Transboundary and Emerging Diseases
ORIGINAL ARTICLE
Development of a Real-Time PCR Assay for Detection and Quantification of Anaplasma ovis Infection Q. Chi1,2, Z. Liu1, Y. Li1, J. Yang1, Z. Chen1, C. Yue2, J. Luo1 and H. Yin1 1
2
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Grazing Animal Diseases MOA, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China College of Veterinary Medicine, Xinjiang Agricultural University, Urumqi, China
Keywords: Anaplasma ovis; real-time PCR; small ruminant Correspondence: H. Yin. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu 730046, China. Tel.: +86 931 8342515; Fax: +86 931 8342515; E-mail: [email protected] J. Luo. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu 730046, China. Tel.: +86 931 8342551; Fax: +86 931 8340977; E-mail: [email protected] Received for publication November 15, 2012
Summary Anaplasma ovis is a tick-borne intra-erythrocytic rickettsial pathogen of small ruminants. Real-time PCR possesses merits of rapidity, accuracy, reliability, automation and ease of standardization, but has not been used for detection of A. ovis, to the best of our knowledge. In this study, a real-time PCR assay was developed for detection and quantification of A. ovis. Species-specific primers and TaqMan probe were designed based on the gltA gene. No cross-reactions were observed with Anaplasma marginale, Anaplasma bovis, Anaplasma phagocytophilum, Borrelia burgdorferi s. l., Chlamydia psittaci, Mycoplasma mycoides, Theileria luwenshuni and Babesia sp. Xinjiang isolate. Analytic sensitivity results revealed that realtime PCR could detect as few as 10 copies of the gltA gene. The performance of real-time PCR was assessed by testing 254 blood samples from goats and comparing with the results from conventional PCR. This demonstrated that the real-time PCR assay was significantly more sensitive than conventional PCR. Our results indicated that real-time PCR is a useful approach for detecting A. ovis infections and has potential as an alternative tool for ecological and epidemiological surveillance of ovine anaplasmosis.
doi:10.1111/tbed.12139
Introduction Anaplasma ovis is a tick-borne intra-erythrocytic rickettsial pathogen of sheep, goats and wild ruminants (Krier and Ristic, 1963; de la Fuente et al., 2006, 2007). It induces acute anaemia in sheep and goats following invasion and replication within erythrocytes (Splitter et al., 1956). This pathogen is classified in the genus Anaplasma (Rickettsiales: Anaplasmataceae), along with Anaplasma marginale, Anaplasma phagocytophilum and Anaplasma bovis that infect ruminants and Anaplasma platys that infects dogs (Dumler and Brouqui, 2004; de la Fuente et al., 2007; Aubry and Geale, 2011). Anaplasma ovis is transmitted by Rhipicephalus bursa in the Old World and by Dermacentor andersoni in the New World (Friedhoff, 1997). It has been demonstrated that A. ovis is widely distributed in China (Lu et al., 1997; Zhou et al., 2010; Liu et al., 2012).
To date, the most commonly used method for diagnosis of A. ovis is microscopic examination of Giemsa-stained blood smears taken during the acute phase of the disease, but it is inefficient for detection of presymptomatic and carrier animals. Serologically, a competitive inhibition ELISA based on a major surface protein (MSP 5) B-cell epitope is used to detect goats infected with A. ovis (Ndung’u et al., 1995). However, the test cannot differentiate A. ovis from A. marginale infection, because they both express the MSP5 antigen (Visser et al., 1992). Regarding nucleotide detection methods, a DNA probe-based method was established and used to identify infected goats in Kenya; however, the limited sensitivity of the probe may prohibit detection of persistently infected carrier goats with lowlevel rickettsemia (Shompole et al., 1989). In addition, a sensitive and specific loop-mediated isothermal amplification for detection of A. ovis has been recently described
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
119
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
(Ma et al., 2011), although this method still needs to be validated by testing large-scale samples in the field. The present study describes a quantitative real-time PCR with a TaqMan fluorogenic detection system for detection of A. ovis. Quantification of A. ovis in unknown samples was performed by comparison of the fluorescence signals of the sample with those of a standard curve. Blood specimens collected from goats in Southern China were used to evaluate its performance. Materials and Methods Strains, field blood specimens and DNA extraction Twelve A. ovis isolates were used in this study: GN27, Yuzhong and Yongjing isolates from Gansu; Dangxiong from Dermacentor niveus in Tibet; Haibei from Qinghai; H15 from Henan; WG7 and YD4 from Hubei; XT3 and YX10 from Zhejang; and G45 and G54 from Guizhou. Field blood specimens were collected from 254 goats in four regions of Southern China (Henan, Zhejiang, Hubei and Guizhou; Fig. 1). DNA was extracted from 300 ll of blood using a Gentra Puregene Blood Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The DNA of each sample was eluted in 100 ll DNA hydration solution and stored at 20°C. PCR application of Anaplasma ovis gltA gene Specific primers were AOgltA-F, ACAGAGGGTATGATGTCGC and AOgltA-R, GCATTCTGCTCGTGGTCT, which generated a product of 481 bp. The reactions were performed in a final volume of 50 ll, containing 20 pmol each primer, 5 ll PCR buffer, 4 ll dNTPs, 0.25 ll Taq (5 U/ml; TaKaRa, Dalian, China) and 1 ll DNA sample. Reactions
