crossmark
Development of an Enzyme-Linked Immunosorbent Assay Based on Fusion VP2332-452 Antigen for Detecting Antibodies against Aleutian Mink Disease Virus Xiaowei Chen, Cailing Song, Yun Liu, Liandong Qu, Dafei Liu, Yun Zhang, Ming Liu State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Harbin, China
For detection of Aleutian mink disease virus (AMDV) antibodies, an enzyme-linked immunosorbent assay (ELISA) was developed using the recombinant VP2332-452 protein as an antigen. Counterimmunoelectrophoresis (CIEP) was used as a reference test to compare the results of the ELISA and Western blotting (WB); the specificity and sensitivity of the VP2332-452 ELISA were 97.9% and 97.3%, respectively, which were higher than those of WB. Therefore, this VP2332-452 ELISA may be a preferable method for detecting antibodies against AMDV.
A
leutian mink disease virus (AMDV), a member of the genus Amdovirus, subfamily Parvovirinae, family Parvoviridae, is a single-stranded DNA virus with a genome length of 4.8 kb (1, 2). The AMDV genome contains two major open reading frames (ORFs), i.e., a 5= ORF encoding the capsid proteins VP1 and VP2 and a 3= ORF encoding the nonstructural proteins NS1 and NS2. Identified strains varied in pathogenicity from nonpathogenic (AMDV-G) to highly pathogenic (AMDV-Utah 1, AMDVUnited, and AMDV-K) (3–5). AMDV is found in all countries that breed mink and causes the greatest financial loss to farmers, including decreased production, loss of breeding animals, and low-quality fur (6). This nonenveloped DNA virus is persistent in the environment and resistant to various physical and chemical treatments. AMDV infection is normally persistent and fatal, and there is no effective vaccine against the disease (7–9). Transmission of AMDV occurs horizontally by direct and indirect contact and vertically from pregnant mink to kits. Currently, the most successful strategies for eradicating AMD are based on serological screening and culling of all antibody-positive animals. AMD diagnosis is primarily based on the clinical signs and detection of AMDV antibodies. Counterimmunoelectrophoresis (CIEP) has been widely used for routine detection of AMDV antibodies (10). Concerning antibody detection, enzyme-linked immunosorbent assay (ELISA) has the advantage of being easily automated, whereas the CIEP analysis is labor intensive, with many manual tasks and requiring sophisticated instruments, and is not suited for automation. Currently, an ELISA based on the baculovirus-expressed whole VP2 protein has been developed, and it seems to be in good agreement with CIEP analysis (11). However, this ELISA has the disadvantages of requiring propagation and purification of large quantities of VP2 protein in eukaryotic baculovirus systems and expensive processes. Propagation and purification of the proteins are easier than with the eukaryotic expression system, and the cost is lower in the Escherichia coli (E. coli) expression system. E. coli-expressed protein-based ELISAs have a high sensitivity and specificity because of the high concentration of immunoreactive antigens, and they have been widely used for large-scale surveys (12–15). However, a cost-effective ELISA based on E. coli-expressed proteins for rapid detection of antibodies against AMDV has not been developed. Therefore, in the pres-
February 2016 Volume 54 Number 2
ent study, we developed a rapid, cheap, and sensitive ELISA based on E. coli-expressed proteins for screening antibodies against AMDV. Bloom et al. (16) demonstrated that the antigenic regions, or the most consistently immunoreactive regions, were pVP2e, pVP2f, and pVP2g (between amino acids [aa] 290 and 525), which encompassed the analogs of surface loops 3 and 4 of the canine parvovirus (CPV) (17, 18), containing the linear epitopes located on the external surface of the AMDV virion capsid proteins. These pVP2e, pVP2f, and pVP2g segments of capsid proteins of AMDV were detected in all of the serum samples of mink infected with different AMDVs (AMDV-TR, AMDV-Utah, or AMDV-Pullman). Moreover, Bloom et al. (19) identified one very important surface-exposed residue, the 19-amino-acid peptide VP2428-446 on the VP2 segment. To express central antigen fragments of the VP2 protein, the potential major hydrophilic region or antigenic peak on VP2 was calculated and found to be located in the central region between aa 332 and 452 (data not shown) by using DNAStar Lasergene software 99 (20). Primers VP2e F994 (5=-TATGGATCCAGAC TAGGTCACTTTTGGGGTG-3=; underlined nucleotides represent the BamHI site) and VP2g R1356 (TATCTGCAGTTAATGGTGAT GATGGTGGTGAATGGGTGGTACACG-3=; underlined nucleotides represent the PstI site) corresponding to this region (between aa 332 and 452) were designed. The amplified PCR product was sequenced, resulting in the expected 363-bp segment. The PCR
Received 29 September 2015 Returned for modification 17 October 2015 Accepted 31 October 2015 Accepted manuscript posted online 18 November 2015 Citation Chen X, Song C, Liu Y, Qu L, Liu D, Zhang Y, Liu M. 2016. Development of an enzyme-linked immunosorbent assay based on fusion VP2332-452 antigen for detecting antibodies against Aleutian mink disease virus. J Clin Microbiol 54:439 –442. doi:10.1128/JCM.02625-15. Editor: B. W. Fenwick Address correspondence to Yun Zhang, [email protected], or Ming Liu, [email protected]. X.C and C.S. contributed equally to this article. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JCM.02625-15. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Journal of Clinical Microbiology
jcm.asm.org
439
Chen et al.
