery of new species, currently, with more than 22 different species that can be grouped into seven clades (Varga et al. 2011). Conventional approaches for the identification of ASF are multivariate involving examination of macroscopic (colony diameter, colour and texture) and microscopic (size and texture of conidia and conidiophores structure) morphological characteristics of cultures grown on different media and extrolite profile analysis (Klich 2002; Rodrigues et al. 2009; Varga et al. 2011). Differentiation of toxigenic strains from nontoxigenic strains in ASF is important because of the economic and public health importance of the group (Nesci and Etcheverry 2002). PCR assays targeting genes encoding key enzymes in aflatoxin biosynthetic pathway viz., aflR, nor1 genes in normal, multiplex or real-time formats (Woloshuk et al. 1994; Godet and Munaut 2010; Rashmi et al. 2013) would partly suffice this necessity, but these assays can detect mycotoxigenic aspergilli, besides A. flavus, A. parasiticus and A. nomius (ASF members), such as Aspergillus fumigatus, Aspergillus niger, Aspergillus carbonarius (non-ASF members). This drawback can be overcome by utilizing a specific marker for ASF along with biosynthetic pathway genes in the PCR assay. On the other hand, nontoxigenic members in the section also stand important in terms of the industrial and food applications, and a method for specific identification of ASF on the whole is still lacking. Owing to ambiguity, time and cost involved in the traditional methods, simpler molecular detection techniques that are rapid, specific and reliable are needed. In this study, with an objective of developing an ASF-specific molecular marker, we attempted to identify an inter simple sequence repeat (ISSR) profile-based sequence-characterized amplified region (SCAR) marker from major species of ASF. We also developed a detection PCR using the primers designed for the SCAR sequence and validated the applicability of the SCAR-PCR in specific identification of ASF group members, concurrently. Results and discussion In the current study, firstly, genetic diversity of ASF members was assessed by ISSR fingerprinting technique. A total of 12 ISSR primers were analysed for their capability to produce polymorphic amplicons on a subset of 15
Aspergillus strains containing representative isolates from major species of ASF: A. flavus (6), A. parasiticus (3), A. nomius (1), A. oryzae (3), A. sojae (1) and A. tamarii (1). Only four primers ((AG)8C, (AG)8G, (GA)6CC and (GTG)5) were found to possess 100% typeability and resulted in robust and reproducible fingerprints for all the strains used in the study as analysed by agarose gel electrophoresis. Band profiles of the PCR amplicons had a lucid pattern of approximately 17 bands (AG)8C (Fig. 1a), 6–15 bands (AG)8G, 7–16 bands (GA)6CC and 5–12 bands (GTG)5 per isolate in average within a range of 100–1000 bp. Dendrograms constructed by UPGMA method based on banding pattern of all the four ISSR amplicons showed clear diversity among the strains used, but could not topologically differentiate between the distinct species (Fig. 1b). Although (GA)8C primer was found to be 100% typeable, it was excluded from the study, because the patterns had only 3–5 bands allowing insufficient discrimination. To determine the discriminatory power of the primers statistically, we estimated Simpson’s (SID) and Shannon’s (H) indices of diversity using Comparing Partitions online tool and primer (AG)8C was found to be highly polymorphic (Table 1). Although performed on a relatively smaller number of strains, the diversity generated by (AG)8C primer among the members of ASF supported two important previous observations. Firstly, strains of A. flavus and A. oryzae isolates were grouped into a single cluster at a percentage similarity of above 70%, which was in concordance with many earlier findings (Klich et al. 1995; Kumeda and Asao 1996; Geiser et al. 2000; Wang et al. 2001; Montiel et al. 2003; Chang and Ehrlich 2010). Secondly, similar to the observations of Yuan et al. (1995), Kumeda and Asao (2001), Rigo et al. (2002), Lee et al. (2006) and many others, in our study, A. tamarii and A. nomius were grouped separately as outliers. It was evident from our results that the phylogenetic diversity by ISSR with (AG)8C primer could be negotiable with the existing literature on molecular typing of ASF strains, and therefore, this technique might replace other cumbersome fingerprinting methods for high-throughput analysis. On overlapping the electropherograms of (AG)8C ISSR band profiles, a common band with almost uniform and highest density was observed at an RF distance of 055 corresponding to approximately 650 bp length in all the lanes. This band was excised from all the lanes, cloned separately into pTZ57R/T vector and sequenced following confirmation of the insert size by PCR with universal vector primers. All the sequences obtained were processed by NCBI Vecscreen (http://www.ncbi.nlm.nih.gov/tools/ vecscreen/ ) to remove the segments of the vector origin. Analysis of the resultant sequences by Basic Local Alignment Search Tool (BLAST) revealed 90–100% identity in
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
415
Aspergillus section Flavi detection
S.R. Priyanka et al.
