Journal of Virological Methods 217 (2015) 64–69

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Development of a TaqMan MGB RT-PCR for the rapid detection of H3 subtype avian influenza virus circulating in China Qiaoyang Teng a,b , Weixia Shen a , Dawei Yan a , Liping Yan a,b , Xuesong Li a,b , Guoxin Li a,b , Jianmei Yang a,b , Zejun Li a,b,∗ a b

Innovation Team for Pathogen Ecology Research on Animal Influenza Virus, Shanghai 200241, China Department of Avian Infectious Disease, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai 200241, China

a b s t r a c t Article history: Received 16 June 2014 Received in revised form 16 January 2015 Accepted 11 February 2015 Available online 6 March 2015 Keywords: Minor groove binder H3 subtype Sensitivity Detection

Previous studies demonstrated that the H3 avian influenza virus (AIV) in China is isolated most frequently from wild birds and live poultry markets. However, there is no subtype-specific real-time polymerase chain reaction (RT-PCR) available for the rapid and highly sensitive identification of H3 AIV. In this study, a TaqMan minor groove binder (MGB) probe and a pair of primers were designed based on a conserved region in the hemagglutinin gene of H3 AIV. These were used to generate an H3-MGB RT-PCR assay that recognizes only H3 AIV. The detection limit of the H3-MGB RT-PCR was 10 copies of DNA per reaction when 10-fold serial dilutions of T-H3HA plasmid were used as the template. This was 1000-times more sensitive than conventional RT-PCR. In experimental samples obtained from oropharyngeal swabs or cloacal swabs, the virus was detected in all ducks using H3-MGB RT-PCR, whereas only one duck tested positive for the virus in oropharyngeal swabs tested using conventional RT-PCR. The H3-MGB RT-PCR assay developed in this study is a sensitive and rapid tool for screening H3 AIV in China. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Avian influenza (AI) has 16 hemagglutinin (HA) and nine neuraminidase subtypes (Alexander, 2007; Lee and Saif, 2009). The H3, H4, H9, and H10 subtypes have been circulating and evolving in China (Liu et al., 2003). Among these, the H3 subtype avian influenza virus (AIV) is isolated most frequently from wild birds and live poultry markets (Shortridge, 1992; Liu et al., 2003; Choi et al., 2012). A recent serological survey conducted in China demonstrated a wide range of H3 subtype AIV infections in chickens (Pu et al., 2009). Generally, influenza viruses are strictly host-specific (Beare and Webster, 1991; Webster et al., 1992). Although the mechanism of host range restrictions is not defined completely, compatibility between the virus HA protein and its corresponding receptor on host cells determines the species specificity of the virus partially (Ito et al., 1998; Ito, 2000). Since 1998, H3N2 viruses have spread widely in the North American swine population and caused a

∗ Corresponding author at: Innovation Team for Pathogen Ecology Research on Animal Influenza Virus, Shanghai 200241, China. Tel.: +86 3 429 3446; fax: +86 3 429 3446. E-mail address: [email protected] (Z. Li). http://dx.doi.org/10.1016/j.jviromet.2015.02.025 0166-0934/© 2015 Elsevier B.V. All rights reserved.

serious epizootic outbreak of respiratory illness. These H3N2 viruses are triple reassortant viruses that contain HA, NA, and PB1 gene segments from human-lineage influenza viruses, PA and PB2 gene segments from avian-lineage influenza viruses, and M, NS, and NP gene segments from classical swine-lineage influenza viruses (Zhou et al., 1999; Karasin et al., 2000; Webby and Webster, 2001; Richt et al., 2003). In addition, avian-origin H3 influenza virus contributes to canine influenza in South Korea and China (Song et al., 2008; Li et al., 2010). These data suggest that H3 AIV obtained the ability for inter-species transmission gradually and that it now poses a threat to mammals. Therefore, it is important to enhance surveillance for H3 AIV. Conventional diagnostic methods for AIV involved isolating the virus from embryonated eggs or the hemagglutination test, both of which are time-consuming and laborious processes. Unlike conventional methods, RT-PCR is a rapid and highly sensitive assay, and it is recommended for the diagnosis of AIVs. RT-PCRs to amplify H5, H6, H7, H9, and H11 AIVs have been reported previously (Das and Suarez, 2007; Ben Shabat et al., 2010; Monne et al., 2008). In addition, a multiplex RT-PCR was established to identify subtype H3 human influenza virus (Suwannakarn et al., 2008; Shisong et al., 2011); however, it was not suitable for the detection of H3 AIV. To date, only conventional RT-PCR or reverse transcription loopmediated isothermal amplification (RT-LAMP) assays have been