FIG 1 (A) Identification of VP2332-452 fusion protein from transformed E. coli cells by SDS-PAGE. Lane 1, E. coli transformed with pMAL-VP2332-452; lane 2, E. coli transformed with pMAL-c2x; lane M, molecular mass marker. (B) Purified VP2332-452 fusion protein analyzed by SDS-PAGE and detected by Western blotting with mink anti-AMDV sera. Lane M, molecular mass marker; lane 1, purified VP2332-452 fusion protein; lane 2, protein from pMAL-c2x-transformed E. coli.
product was cloned into the BamHI-PstI sites of the pMAL-c2x vector (New England BioLabs). The correct orientation of inserts was confirmed by restriction analysis and nucleotide sequencing. The recombinant pMAL-VP2332-452 plasmid was transfected into BL21 E. coli (pLysS; Invitrogen). The expressed VP2332-452 fusion proteins in cell debris and supernatant were purified by using a HisPur cobalt purification kit (Thermo Scientific) and then analyzed by SDS-PAGE and Western blotting. Nitrocellulose membranes were probed with AMDV-positive mink sera (diluted 1:100) and phosphatase-labeled goat anti-feline IgG conjugates (1:2,000 dilution) (Thermo Scientific). SDS-PAGE showed the VP2332-452 fusion protein with a molecular mass of ⬃64 kDa (Fig. 1A), which is consistent with the expected size of fusion proteins (24.5-kDa VP2332-452 protein plus 40-kDa maltose binding protein tag). Western blotting showed that AMDV-positive sera reacted specifically against a purified 64-kDa VP2332-452 fusion protein (Fig. 1B). No proteins belonging to pMAL-c2x were detected in BL21 E. coli. Thirty mink were immunized with purified inactivated wild-type Chinese AMDV strain Z in complete Freund’s adjuvant and boosted twice with incomplete Freund’s adjuvant at 2-week intervals (approved by the Harbin Veterinary Research Institute Animal Center). Sera were collected on day 15 after the final boost. Thirty immunized and eight nonimmunized mink serum samples were used as positive- and negative-control samples in ELISA, Western blotting, and CIEP (10, 21). Sera against other known mink pathogens, e.g., mink viral enteritis virus, canine distemper virus, and Aujeszky disease (pseudorabies) virus, were collected at the Harbin Veterinary Research Institute. A total of 357 clinical serum samples were collected from minks suffering from AMD at various commercial farms since 2011. CIEP was performed using the Danad antigen (Danish Fur Breeders’ Association, Glostrup, Denmark) by following the man-
440
jcm.asm.org
ufacturer’s instructions (10, 21). Briefly, Danad antigen was added in opposing wells 1 cm apart, and the gel was run for 30 min in Gelmann buffer (50.5 mM barbiturate, 40 mM Tris) at 4.5 V. Precipitate formation in the gel between the two wells indicated positivity. For ELISA procedures, 96-well ELISA plates (Biofil; Canada JET Biochemicals, Inc.), 100 l of sample volume, and phosphatebuffered saline (PBS) containing 0.05% Tween 20 and 5% skim milk as a dilution buffer were used. To standardize the VP2332-452 ELISA, the AMDV-positive and AMDV-negative sera were diluted from 1:50 to 1:6,400 and the conjugate from 1:500 to 1:4,000. To determine the optimal concentration of protein, a checkerboard titration was carried out with different amounts of VP2332-452 protein (ranging from 0.7 to 7,000 ng/ml). By using the AMDV-positive or AMDV-negative sera, we found the optimal dilution of the test sera to be 1:100. The optimum VP2332-452 protein concentration was found to be 700 ng/ml. The optimal conjugate dilution was determined to be 1:2,000. Thus, the standardized VP2332-452 ELISA procedure is 100 l of 700 ng/ml purified VP2332-452 protein coated onto the wells of a 96-well ELISA plate and incubated overnight at 4°C. After washing twice with PBS-T (PBS containing 0.05% Tween 20), AMDV-positive and AMDV-negative sera diluted 1:100 were added. A total of 100 l of the conjugate diluted 1:2,000 was added after washing. Reactions were stopped by adding 3 M NaOH, and the plate was read on a microplate reader (Bio-Rad, Japan) at 405 nm. Using this standardized procedure, a good positive-to-negative ratio was obtained by dividing the positive and negative optical density (OD) values (2.1). AMDV-negative (n ⫽ 8) and AMDVpositive (n ⫽ 30) serum samples were examined for the presence of specific antibodies in the VP2332-452 ELISA and CIEP tests. The average OD of the AMDV-negative sera in the VP2332-452 ELISA was 0.30 ⫾ 0.024 (standard deviation [SD]). The cutoff value of the test was 0.372, determined by calculating the arithmetic mean plus three standard deviations of OD values of negative samples. The serum specimens diluted 1:100 that had OD values of ⬍0.372 or ⱖ0.372 were interpreted as negative and positive, respectively. According to this criterion, 8 uninfected mink serum samples were negative and 30 AMDV-positive serum samples were positive in the VP2332-452 ELISA. The detection threshold of the VP2332-452 ELISA compared to that of the CIEP test was determined by using serial dilutions of the AMDV-positive sera. The sensitivity was a dilution of 1:3,200 sera tested at 0.372 absorbance units for the VP2332-452 ELISA. The negative-control sera showed no detectable VP2332-452-specific antibodies in the ELISA. Antisera specific for other known mink pathogens yielded OD values of ⬍0.372, indicating that there was no cross-reactivity between the antisera specific for other known mink pathogens and VP2332-452 protein in the ELISA. The sensitivity and specificity of the VP2332-452 ELISA were