(a) 0·4
0·3
0·2
0·1 AF1 AF10 AF3 AO2 AO3 AF2 AO1 AP1 AF7 AP3 AS1 AF9 AP2 AN1 AT1
849
379 149 10
33 58
27 59
92
215
278
326
(AG)8 C (b) 0·3
0·2
0·1
0·5 968
241 80 82 996 203 110 246
388
0·4
AO1 AN1 AO2 AP2 AF9 AF3 AF2 AP3 AF1 AF7 AF10 AP1 AS1 AT1 AO3
(GA)6CC
0·3
0·2
0·1
0·3
AN1 AT1 AP2 294 AF3 AP1 388 412 AF7 AF10 490 AF1 634 AS1 589 AO2 AP3 709 860 AO1 AF2 AO3 AF9 (AG)8G
0·2
0·1
654
392 545 997
617
630 539 394
AF9 AO2 AS1 AP3 AF1 AF2 AN1 AF7 AT1 AO3 AF10 AF3 AP2 AP1 AO1
(GTG)5
Figure 1 UPGMA dendrograms based on banding patterns of ISSR profiles of (AG)8C (a) and (AG)8G,(GA)6CC,(GTG)5 (b) for representative ASF members. The scale bar at the top (left) indicates the correlation coefficient.
Table 1 Simpson’s index of diversity (SID) with jackknife pseudo-values at confidence interval of 95% and entropy (H) of each typing method
Method
SID (# partitions)
Jackknife pseudo-values CI (95%)
H
(AG)8C (GA)6CC (AG)8G (GTG)5
0990 0914 0886 0752
0963–1000 0805–1000 0787–0984 0554–0951
3774 3057 274 2013
(14) (10) (8) (5)
A. flavus NRRL 3357 XM_002379510 and XM_002379509 loci and A. oryzae RIB40 XM_001821800 locus, which encode an unknown protein and a small region in diphthamide biosynthesis protein 1. The sequences of all the inserts (SCAR marker) were aligned by ClustalW2, and forward and reverse primers (SCAR-AFF and SCAR-AFR) were designed in the conserved region of the sequences. The SCAR-PCR using 416
the primer pair specifically detected all the strains from ASF group, and agarose gel electrophoresis confirmed the presence of amplicons at the expected molecular weight of approximately 610 bp (Fig. 2a). No spurious amplicons were observed with any other nonspecific fungal strains (Fig. 2b). The sensitivity of the SCAR-PCR was assessed by DNA dilution technique using DNA from A. flavus NCIM 1209, and the minimum detection level of the purified DNA was found to be 01 ng (Fig. 2c). The current PCR was also found to specifically amplify from DNA prepared by thermal lysis technique. DNA was extracted by thermal lysis method from two-day enrichment cultures of forty five natural samples, and when ‘this DNA was’ subjected to SCAR-PCR, twenty-eight samples (6 paddy, 8 ground nut, 10 maize and 4 chickpea) yielded positive amplification, indicating the presence of ASF members (Table 2). Conventional culturing technique using the sample enrichments isolated many fungi belonging to different genera
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
(a)
M ar k AF er 1 AF 2 AF AF3 3 AF 4 AF 5 AF 6 AF 7 AF 8 AF 9 AF 1 AF 0 11 AF 1 AO 2 1 AO AO2 3 AO 4 AP 1 AP 2 AP 3 AP 4 AS 1 AS 2 AT 1 AN 1
S.R. Priyanka et al.