Q. Teng et al. / Journal of Virological Methods 217 (2015) 64–69 Table 1 The primers and probes used in H3-MGB RT-PCR.

65

2.4. Preparation of T-H3HA plasmid

used to detect H3 AIV (Peng et al., 2011; Wu et al., 2013), but they exhibit low sensitivity. Recently, Elizalde et al. (2014) developed an H3-specific RT-PCR to detect viruses isolated from the European Union. However, this assay could not be used to detect the H3 AIVs circulating in China because of sequence mismatches between the H3 probe and HAs. The aim of the current study was to develop and evaluate a TaqMan minor groove binder (MGB) RT-PCR-based assay to screen for H3 AIVs in China.

The HA fragment of SH68 H3N2 was amplified using the primers H3HA-1F and H3HA-1319R (Table 1) in a 50-␮L reaction mixture containing 0.5 ␮L pfx (Invitrogen, Shanghai, China), 5 ␮L 10× buffer, 1.5 ␮L upstream primer (10 ␮M), 1.5 ␮L downstream primer (10 ␮M), 1 ␮L MgSO4 , 1.5 ␮L dNTP (10 ␮M), 2 ␮L cDNA, and 37 ␮L DEPC-treated water. The PCR cycling conditions were as follows: 2 min at 94 ◦ C, 40 cycles of 15 s at 95 ◦ C, 30 s at 53 ◦ C, and 2 min at 68 ◦ C, followed by 10 min at 68 ◦ C. The PCR product was purified using a DNA Gel Extraction Kit (Axygen, Hangzhou, China) and then ligated into pMD19-T vector in a 10-␮L reaction mixture containing 1 ␮L PCR purification product, 1 ␮L pMD19-T vector, 5 ␮L Solution I, 3 ␮L DEPC-treated water (TaKaRa). The recombinant plasmid was designated T-H3HA, and was transformed into JM109 competent cells. The cells were then cultured, and the expressed vector was extracted using a plasmid extraction kit (Axygen). The concentration of T-H3HA plasmid was determined using an EPOCH instrument (BioTek, Beijing, China).

2. Materials and methods

2.5. Real-time PCR

2.1. Virus strains

RT-PCR was performed in a 25-␮L reaction mixture containing 12.5 ␮L premix Ex Taq (TaKaRa), 1 ␮L H3AIV-F primer (10 ␮M), 1 ␮L H3AIV-R primer (10 ␮M), 0.5 ␮L H3AIV-MGB (10 ␮M) probe (Table 1), 1 ␮L template, and 9 ␮L DEPC-treated water. Reactions were performed on a 7500 Real-time PCR instrument (Applied Biosystems) using the following cycling conditions: 2 min at 95 ◦ C, and 40 cycles of 5 s at 95 ◦ C and 34 s at 60 ◦ C. Sterile DEPC-treated water was used as a negative control. The data were analyzed using 7500 System SDS Software Version 1.2 (Applied Biosystems).

Name

Sequence 5 –3

H3AIV-F H3AIV-R H3-MGB H3HA-1F H3HA-1319R

GCAACAGGAATGCGGAATG GCCTGAAGCCATACCAACCA NED-TATTCGGTGCAATAGCAP* AGCAAAAGCAGGGG TTGTAAGACCAGAGATCTA

*P represents TAMRA-MGB.