TABLE 1 Comparison between CIEP test and VP2332-452 ELISA in detection of AMDV-related antibodies CIEP result (no. of samples) VP2332-452 ELISA result
Positive
Negative
Total
Positive Negative Total
254 7 261
2 94 96
256 101 357
Journal of Clinical Microbiology
February 2016 Volume 54 Number 2
ELISA for Detecting Antibodies against AMDV
TABLE 2 Comparison between CIEP test and Western blotting in detection of AMDV-related antibodies CIEP result (no. of samples) Western blotting result
Positive
Negative
Total
Positive Negative Total
233 21 254
13 83 96
246 104 350
cost-effective, and be automated for intensive surveillance and routine diagnosis of a disease. The VP2332-452 ELISA fulfills these objectives and serves as an inexpensive source of reagents for clinical surveillance of AMDV infection. In conclusion, the VP2332-452 ELISA has advantages over the CIEP test and Western blotting, and it can be used for the detection of antibodies against AMDV in mink. ACKNOWLEDGMENTS
compared to those of the CIEP test by using the 357 clinical serum samples (Table 1). The CIEP test determined that 261 and 96 samples were AMDV positive and negative, respectively. The VP2332-452 ELISA showed that 256 and 101 serum samples were VP2332-452 antibody positive and negative, respectively. Of the 357 serum samples, 254 were judged to be positive and 96 negative by both methods (Table 1). Using the CIEP test as a reference, the specificity and sensitivity of the VP2332-452 ELISA were 97.9% and 97.3%, respectively. The concordance between the two methods was 98.0%. The Western blotting procedure was also optimized for AMDV antibody detection, and the results were compared with those of the CIEP test. Briefly, ⬃1 g purified VP2332-452 protein was subjected to 10% SDS-PAGE and transferred to nitrocellulose membrane. The membrane was incubated with AMDV-positive (n ⫽ 30) or AMDV-negative (n ⫽ 8) sera (diluted 1:100 in PBS) followed by a secondary horseradish peroxidase-conjugated goat anti-feline antibody (see Fig. S1 in the supplemental material). AMDV-positive sera (n ⫽ 30) reacted specifically against a purified 64-kDa VP2332-452 fusion protein. No proteins were detected from AMDV-negative sera (n ⫽ 8). For comparison with the CIEP test, 350 clinical serum samples (that were in agreement for both the CIEP test and the VP2332-452 ELISA) were analyzed by Western blotting. Briefly, 1 g/ml VP2332-452 fusion protein transferred from polyacrylamide gel on nitrocellulose membrane was probed with clinical sera diluted 1:100 as described for Western blotting. The sensitivity and specificity of Western blotting were analyzed using the results of the CIEP test as a reference. The specificity and sensitivity were 86.4% and 91.7%, respectively. The results of the CIEP test and Western blotting were in agreement for 316 samples (Table 2). However, 21 samples that were negative by Western blotting were positive in the CIEP test, and 13 serum samples that were negative in the CIEP test were positive by Western blotting. The sensitivity and specificity of Western blotting were lower than in the VP2332-452 ELISA. The aim of this study was to develop a cheap, simple, and sensitive method for detecting antibodies against AMDV in mink using the VP2332-452 protein, a core antigen of VP2 protein. The VP2 protein peak antigen region was calculated, cloned, and expressed in an E. coli system. By using the purified VP2332-452 protein as a detecting antigen, clinical mink serum samples were tested by VP2332-452 ELISA and Western blotting. The results of the VP2332-452-ELISA and Western blotting using the purified recombinant VP2332-452 protein were compared with the results of CIEP using a commercial antigen and showed that the recombinant VP2332-452 protein has a good antigenicity to detect AMDVspecific antibodies by ELISA and Western blotting. Also, compared to Western blotting, the ELISA results were in better concordance with those of the CIEP test. A preferred diagnostic technique must have simple steps, be
February 2016 Volume 54 Number 2
This work was supported by the Modern Agroindustry Technology Research System (CARS-43-10) and the Chinese Fund for Agri-Scientific Research (201303046).