PC M ar ke r
(b)
M ar k AF er 1 AO AP 1 1 AS 1 AT 1 AN i AF u AC AO c AG AF un AA w AC d AA s AC h AC 1 AF i AF s p AF oe AL u FG c FM
~650 bp
~650 bp
140 000
(c)
120 000
Raw volume
Figure 2 Specificity of SCAR-PCR. Gel electrophoresis of PCR amplicons obtained from SCAR-PCR with Aspergillus section Flavi strains (a) and other nonspecific fungal strains (b). (c). Sensitivity of SCAR-PCR. Dilutions of purified total DNA of Aspergillus flavus NCIM 1209 were analysed by SCAR-PCR. Amplicons were run in 12% agarose gel with ethidium bromide and documented, and the raw volume of fluorescent peaks was analysed by Genetools software and plotted.
100 000 80 000 60 000 40 000 20 000
including Cladosporium, Trichothecium, Aspergillus, Fusarium, Penicillium, Alternaria and Mycelia sterilia. All the samples found positive to SCAR-PCR yielded at least one ASF member except from paddy sample 8, which may be due to competitive inhibition of growth on PDA agar plate by interfering fungi. Many detection systems have been developed for the detection of members of ASF. McAlpin and Mannarelli (1995) discovered a repetitive DNA probe pAF28 for distinguishing A. flavus isolates. Shapira et al. (1996) identified that PCR targeting versicolorin A dehydrogenase gene (ver-1) could specifically detect A. flavus and A. parasiticus only. Kumeda and Asao (2001) developed a heteroduplex panel analysis utilizing fragments of the internal transcribed spacer regions of the rRNA gene for the identification of interspecific variations in ASF. Godet and Munaut (2010) developed a six-step strategy using a real-time PCR, RAPD, and Sma I digestion-based decision-making tree for simultaneous identification and differentiation at least nine members of ASF. Rodrigues et al. (2011) identified ASF isolates employing a novel approach based on spectral analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
0
100
10
1
0·1
0·01
0·001
DNA dilution (ng µl–1)
(MALDI-TOF ICMS). A comprehensive literature on majority of the detection techniques could be found in the mini-review by Abdin et al. (2010). Although very advantageous, these detection systems involve cumbersome procedures and technical skill to understand the data generated. The SCAR-PCR developed in the current study is superior over the other existing detection systems due to its sheer simplicity and ease of performance. In conclusion, the present PCR can rapidly and reliably identify major members of ASF and when coupled with aflatoxin biosynthetic pathway gene(s), can be utilized in routine food and clinical sample analysis. This PCR, although not a complete substitute for conventional polyphasic detection techniques, if used as a supplementary strategy, can ease the identification of Aspergillus section Flavi members with respect to time and cost. Materials and methods Standard strains and culture conditions All fungal strains used in the study are listed in Table 3. Standard fungal strains were obtained from culture
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
417
Aspergillus section Flavi detection
S.R. Priyanka et al.
Table 2 Application of SCAR-PCR assay to natural food samples. Two-day-old enriched food sample cultures were analysed by SCAR-PCR and subjected to conventional isolation Sample
Sample ID
SCAR-PCR
Conventional isolation
Paddy
P1 P2 P3 P4 P5 P6 P7 P8 P9 G1 G2 G3 G4 G5 G6 G7 G8 G9 G10 G11 G12 G13 M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M11 M12 M13 M14 C1 C2 C3 C4 C5 C6 C7 C8 C9
+ + +
A. flavus, Fusarium sp. A. flavus, A. nomius, Mycelia sterilia A. parasiticus, Cladosporium sp. Fusarium sp., Penicillium sp., Mycelia sterilia A. oryzae, A. nomius, A. sp., Fusarium sp. Penicillium sp., Trichoderma sp., Mycelia sterilia Claviceps sp., Mycelia sterilia Penicillium sp., Fusarium sp. Mycelia sterilia A. tamarii, Mycelia sterilia A. flavus, A. parasiticus Fusarium sp., Mycelia sterilia Trichoderma sp., A. ochraceous A. tamarii, A. nomius, A. niger A. flavus, Mycelia sterilia A. fumigatus, Penicillium sp. Claviceps sp. A. flavus, Alternaria sp., Cladosporium sp., Mycelia sterilia A. niger, Cladosporium sp. A. oryzae, Penicillium sp. A. flavus, A. oryzae A. nomius, Alternaria sp. A. parasiticus A. nomius A. flavus/A. parasiticus, Mycelia sterilia A. parasiticus, Cladosporium sp. A. flavus, A. nomius A. flavus, A. niger, Mycelia sterilia A. oryzae, Mycelia sterilia A. flavus, A. tamarii A. tamarii A. niger, Penicillium sp. A. niger, A. flavus Cladospirum sp., Trichoderma sp., Mycelia sterilia A. fumigatus, A. niger, Rhizopus sp. A. awamori, Penicillium sp. A. oryzae, A. niger, Penicillium sp., Mycelia sterilia Penicillium sp., Mycelia sterilia A. clavatus, Cladosporium sp., Mycelia sterilia A. flavus, A. oryzae, Mycelia sterilia A. flavus, A. tamarii, Mycelia sterilia Fusarium sp. Penicillium sp. A. flavus., Alternaria sp. Claviceps sp., Aspergillus niger A. oryzae, A. niger, Cladosporium sp.