The H3N2 subtype of AIV was isolated and prepared using 9-day-old specific-pathogen-free (SPF) chicken embryos according to the methods described previously (World Organization for Animal Health, 2012). The A/duck/Shanghai/68/2009 (H3N2), renamed SH68 H3N2, A/duck/Shanghai/32/2009(H4N2), A/duck/Shanghai/30/2009(H5N1), A/goose/Guangdong/1126/2009 (H6N1), A/duck/Zhejiang/690/2009(H7N3), A/duck/Zhejiang/606/ 2009(H9N2), A/duck/Shanghai/601/2009(H10N8), and A/duck/ Jiangsu/884/2009(H11N9) AIV strains, as well as Newcastle disease virus (NDV) chicken/China/977/2009 and duck tembusu virus (DTMUV) FX2010 strains, were preserved at −80 ◦ C. 2.2. Primer and probe design The nucleotide sequences of the HA gene from 49 H3 AIV strains circulating in China were obtained from the GenBank database between 2000 and 2013. Multiple sequences were aligned using Clustal W software (Version 1.83; EBI, Cambridge UK, http://www.ebi.ac.uk/clustalw). H3HA gene-specific primers and probe were selected based on the conserved sequences in the HAs of H3 AIVs, and were designed using primer 5.0 software (Applied Biosystems, Foster City, CA, USA). The specificity of the primers and probe were verified by comparing their sequences to all the sequences in GenBank using BLAST searches (http://www.ncbi.nlm.nih.gov/). The primers and probe used are listed in Table 1. The probe was labeled with NED at the 5 -end and TAMRA MGB at the 3 -end. 2.3. RNA extraction and cDNA synthesis Total RNA was extracted from the allantoic fluids using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Next, cDNA was synthesized from the RNA using reverse transcriptase AMV (TaKaRa, Dalian, China) in a final volume of 20 ␮L containing the following: 5 ␮L RNA, 4 ␮L 5× RT buffer, 4 ␮L dNTPs (2.5 mM), 2 ␮L 10 ␮M specific primer (5 AGCAAAAGCAGG-3 ), 1 ␮L AMV reverse transcriptase, 0.5 ␮L RNase inhibitor (TaKaRa, Dalian, China), and 3.5 ␮L diethylpyrocarbonate (DEPC)-treated water. The reaction was incubated at 42 ◦ C for 1 h followed by incubation at 70 ◦ C for 15 min.

2.6. Specificity test The specificity of the H3-MGB RT-PCR was evaluated using H3, H4, H5, H6, H7, H9, H10, and H11 AIVs as well as NDV, DTMUV, SH68 RNA, and DEPC-treated water. 2.7. Standard curve and sensitivity test Ten-fold serial dilutions of T-H3HA were used as the templates for H3-MGB RT-PCRs to determine the standard curve and DNA detection limit of the novel assay. All samples were tested in triplicate. In addition, RNA was extracted from SH68 H3N2 (107.5 EID50 for eggs) and then transcribed into first-strand cDNA. The cDNA was diluted serially 10-fold by using DEPC-treated water and analyzed using RT-PCR. All serial dilutions of DNA and cDNA were also subjected to conventional RT-PCR using the primers H3AIV-F and H3AIV-R to compare the sensitivity of the assays. Conventional RTPCR was performed in a 25-␮L reaction mixture containing 12.5 ␮L PCR mix (Dongsheng, Beijing, China), 1 ␮L H3AIV-F primer (10 ␮M), 1 ␮L H3AIV-R primer (10 ␮M; Table 1), 1 ␮L template, and 9.5 ␮L DEPC-treated water. The PCR cycling conditions were as follows: 2 min at 95 ◦ C, 40 cycles of 30 s at 95 ◦ C, 30 s at 60 ◦ C, and 1 min at 72 ◦ C, followed by 10 min at 72 ◦ C. 2.8. Reproducibility test Inter-assay and intra-assay reproducibility tests were performed using different concentrations of T-H3HA plasmid (1 × 107 , 1 × 106 , and 1 × 105 copies). Inter-assay variation was assessed by comparing three samples of each concentration in a single round of RT-PCRs. Intra-assay variation was assessed by repeating three independent RT-PCRs.

66

Q. Teng et al. / Journal of Virological Methods 217 (2015) 64–69

Table 2 DNA amplification sensitivity of the H3-MGB RT-PCR and conventional RT-PCR.

Table 3 Virus sensitivities of H3-MGB RT-PCR and conventional RT-PCR.