REFERENCES 1. Bloom ME, Alexandersen S, Perryman S, Lechner D, Wolfinbarger JB. 1988. Nucleotide sequence and genomic organization of Aleutian mink disease parvovirus (ADV): sequence comparisons between a nonpathogenic and a pathogenic strain of ADV. J Virol 62:2903–2915. 2. Bloom ME, Berry BD, Wei W, Perryman S, Wolfinbarger JB. 1993. Characterization of chimeric full-length molecular clones of Aleutian mink disease parvovirus (ADV): identification of a determinant governing replication of ADV in cell culture. J Virol 67:5976 –5988. 3. Bloom ME, Race RE, Wolfinbarger JB. 1980. Characterization of Aleutian disease virus as a parvovirus. J Virol 35:836 – 843. 4. Gottschalck E, Alexandersen S, Storgaard T, Bloom ME, Aasted B. 1994. Sequence comparison of the non-structural genes of four different types of Aleutian mink disease parvovirus indicates an unusual degree of variability. Arch Virol 138:213–231. http://dx.doi.org/10 .1007/BF01379127. 5. Hadlow WJ, Race RE, Kennedy RC. 1983. Comparative pathogenicity of four strains of Aleutian disease virus for pastel and sapphire mink. Infect Immun 41:1016 –1023. 6. Gorham JR, Henson JB, Crawford TB, Padgett GA. 1976. The epizootiology of Aleutian disease. Front Biol 44:135–158. 7. Aasted B, Alexandersen S, Christensen J. 1998. Vaccination with Aleutian mink disease parvovirus (AMDV) capsid proteins enhances disease, while vaccination with the major non-structural protein causes partial protection from disease. Vaccine 16:1158 –1165. http://dx.doi.org/10 .1016/S0264-410X(98)80114-X. 8. Castelruiz Y, Blixenkrone-Møller M, Aasted B. 2005. DNA vaccination with the Aleutian mink disease virus NS1 gene confers partial protection against disease. Vaccine 23:1225–1231. http://dx.doi.org /10.1016/j.vaccine.2004.09.003. 9. Porter DD, Larsen AE, Porter HG. 1972. The pathogenesis of Aleutian disease of mink. II. Enhancement of tissue lesions following the administration of a killed virus vaccine or passive antibody. J Immunol 109:1–7. 10. Cho HJ, Ingram DG. 1972. Antigen and antibody in Aleutian disease in mink. I. Precipitation reaction by agar-gel electrophoresis. J Immunol 108:555–557. 11. Knuuttila A, Aronen P, Saarinen A, Vapalahti O. 2009. Development and evaluation of an enzyme-linked immunosorbent assay based on recombinant VP2 capsids for the detection of antibodies to Aleutian mink disease virus. Clin Vac Immunol 16:1360 –1365. http://dx.doi.org/10.1128 /CVI.00148-09. 12. Sevinc F, Cao S, Xuan X, Sevinc M, Ceylan O. 2015. Identification and expression of Babesia ovis secreted antigen 1 and evaluation of its diagnostic potential in an enzyme-linked immunosorbent assay. J Clin Microbiol 53:1531–1536. http://dx.doi.org/10.1128/JCM.03219-14. 13. Van Dreumel AK, Michalski WP, McNabb LM, Shiell BJ, Singanallur NB, Peck GR. 2015. Pan-serotype diagnostic for foot-and-mouth disease using the consensus antigen of nonstructural protein 3B. J Clin Microbiol 53:1797–1805. http://dx.doi.org/10.1128/JCM.03491-14. 14. Chang PC, Chen KT, Shien JH, Shieh HK. 2002. Expression of infectious laryngotracheitis virus glycoproteins in Escherichia coli and their application in enzyme-linked immunosorbent assay. Avian Dis 46:570 –580. http: //dx.doi.org/10.1637/0005-2086(2002)046[0570:EOILVG]2.0.CO;2. 15. Jiao YJ, Zeng XY, Guo XL, Qi X, Zhang X, Shi ZY, Zhou MH, Bao CJ, Zhang WS, Xu Y, Wang H. 2011. Preparation and evaluation of recombinant severe fever with thrombocytopenia syndrome virus nu-
Journal of Clinical Microbiology
jcm.asm.org
441
Chen et al.
cleocapsid protein for detection of total antibodies in human and animal sera by double-antigen sandwich enzyme-linked immunosorbent assay. J Clin Microbiol 50:372–377. http://dx.doi.org/10.1128 /JCM.01319-11. 16. Bloom ME, Martin DA, Oie KL, Huhtanen ME, Costello F, Wolfinbarger JB, Hayess SF, Agbandje-Mckenna M. 1997. Expression of Aleutian mink disease parvovirus capsid proteins in defined segments: localization of immunoreactive sites and neutralizing epitopes to specific regions. J Virol 71:705–714. 17. Strassheim ML, Gruenberg A, Veijalainen PML, Sgro JY, Parrish CR. 1994. Two dominant neutralizing antigenic determinants of canine parvovirus are found on the threefold spike of the virus capsid. Virology 198:175–184. http://dx.doi.org/10.1006/viro.1994.1020. 18. Tsao J, Chapman MS, Agbandje M, Keller W, Smith K, Wu H, Luo M, Smith TJ, Rossmann MG, Compans RW, Parrish CR. 1991. The three-
442
jcm.asm.org
dimensional structure of canine parvovirus and its functional implications. Science 251:1456 –1464. http://dx.doi.org/10.1126/science.2006420. 19. Bloom ME, Best SM, Hayes SF, Wells RD, Wolfinbarger JB, McKenna R, Agbandje-McKenna M. 2001. Identification of Aleutian mink disease parvovirus capsid sequences mediating antibody-dependent enhancement of infection, virus neutralization, and immune complex formation. J Virol 75:11116 –11127. http://dx.doi.org/10.1128/JVI.75.22.11116 -11127.2001. 20. Cui XL, Nagesha HS, Holmesa IH. 2003. Mapping of conformational epitopes on capsid protein VP2 of infectious bursal disease virus by fd-tet phage display. J Virol Methods 114:109 –112. http://dx.doi.org/10.1016/j .jviromet.2003.09.006. 21. Bloom ME, Race RE, Hadlow WJ, Chesebro B. 1975. Aleutian disease of mink: the antibody response of sapphire and pastel mink to Aleutian disease virus. J Immunol 115:1034 –1037.