Groundnut
Maize
Chickpea
+
+ + +
+ +
+ + + + + + + + + + + + + +
+
+ +
+ +
collection centres at MTCC (Microbial Type Culture Collection at IMTech, Chandigarh, India) and NCIM (National Collection of Industrial Micro-organisms at NCL, Pune, India). DFR strains were isolated at the Defence Food Research Laboratory, Mysore, from different food and environmental samples. Media and media components were procured from Himedia (Mumbai, India). 418
All the fungal cultures were maintained in potato dextrose agar or potato dextrose broth and incubated at 37°C. DNA extraction Sample preparation for DNA extraction was followed according to Rashmi et al. (2013) with additional
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
Table 3 List of fungal cultures used in the study S. No.
culture code
Strain name
Identifier
Source
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42
AF1 AF2 AF3 AF4 AF5 AF6 AF7 AF8 AF9 AF10 AF11 AF12 AP1 AP2 AP3 AP4 AO1 AO2 AO3 AO4 AS1 AS2 AN1 AT1 ANi Afu AC AOc AG AFun AAw ACd AAs ACh ACl AFis AFp AFoe ALuc FG FM PC
Aspergillus flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. parasiticus A. parasiticus A. parasiticus A. parasiticus A. oryzae A. oryzae A. oryzae A. oryzae A. sojae A. sojae A. nomius A. tamarii A. niger A. fumigatus A. carbonarius A. ochraceus A. gigantius A. funiculosus A. awamori A. candidus A. amstelodami A. chevalieri A. clavatus A. fischeri A. flavipes A. foetidus A. luchuensis Fusarium graminearum F. moniliforme Penicillium chrysogenum
NCIM 1209 DFRL AF01 DFRL AF12 DFRL AF13 DFRL AF15 DFRL AF16 DFRL AF18 DFRL AF19 DFRL AF24 DFRL AF28 DFRL AF30 DFRL AF31 NCIM 898 MTCC2796 MTCC2797 DFRL AP 2 NCIM 564 NCIM 640 NCIM 644 MTCC 634 NCIM 1198 MTCC 8779 MTCC 8651 MTCC 8841 MTCC 9687 MTCC 8636 MTCC 2199 MTCC 4893 NCIM 568 NCIM 1029 NCIM 885 NCIM 884 NCIM 1026 NCIM 940 NCIM 1007 NCIM 517 NCIM 1209 NCIM 1027 NCIM 991 MTCC 2089 MTCC 156 MTCC 6479
NCIM*, Pune DFRL†, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore DFRL, Mysore NCIM, Pune MTCC‡, Chandigarh MTCC, Chandigarh DFRL, Mysore NCIM, Pune NCIM, Pune NCIM, Pune MTCC, Chandigarh NCIM, Pune MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune NCIM, Pune MTCC, Chandigarh MTCC, Chandigarh MTCC, Chandigarh
*NCIM: National Collection Of Industrial Micro-organisms, Pune. †DFRL: Defence Food Research Laboratory, Mysore. ‡MTCC: Microbial Type Culture Collection, Chandigarh.
modifications. Briefly, 7-day-old fungal mycelia, harvested by filtration through Whatman filter paper No. 3, were frozen in liquid nitrogen and pulverized to a fine powder using a sterile pestle and mortar. The mycelial powder was stored at 20°C until further use. Total genomic DNA was isolated using DNeasy plant Minikit (Qiagen, Hilden, Germany) as per manufacturer’s instructions. DNA was eluted in nuclease-free water (Qiagen), and the concentration was estimated by NanoDrop ND-1000 spectrophotometer
(Thermo Scientific, Bengaluru, India). DNA was stored at 80°C until further use. DNA for immediate use was extracted by the thermal lysis method (Cenis 1992). Inter simple sequence repeat PCR analysis A total of 15 ISSR primers were custom-synthesized by Eurofins (Bangalore, India) according to the sequences retrieved from the database of University of British
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
419
Aspergillus section Flavi detection
S.R. Priyanka et al.