Number of DNA copies

H3-MGB RT-PCR Ct value (mean ± SD)a

Conventional RT-PCRb

cDNA dilutions

H3-MGB RT-PCR Ct value (mean ± SD)

Conventional RT-PCR

1.0 × 109 1.0 × 108 1.0 × 107 1.0 × 106 1.0 × 105 1.0 × 104 1.0 × 103 1.0 × 102 1.0 × 101 Negative control

12.82 ± 0.29a 15.74 ± 0.26 18.57 ± 0.08 21.39 ± 0.10 24.11 ± 0.05 27.90 ± 0.38 31.28 ± 0.15 34.51 ± 0.36 36.94 ± 0.36 Undetermined

+++b +++ +++ ++ ++ + – – – –

Undiluted 10−1 10−2 10−3 10−4 10−5 Negative control

23.74 ± 0.07a 26.90 ± 0.12 30.40 ± 0.07 33.43 ± 0.09 36.15 ± 0.81 Undetermined Undetermined

++b + – – – – –

Serial 10-fold dilutions from 109 to 101 copies of T-H3HA were used as templates to determine the standard curve of H3-MGB RT-PCR and for conventional RT-PCR. Each dilution was performed in triplicate for H3-MGB RT-PCR. The products of conventional RT-PCR were separated using 1% agarose gel electrophoresis. a Ct ≤ 37 was considered positive (+). b +++ represents a very bright band, ++ represents a moderately bright band, and + represents a weak band; – represents no band.

2.9. Detecting samples from experimentally or naturally infected ducks Three-week-old SPF ducks (n = 3) were inoculated intranasally with 106 EID50 SH68 H3N2 in a volume of 200 ␮L. Oropharyngeal and cloacal swabs were then collected 3 days after the inoculation. Then, the ducks were euthanized, and lung tissues were collected and homogenized in 1 mL cold phosphate-buffered saline per gram. Solid debris was removed by centrifugation at 12,000 × g for 5 min. The swabs were soaked in 1 mL cold phosphate-buffered saline and then centrifuged at 12,000 × g for 5 min. Supernatants were collected, and the viral RNA was extracted and transcribed into cDNA as described in Section 2.3. The cDNAs were then used in the conventional RT-PCR and H3-MGB RT-PCR assays described in Sections 2.7 and 2.5, respectively. All animals were raised in separate isolators. Lungs and swabs from uninfected SPF ducks (n = 3) were used as negative controls. 3. Results 3.1. Standard curve for H3-MGB RT-PCR Ten-fold serial dilutions of the standard plasmid were used to construct a standard curve that was linear between 109 and 101 copies of DNA (Fig. 1). The equation used to generate the standard curve was y = −3.085x + 40.24. The linear regression coefficient (R2 ) was 0.997, and the amplification efficiency (E) was 1.11. 3.2. Specificity of H3-MGB RT-PCR The specificity of the H3-MGB RT-PCR was evaluated by testing H3, H4, H6, H7, H9, H10, and H11 AIVs, as well as NDV and DTMUV; SH68 RNA and DEPC-water were used as negative controls. Strong fluorescence signals were obtained from reactions containing H3 AIV, whereas the signals from the remaining samples and negative controls were below baseline detection levels (Fig. 2). Therefore, only H3 AIVs were detected using H3-MGB RT-PCR. 3.3. Detection limits of H3-MGB RT-PCR 101

Total RNA was extracted from SH68 virus, and was transcribed into the first strand of cDNA. Serial 10-fold dilutions of cDNA were used as the templates for H3-MGB RT-PCR and conventional RT-PCR. Each dilution was performed in triplicate in the H3-MGB RT-PCR. a Ct ≤ 37 was considered positive (+). b ++ represents a moderately bright band, + represents a weak band, and – represents no band.

detection limit was 10−4 dilutions of cDNA (Table 3), whereas that of the conventional RT-PCR was 10−1 dilutions of cDNA. When Ct ≤ 37, there was a linear relationship between the amount of template and the Ct value. 3.4. Reproducibility of the H3-MGB RT-PCR The inter- and intra-assay reproducibility of the novel H3-MGB RT-PCR assay was evaluated by testing three different dilutions of standard plasmid (from 105 to 107 copies). The results of an intraassay variability test revealed that the coefficients of variation were