Journal of Clinical Microbiology
February 2016 Volume 54 Number 2
Development of an Enzyme-Linked Immunosorbent Assay Based on Fusion VP2332-452 Antigen for Detecting Antibodies against Aleutian Mink Disease Virus Xiaowei Chen, Cailing Song, Yun Liu, Liandong Qu, Dafei Liu, Yun Zhang, Ming Liu State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Harbin, China
For detection of Aleutian mink disease virus (AMDV) antibodies, an enzyme-linked immunosorbent assay (ELISA) was developed using the recombinant VP2332-452 protein as an antigen. Counterimmunoelectrophoresis (CIEP) was used as a reference test to compare the results of the ELISA and Western blotting (WB); the specificity and sensitivity of the VP2332-452 ELISA were 97.9% and 97.3%, respectively, which were higher than those of WB. Therefore, this VP2332-452 ELISA may be a preferable method for detecting antibodies against AMDV.
A
leutian mink disease virus (AMDV), a member of the genus Amdovirus, subfamily Parvovirinae, family Parvoviridae, is a single-stranded DNA virus with a genome length of 4.8 kb (1, 2). The AMDV genome contains two major open reading frames (ORFs), i.e., a 5= ORF encoding the capsid proteins VP1 and VP2 and a 3= ORF encoding the nonstructural proteins NS1 and NS2. Identified strains varied in pathogenicity from nonpathogenic (AMDV-G) to highly pathogenic (AMDV-Utah 1, AMDVUnited, and AMDV-K) (3–5). AMDV is found in all countries that breed mink and causes the greatest financial loss to farmers, including decreased production, loss of breeding animals, and low-quality fur (6). This nonenveloped DNA virus is persistent in the environment and resistant to various physical and chemical treatments. AMDV infection is normally persistent and fatal, and there is no effective vaccine against the disease (7–9). Transmission of AMDV occurs horizontally by direct and indirect contact and vertically from pregnant mink to kits. Currently, the most successful strategies for eradicating AMD are based on serological screening and culling of all antibody-positive animals. AMD diagnosis is primarily based on the clinical signs and detection of AMDV antibodies. Counterimmunoelectrophoresis (CIEP) has been widely used for routine detection of AMDV antibodies (10). Concerning antibody detection, enzyme-linked immunosorbent assay (ELISA) has the advantage of being easily automated, whereas the CIEP analysis is labor intensive, with many manual tasks and requiring sophisticated instruments, and is not suited for automation. Currently, an ELISA based on the baculovirus-expressed whole VP2 protein has been developed, and it seems to be in good agreement with CIEP analysis (11). However, this ELISA has the disadvantages of requiring propagation and purification of large quantities of VP2 protein in eukaryotic baculovirus systems and expensive processes. Propagation and purification of the proteins are easier than with the eukaryotic expression system, and the cost is lower in the Escherichia coli (E. coli) expression system. E. coli-expressed protein-based ELISAs have a high sensitivity and specificity because of the high concentration of immunoreactive antigens, and they have been widely used for large-scale surveys (12–15). However, a cost-effective ELISA based on E. coli-expressed proteins for rapid detection of antibodies against AMDV has not been developed. Therefore, in the pres-
February 2016 Volume 54 Number 2
ent study, we developed a rapid, cheap, and sensitive ELISA based on E. coli-expressed proteins for screening antibodies against AMDV. Bloom et al. (16) demonstrated that the antigenic regions, or the most consistently immunoreactive regions, were pVP2e, pVP2f, and pVP2g (between amino acids [aa] 290 and 525), which encompassed the analogs of surface loops 3 and 4 of the canine parvovirus (CPV) (17, 18), containing the linear epitopes located on the external surface of the AMDV virion capsid proteins. These pVP2e, pVP2f, and pVP2g segments of capsid proteins of AMDV were detected in all of the serum samples of mink infected with different AMDVs (AMDV-TR, AMDV-Utah, or AMDV-Pullman). Moreover, Bloom et al. (19) identified one very important surface-exposed residue, the 19-amino-acid peptide VP2428-446 on the VP2 segment. To express central antigen fragments of the VP2 protein, the potential major hydrophilic region or antigenic peak on VP2 was calculated and found to be located in the central region between aa 332 and 452 (data not shown) by using DNAStar Lasergene software 99 (20). Primers VP2e F994 (5=-TATGGATCCAGAC TAGGTCACTTTTGGGGTG-3=; underlined nucleotides represent the BamHI site) and VP2g R1356 (TATCTGCAGTTAATGGTGAT GATGGTGGTGAATGGGTGGTACACG-3=; underlined nucleotides represent the PstI site) corresponding to this region (between aa 332 and 452) were designed. The amplified PCR product was sequenced, resulting in the expected 363-bp segment. The PCR
Received 29 September 2015 Returned for modification 17 October 2015 Accepted 31 October 2015 Accepted manuscript posted online 18 November 2015 Citation Chen X, Song C, Liu Y, Qu L, Liu D, Zhang Y, Liu M. 2016. Development of an enzyme-linked immunosorbent assay based on fusion VP2332-452 antigen for detecting antibodies against Aleutian mink disease virus. J Clin Microbiol 54:439 –442. doi:10.1128/JCM.02625-15. Editor: B. W. Fenwick Address correspondence to Yun Zhang, [email protected], or Ming Liu, [email protected]. X.C and C.S. contributed equally to this article. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JCM.02625-15. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Journal of Clinical Microbiology
jcm.asm.org
439
Chen et al.