Columbia, Canada (Table S1). All the 15 ISSR primers were screened onto a set of 15 random fungal strains of ASF for their typeability and reproducibility of band patterns. PCRs were performed in a volume of 20 ll containing 50 ng genomic DNA, 2 ll 10X buffer, 140 lmol l 1 dNTPs, 3 mmol l 1 MgCl2, 20 pmol l 1 primers and 15 U Taq DNA polymerase (Sigma, Bengaluru, India). The amplifications were performed in Eppendorf Mastercycler gradient thermal cycler (Eppendorf, Hamburg, Germany) with reaction conditions of 94°C initial denaturation for 4 min and 35 cycles of 94°C for 30 s, annealing temperature varying between 40°C and 50°C for 1 min, extension temperature at 72°C for 2 min and a final extension at 72°C for 10 min. To ensure reproducibility and consistency of amplification, all PCRs were performed in triplicate. The amplified products were resolved on 12% agarose gel in 1X TBE buffer at 70 V at room temperature. Gels were stained with ethidium bromide, visualized under UV light and documented using a gel documentation system (G-box, Syngene, Bangalore, India). Agarose gel analysis and dendrogram construction The documented gel photographs were appended with each other and imported to GENESYS image acquisition software as inverted 8-bit grey-scale TIF images. Each image was processed for the spectral analysis to determine the band density using rolling disc background subtraction. ISSR profiles/bands were scored manually for each individual lane from the gel photograph and electropherograms were generated. The unambiguously scored bands were recorded to binary data with the presence of band as ‘1’ or absence as ‘0’. Matrix of binary data was constructed with rows equal to accessions and columns equal to distinct bands. Dendrograms were constructed by unweighted pair group method with arithmetic mean (UPGMA) using TREECONW software (Van de Peer and De Wachter 1994). Band-based diversity indices Diversity indices measure the discriminatory ability of typing systems. In the current study, based on dendrograms constructed, we calculated Simpson’s (SID) and Shannon’s indices (H or entropy) using comparing partitions online tool (http://darwin.phyloviz.net/ComparingPartitions/index.php? link=Tool). Confidence intervals (CIs) of Simpson’s index were also measured to improve the unbiased assessment of the discriminatory power of typing techniques. Sequence-characterized amplified region marker Electropherograms generated by GeneSys image acquisition software from band profiles of (AG)8C ISSR were 420
overlapped onto each other (Figure S1). Putative marker that was found common in all the lanes was excised from agarose gel with sterile gel slicer and purified using GenElute Gel Extraction kit (Sigma). Purified amplicons were ligated into a pTZ57RT vector using InsTAclone PCR Cloning Kit (Thermo Scientific) following the supplier’s instructions. The ligated vector was transformed into competent Escherichia coli DH5a strain (Sambrook et al. 1989) and plated onto LB-ampicillin agar. Distinct colonies were confirmed to possess the insert by colony PCR, and recombinant plasmids from positive clones were isolated using GenElute Plasmid extraction kit (Sigma). Sequencing of the insert was performed at Eurofins Genomics pvt. Ltd., Bengaluru, India. Primer design and SCAR-PCR conditions The obtained SCAR sequences were aligned by CLUSTALW, and the resultant alignment file was searched for conserved region in Jalview applet. A pair of SCAR primers (SCAR-AFF: 5′ATGACTAGCGACAGCGGGTC 3′ and SCARAFR: 5′GAGAGAGCTGGGATACTGCC 3′) was designed for the most conserved region among all the sequences (Data S1). The primers used in the study were custom-synthesized by Eurofins. SCAR-PCR was optimized in 20-ll reaction mixture containing 50 ng of DNA, 2 ll of 10 9 PCR buffer, 15 mmol l 1 MgCl2, 100 lmol l 1 dNTPs mixture, 5 pmol l 1 each primer and 1 U of Taq polymerase. The PCR amplification included an initial denaturation step at 94°C for 4 min, followed by 35 cycles of 94°C for 1 min, 56°C for 1 min and 72°C for 1 min followed by a final extension at 72°C for 5 min. The amplification products were resolved on 12% agarose gel stained with ethidium bromide. Specificity and Sensitivity The cross-reactivity (specificity) of the SCAR primers was analysed by performing the optimized PCR on the different fungal species listed in Table 3. Sensitivity was estimated using different DNA dilutions from the DNA extracted from A. flavus NCIM 1209. SCAR-PCR with naturally contaminated food samples A total of forty-five natural samples (paddy (9), groundnut (13), maize (14) and chickpea (9)) were collected from various retail markets in Mysore. These samples were surface-disinfected by washing them sequentially with 70% ethanol, 2% sodium hypochlorite and sterile distilled water. The surface-sterilized samples were ground and inoculated into 50 ml PDB and incubated for 2 days at 25°C. Two millilitres of culture supernatant was
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
Aspergillus section Flavi detection
S.R. Priyanka et al.