FIG 1 (A) Identification of VP2332-452 fusion protein from transformed E. coli cells by SDS-PAGE. Lane 1, E. coli transformed with pMAL-VP2332-452; lane 2, E. coli transformed with pMAL-c2x; lane M, molecular mass marker. (B) Purified VP2332-452 fusion protein analyzed by SDS-PAGE and detected by Western blotting with mink anti-AMDV sera. Lane M, molecular mass marker; lane 1, purified VP2332-452 fusion protein; lane 2, protein from pMAL-c2x-transformed E. coli.
product was cloned into the BamHI-PstI sites of the pMAL-c2x vector (New England BioLabs). The correct orientation of inserts was confirmed by restriction analysis and nucleotide sequencing. The recombinant pMAL-VP2332-452 plasmid was transfected into BL21 E. coli (pLysS; Invitrogen). The expressed VP2332-452 fusion proteins in cell debris and supernatant were purified by using a HisPur cobalt purification kit (Thermo Scientific) and then analyzed by SDS-PAGE and Western blotting. Nitrocellulose membranes were probed with AMDV-positive mink sera (diluted 1:100) and phosphatase-labeled goat anti-feline IgG conjugates (1:2,000 dilution) (Thermo Scientific). SDS-PAGE showed the VP2332-452 fusion protein with a molecular mass of ⬃64 kDa (Fig. 1A), which is consistent with the expected size of fusion proteins (24.5-kDa VP2332-452 protein plus 40-kDa maltose binding protein tag). Western blotting showed that AMDV-positive sera reacted specifically against a purified 64-kDa VP2332-452 fusion protein (Fig. 1B). No proteins belonging to pMAL-c2x were detected in BL21 E. coli. Thirty mink were immunized with purified inactivated wild-type Chinese AMDV strain Z in complete Freund’s adjuvant and boosted twice with incomplete Freund’s adjuvant at 2-week intervals (approved by the Harbin Veterinary Research Institute Animal Center). Sera were collected on day 15 after the final boost. Thirty immunized and eight nonimmunized mink serum samples were used as positive- and negative-control samples in ELISA, Western blotting, and CIEP (10, 21). Sera against other known mink pathogens, e.g., mink viral enteritis virus, canine distemper virus, and Aujeszky disease (pseudorabies) virus, were collected at the Harbin Veterinary Research Institute. A total of 357 clinical serum samples were collected from minks suffering from AMD at various commercial farms since 2011. CIEP was performed using the Danad antigen (Danish Fur Breeders’ Association, Glostrup, Denmark) by following the man-
440
jcm.asm.org
ufacturer’s instructions (10, 21). Briefly, Danad antigen was added in opposing wells 1 cm apart, and the gel was run for 30 min in Gelmann buffer (50.5 mM barbiturate, 40 mM Tris) at 4.5 V. Precipitate formation in the gel between the two wells indicated positivity. For ELISA procedures, 96-well ELISA plates (Biofil; Canada JET Biochemicals, Inc.), 100 l of sample volume, and phosphatebuffered saline (PBS) containing 0.05% Tween 20 and 5% skim milk as a dilution buffer were used. To standardize the VP2332-452 ELISA, the AMDV-positive and AMDV-negative sera were diluted from 1:50 to 1:6,400 and the conjugate from 1:500 to 1:4,000. To determine the optimal concentration of protein, a checkerboard titration was carried out with different amounts of VP2332-452 protein (ranging from 0.7 to 7,000 ng/ml). By using the AMDV-positive or AMDV-negative sera, we found the optimal dilution of the test sera to be 1:100. The optimum VP2332-452 protein concentration was found to be 700 ng/ml. The optimal conjugate dilution was determined to be 1:2,000. Thus, the standardized VP2332-452 ELISA procedure is 100 l of 700 ng/ml purified VP2332-452 protein coated onto the wells of a 96-well ELISA plate and incubated overnight at 4°C. After washing twice with PBS-T (PBS containing 0.05% Tween 20), AMDV-positive and AMDV-negative sera diluted 1:100 were added. A total of 100 l of the conjugate diluted 1:2,000 was added after washing. Reactions were stopped by adding 3 M NaOH, and the plate was read on a microplate reader (Bio-Rad, Japan) at 405 nm. Using this standardized procedure, a good positive-to-negative ratio was obtained by dividing the positive and negative optical density (OD) values (2.1). AMDV-negative (n ⫽ 8) and AMDVpositive (n ⫽ 30) serum samples were examined for the presence of specific antibodies in the VP2332-452 ELISA and CIEP tests. The average OD of the AMDV-negative sera in the VP2332-452 ELISA was 0.30 ⫾ 0.024 (standard deviation [SD]). The cutoff value of the test was 0.372, determined by calculating the arithmetic mean plus three standard deviations of OD values of negative samples. The serum specimens diluted 1:100 that had OD values of ⬍0.372 or ⱖ0.372 were interpreted as negative and positive, respectively. According to this criterion, 8 uninfected mink serum samples were negative and 30 AMDV-positive serum samples were positive in the VP2332-452 ELISA. The detection threshold of the VP2332-452 ELISA compared to that of the CIEP test was determined by using serial dilutions of the AMDV-positive sera. The sensitivity was a dilution of 1:3,200 sera tested at 0.372 absorbance units for the VP2332-452 ELISA. The negative-control sera showed no detectable VP2332-452-specific antibodies in the ELISA. Antisera specific for other known mink pathogens yielded OD values of ⬍0.372, indicating that there was no cross-reactivity between the antisera specific for other known mink pathogens and VP2332-452 protein in the ELISA. The sensitivity and specificity of the VP2332-452 ELISA were
TABLE 1 Comparison between CIEP test and VP2332-452 ELISA in detection of AMDV-related antibodies CIEP result (no. of samples) VP2332-452 ELISA result
Positive
Negative
Total
Positive Negative Total
254 7 261
2 94 96
256 101 357
Journal of Clinical Microbiology
February 2016 Volume 54 Number 2
ELISA for Detecting Antibodies against AMDV
TABLE 2 Comparison between CIEP test and Western blotting in detection of AMDV-related antibodies CIEP result (no. of samples) Western blotting result
Positive
Negative
Total
Positive Negative Total
233 21 254
13 83 96
246 104 350
cost-effective, and be automated for intensive surveillance and routine diagnosis of a disease. The VP2332-452 ELISA fulfills these objectives and serves as an inexpensive source of reagents for clinical surveillance of AMDV infection. In conclusion, the VP2332-452 ELISA has advantages over the CIEP test and Western blotting, and it can be used for the detection of antibodies against AMDV in mink. ACKNOWLEDGMENTS
compared to those of the CIEP test by using the 357 clinical serum samples (Table 1). The CIEP test determined that 261 and 96 samples were AMDV positive and negative, respectively. The VP2332-452 ELISA showed that 256 and 101 serum samples were VP2332-452 antibody positive and negative, respectively. Of the 357 serum samples, 254 were judged to be positive and 96 negative by both methods (Table 1). Using the CIEP test as a reference, the specificity and sensitivity of the VP2332-452 ELISA were 97.9% and 97.3%, respectively. The concordance between the two methods was 98.0%. The Western blotting procedure was also optimized for AMDV antibody detection, and the results were compared with those of the CIEP test. Briefly, ⬃1 g purified VP2332-452 protein was subjected to 10% SDS-PAGE and transferred to nitrocellulose membrane. The membrane was incubated with AMDV-positive (n ⫽ 30) or AMDV-negative (n ⫽ 8) sera (diluted 1:100 in PBS) followed by a secondary horseradish peroxidase-conjugated goat anti-feline antibody (see Fig. S1 in the supplemental material). AMDV-positive sera (n ⫽ 30) reacted specifically against a purified 64-kDa VP2332-452 fusion protein. No proteins were detected from AMDV-negative sera (n ⫽ 8). For comparison with the CIEP test, 350 clinical serum samples (that were in agreement for both the CIEP test and the VP2332-452 ELISA) were analyzed by Western blotting. Briefly, 1 g/ml VP2332-452 fusion protein transferred from polyacrylamide gel on nitrocellulose membrane was probed with clinical sera diluted 1:100 as described for Western blotting. The sensitivity and specificity of Western blotting were analyzed using the results of the CIEP test as a reference. The specificity and sensitivity were 86.4% and 91.7%, respectively. The results of the CIEP test and Western blotting were in agreement for 316 samples (Table 2). However, 21 samples that were negative by Western blotting were positive in the CIEP test, and 13 serum samples that were negative in the CIEP test were positive by Western blotting. The sensitivity and specificity of Western blotting were lower than in the VP2332-452 ELISA. The aim of this study was to develop a cheap, simple, and sensitive method for detecting antibodies against AMDV in mink using the VP2332-452 protein, a core antigen of VP2 protein. The VP2 protein peak antigen region was calculated, cloned, and expressed in an E. coli system. By using the purified VP2332-452 protein as a detecting antigen, clinical mink serum samples were tested by VP2332-452 ELISA and Western blotting. The results of the VP2332-452-ELISA and Western blotting using the purified recombinant VP2332-452 protein were compared with the results of CIEP using a commercial antigen and showed that the recombinant VP2332-452 protein has a good antigenicity to detect AMDVspecific antibodies by ELISA and Western blotting. Also, compared to Western blotting, the ELISA results were in better concordance with those of the CIEP test. A preferred diagnostic technique must have simple steps, be
February 2016 Volume 54 Number 2
This work was supported by the Modern Agroindustry Technology Research System (CARS-43-10) and the Chinese Fund for Agri-Scientific Research (201303046).