centrifuged at 10 000 9 g for 5 min, and the pellet obtained was resuspended in 100 ll distilled water and further subjected to DNA isolation by the thermal lysis method. For analysis, 1 ll of each sample was included in PCR assay. In parallel, fungal species were isolated from the infected maize, groundnut, paddy and chick pea samples. Isolations were made by placing the surface-sterilized infected grains on to potato dextrose agar plates. The plates were incubated at 28°C for 5–7 days. Each of the grown fungi was subcultured onto a fresh PDA slant in a 15-ml slant bottle to obtain a pure culture. Each pure culture was characterized and identified on the basis of their morphological and microscopic characteristics using the key of Pitt and Hocking (2009) , and single spore cultures were lyophilized and maintained at DFRL repository. Acknowledgements We thank Dr. Ramana MV for his assistance in fungal isolation. Conflict of interest The authors declare no conflict of interest. References Abdin, M.Z., Malik, M. and Javed, A.S. (2010) Advances in molecular detection of Aspergillus: an update. Arch Microbiol 192, 409–425. Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res 20, 2380. Chang, P.K. and Ehrlich, K.C. (2010) What does genetic diversity of Aspergillus flavus tell us about Aspergillus oryzae? Int J Food Microbiol 138, 189–199. Geiser, D.M., Dorner, J.W., Horn, B.W. and Taylor, J.W. (2000) The phylogenetics of mycotoxin and sclerotium production in Aspergillus flavus and Aspergillus oryzae. Fungal Genet Biol 31, 169–179. Godet, M. and Munaut, F. (2010) Molecular strategy for identification in Aspergillus section Flavi. FEMS Microbiol Lett 304, 157–168. Haines, J. (1995) Aspergillus in compost: straw man or fatal flaw. Biocycle 6, 32–35. Klich, M.A. (2002) Identification of Common Aspergillus Species. Utrecht, the Netherlands: Centra albureau voor Schimmelcultures. 116 p. Klich, M.A., Yu, J., Chang, P.K., Mullaney, E.J., Bhatnagar, D. and Cleveland, T.E. (1995) Hybridization of genes involved in aflatoxin biosynthesis to DNA of aflatoxigenic and non aflatoxigenic aspergilli. Appl Microbiol Biotechnol 44, 439–443. Kumeda, Y. and Asao, T. (1996) Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA
internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl Environ Microbiol 62, 2947– 2952. Kumeda, Y. and Asao, T. (2001) Heteroduplex panel analysis a novel method for genetic identification of Aspergillus section Flavi strains. Appl Environ Microbiol 67, 4084– 4090. Latge, J.P. (1999) Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev 12, 310–350. Lee, C.Z., Liou, G.Y. and Yuan, G.F. (2006) Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152, 161–170. Machida, M., Yamada, O. and Gomi, K. (2008) Genomics of Aspergillus oryzae: learning from the history of koji mold and exploration of its future. DNA Res 15, 173–183. McAlpin, C.E. and Mannarelli, B. (1995) Construction and characterization of a DNA probe for distinguishing strains of Aspergillus flavus. Appl Environ Microbiol 61, 1068–1072. Montiel, D., Dickinson, M.J., Lee, H.A., Dyer, P.S., Jeenes, D.J., Roberts, I.N., James, S., Fuller, L.J. et al. (2003) Genetic differentiation of the Aspergillus section Flavi complex using AFLP fingerprintings. Mycol Res 107, 1427– 1434. Nesci, A. and Etcheverry, M. (2002) Aspergillus section Flavi populations from field maize in Argentina. Lett Appl Microbiol 34, 343–348. Pitt, J.I. and Hocking, A.D. (2009) Fungi and Food Spoilage, 3rd edn. London: Springer. Rashmi, R., Ramana, M.V., Shylaja, R., Uppalapati, S.R., Murali, H.S. and Batra, H.V. (2013) Evaluation of a multiplex PCR assay for concurrent detection of four major mycotoxigenic fungi from foods. J Appl Microbiol 114, 819–827. Rigo, K., Varga, J., Toth, B., Teren, J., Mesterhazy, A. and Kozakiewicz, Z. (2002) Evolutionary relationships within Aspergillus section Flavi based on sequences of the intergenic transcribed spacer regions and the 5.8S rRNA gene. J Gen Appl Microbiol 48, 9–16. Rodrigues, P., Venancio, A., Kozakiewicz, Z. and Lima, N. (2009) A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi. Int J Food Microbiol 129, 187–193. Rodrigues, P., Santos, C., Venancio, A. and Lima, N. (2011) Species identification of Aspergillus section Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and molecular approaches. J Appl Microbiol 111, 877–892. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) MolecularCloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Samson, R.A. and Varga, J. (2009) What is a species in Aspergillus? Med Mycol 47, S13–S20. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A. and Salomon, R. (1996) Detection of aflatoxigenic molds in grains by PCR. Appl Environ Microbiol 62, 3270–3273.
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
421
Aspergillus section Flavi detection
S.R. Priyanka et al.
Van de Peer, Y. and De Wachter, Y. (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10, 569–570. Varga, J., Frisvad, J.C. and Samson, R.A. (2011) Two new aflatoxin producing species, and an overview of Aspergillus section Flavi. Stud Mycol 69, 58–80. Wang, L., Yokoyama, K., Takahasi, H., Kase, N., Hanya, Y., Yashiro, K., Miyaji, M. and Nishimura, K. (2001) Identification of species in Aspergillus section Flavi based on sequencing of the mitochondrial cytochrome b gene. Int J Food Microbiol 71, 75–86. Woloshuk, C.P., Foutz, K.R., Brewer, J.F., Bhatnagar, D., Cleveland, T.E. and Payne, G.A. (1994) Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Appl Environ Microbiol 60, 2408–2414. Yu, J., Cleveland, T., Nierman, W. and Bennett, J. (2005) Aspergillus flavus genomics: gateway to human and animal health, food safety, and crop resistance to diseases. Rev Iberoam Micol 22, 194–202. Yuan, G.F., Liu, C.S. and Chen, C.C. (1995) Differentiation of Aspergillus parasiticus from Aspergillus sojae by random
422
amplification of polymorphic DNA. Appl Environ Microbiol 61, 2384–2387.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1 List of ISSR primers used in the study. Figure S1 Overlay of the fifteen individual UV electropherograms of ISSR AG8C band patterns showing the conspicuous and conserved band (red arrow). Data S1 ClustalW multiple sequence alignment of SCAR sequences from 15 fungal cultures used in the study. The forward and reverse primer sequences are highlighted. A: Aspergillus flavus NCIM 1209; B: A. flavus DFR AF28; C: A. flavus DFR AF12; D: A. flavus DFR AF1; E: A. flavus DFR AF18; F: A. flavus DFR AF24; G: Aspergillus oryzae NCIM 640; H: A. oryzae NCIM 644; I: A. oryzae NCIM 564; J: Aspergillus parasiticus NCIM 898; K: A. parasiticus MTCC 2797; L: A. parasiticus MTCC 2796; M: Aspergillus sojae NCIM 1198; N: Aspergillus nomius MTCC 86519; O: Aspergillus tamarii MTCC 8841.
Letters in Applied Microbiology 58, 414--422 © 2013 The Society for Applied Microbiology