REFERENCES 1. Bloom ME, Alexandersen S, Perryman S, Lechner D, Wolfinbarger JB. 1988. Nucleotide sequence and genomic organization of Aleutian mink disease parvovirus (ADV): sequence comparisons between a nonpathogenic and a pathogenic strain of ADV. J Virol 62:2903–2915. 2. Bloom ME, Berry BD, Wei W, Perryman S, Wolfinbarger JB. 1993. Characterization of chimeric full-length molecular clones of Aleutian mink disease parvovirus (ADV): identification of a determinant governing replication of ADV in cell culture. J Virol 67:5976 –5988. 3. Bloom ME, Race RE, Wolfinbarger JB. 1980. Characterization of Aleutian disease virus as a parvovirus. J Virol 35:836 – 843. 4. Gottschalck E, Alexandersen S, Storgaard T, Bloom ME, Aasted B. 1994. Sequence comparison of the non-structural genes of four different types of Aleutian mink disease parvovirus indicates an unusual degree of variability. Arch Virol 138:213–231. http://dx.doi.org/10 .1007/BF01379127. 5. Hadlow WJ, Race RE, Kennedy RC. 1983. Comparative pathogenicity of four strains of Aleutian disease virus for pastel and sapphire mink. Infect Immun 41:1016 –1023. 6. Gorham JR, Henson JB, Crawford TB, Padgett GA. 1976. The epizootiology of Aleutian disease. Front Biol 44:135–158. 7. Aasted B, Alexandersen S, Christensen J. 1998. Vaccination with Aleutian mink disease parvovirus (AMDV) capsid proteins enhances disease, while vaccination with the major non-structural protein causes partial protection from disease. Vaccine 16:1158 –1165. http://dx.doi.org/10 .1016/S0264-410X(98)80114-X. 8. Castelruiz Y, Blixenkrone-Møller M, Aasted B. 2005. DNA vaccination with the Aleutian mink disease virus NS1 gene confers partial protection against disease. Vaccine 23:1225–1231. http://dx.doi.org /10.1016/j.vaccine.2004.09.003. 9. Porter DD, Larsen AE, Porter HG. 1972. The pathogenesis of Aleutian disease of mink. II. Enhancement of tissue lesions following the administration of a killed virus vaccine or passive antibody. J Immunol 109:1–7. 10. Cho HJ, Ingram DG. 1972. Antigen and antibody in Aleutian disease in mink. I. Precipitation reaction by agar-gel electrophoresis. J Immunol 108:555–557. 11. Knuuttila A, Aronen P, Saarinen A, Vapalahti O. 2009. Development and evaluation of an enzyme-linked immunosorbent assay based on recombinant VP2 capsids for the detection of antibodies to Aleutian mink disease virus. Clin Vac Immunol 16:1360 –1365. http://dx.doi.org/10.1128 /CVI.00148-09. 12. Sevinc F, Cao S, Xuan X, Sevinc M, Ceylan O. 2015. Identification and expression of Babesia ovis secreted antigen 1 and evaluation of its diagnostic potential in an enzyme-linked immunosorbent assay. J Clin Microbiol 53:1531–1536. http://dx.doi.org/10.1128/JCM.03219-14. 13. Van Dreumel AK, Michalski WP, McNabb LM, Shiell BJ, Singanallur NB, Peck GR. 2015. Pan-serotype diagnostic for foot-and-mouth disease using the consensus antigen of nonstructural protein 3B. J Clin Microbiol 53:1797–1805. http://dx.doi.org/10.1128/JCM.03491-14. 14. Chang PC, Chen KT, Shien JH, Shieh HK. 2002. Expression of infectious laryngotracheitis virus glycoproteins in Escherichia coli and their application in enzyme-linked immunosorbent assay. Avian Dis 46:570 –580. http: //dx.doi.org/10.1637/0005-2086(2002)046[0570:EOILVG]2.0.CO;2. 15. Jiao YJ, Zeng XY, Guo XL, Qi X, Zhang X, Shi ZY, Zhou MH, Bao CJ, Zhang WS, Xu Y, Wang H. 2011. Preparation and evaluation of recombinant severe fever with thrombocytopenia syndrome virus nu-
Journal of Clinical Microbiology
jcm.asm.org
441
Chen et al.
cleocapsid protein for detection of total antibodies in human and animal sera by double-antigen sandwich enzyme-linked immunosorbent assay. J Clin Microbiol 50:372–377. http://dx.doi.org/10.1128 /JCM.01319-11. 16. Bloom ME, Martin DA, Oie KL, Huhtanen ME, Costello F, Wolfinbarger JB, Hayess SF, Agbandje-Mckenna M. 1997. Expression of Aleutian mink disease parvovirus capsid proteins in defined segments: localization of immunoreactive sites and neutralizing epitopes to specific regions. J Virol 71:705–714. 17. Strassheim ML, Gruenberg A, Veijalainen PML, Sgro JY, Parrish CR. 1994. Two dominant neutralizing antigenic determinants of canine parvovirus are found on the threefold spike of the virus capsid. Virology 198:175–184. http://dx.doi.org/10.1006/viro.1994.1020. 18. Tsao J, Chapman MS, Agbandje M, Keller W, Smith K, Wu H, Luo M, Smith TJ, Rossmann MG, Compans RW, Parrish CR. 1991. The three-
442
jcm.asm.org
dimensional structure of canine parvovirus and its functional implications. Science 251:1456 –1464. http://dx.doi.org/10.1126/science.2006420. 19. Bloom ME, Best SM, Hayes SF, Wells RD, Wolfinbarger JB, McKenna R, Agbandje-McKenna M. 2001. Identification of Aleutian mink disease parvovirus capsid sequences mediating antibody-dependent enhancement of infection, virus neutralization, and immune complex formation. J Virol 75:11116 –11127. http://dx.doi.org/10.1128/JVI.75.22.11116 -11127.2001. 20. Cui XL, Nagesha HS, Holmesa IH. 2003. Mapping of conformational epitopes on capsid protein VP2 of infectious bursal disease virus by fd-tet phage display. J Virol Methods 114:109 –112. http://dx.doi.org/10.1016/j .jviromet.2003.09.006. 21. Bloom ME, Race RE, Hadlow WJ, Chesebro B. 1975. Aleutian disease of mink: the antibody response of sapphire and pastel mink to Aleutian disease virus. J Immunol 115:1034 –1037.
Journal of Clinical Microbiology
February 2016 Volume 54 Number 2