were conducted in an automated DNA C1000 thermal cycler (Bio-Rad, Beijing, China). The cycling conditions were denaturation for 4 min at 94°C, and then 35 cycles at 94°C for 30 s, 53°C for 30 s and 72°C for 30 s, followed by a final extension for 5 min at 72°C. The PCR products were subjected to electrophoresis on 1% agarose gels containing 0.5 lg/ml ethidium bromide and visualized under UV light. Positive PCR products from primers AOgltA-F/AOgltA-R were cloned into pGEM-T vector (Promega, Madison, WI, USA) and then sequenced by Sangon Biotech Company (Shanghai, China). Probe and primers Primers (sense primer: 5′-AGGTACCGGGTATCGTTGCA-3′; anti-sense primer: 5′-AGGTTTGGATCTGCCTCTGTGA-3′) and probe [TaqMan probe: 5′-(FAM)ACATTTACAGGCACACCTCTGGCATGC(BHQ1)-3′] were designed on the basis of a conserved region of A. ovis gltA gene using the Primer Express software (version 3.0; Applied Biosystems, Foster City, CA, USA), which were then synthesized by Sangon Biotech Company. The conserved region of the A. ovis gltA gene was identified through alignments of nucleotide sequences obtained in this study and the available sequences from GenBank (JX559680, JX559681, JX559682, JX559683, JX559684, JX559685, JX559686, JX559687, JX559688, JX559689, JX559690 and JX559691 for A. ovis; AF304139 and AF304140 for A. marginale; AF304141 for Anaplasma centrale; AY464137, AY464135, AY464133, AY464138, AY464136, AY464134, AY464132, AF304138 and AF304137 for A. phagocytophilum; AY077620, AY530807, DQ525686, EU516387, DQ525688, DQ525687 and AB058782 for A. platys) using the ClustalW method in the MegAlign software (DNAStar, Madison, WI, USA). Plasmid construction
Fig. 1. Map of the sampling sites.
120
For construction of a plasmid containing A. ovis gltA gene, the PCR product of 481 bp was cloned into pGEM-T vector (Promega) and then propagated in competent Escherichia coli JM109 cells (TaKaRa). Plasmid DNA was purified from transformed cells using EasyPure Plasmid MiniPrep Kit (TransGen Biotech, Beijing, China) and quantified by NanoDrop 2000 Spectrophotometer (ThermoScientific, Beijing, China). To generate standard curves for quantitative determinations and to assess the amplification efficiency, 10-fold dilutions of the plasmid by Easy Dilution Solution (TaKaRa) were made, representing 100–107 copies/ll of DNA template. Aliquots of each dilution were frozen at 20°C until use. To minimize the potential for contamination, the A. ovis standard plasmid DNA was stored in a separate freezer. © 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
Real-time PCR The real-time PCR assays were performed using Premix Ex Taq (TaKaRa); each 25-ll reaction mixture contained 10 pmol of each forward and reverse primer, 5 pmol of probe, 0.5 ll ROX Reference Dye II, 12.5 ll Premix Ex Taq, 8.0 ll distilled water and 2.0 ll sample DNA. The Agilent Stratagene Mx 3005P QPCR System (Agilent Technologies, Beijing, China) was used for DNA amplification. The thermocycling conditions consisted of 30 s at 95°C for activating the Ex Taq HS DNA Polymerase, and 40 cycles of 5 s at 95°C, 15 s at 58°C and 20 s at 72°C. The real-time PCR was carried out in duplicate for each unknown, and serial 10-fold dilutions of standard plasmid and a no-template control were included in each run. The results of realtime PCR were analysed by MxPro QPCR software (Agilent Technologies). Evaluation of specificity, sensitivity and reproducibility To exclude cross-reaction with other closely related pathogens of ruminants, the specificity of the assay was evaluated by testing positive control DNA from infected blood samples of A. marginale, A. bovis, A. phagocytophilum, Borrelia burgdorferi s. l., Chlamydia psittaci, Mycoplasma mycoides, Theileria luwenshuni, Babesia sp. Xinjiang isolate and negative control DNA from uninfected goats. To evaluate the detection limits of the real-time PCR, 10-fold dilutions of the standard plasmid DNA were used to test the analytic sensitivity in the range of 100–107 copies. Reproducibility of the assay was evaluated by testing 10-fold dilutions of the standard plasmid DNA from 101 to 107 copies, then evaluated reproducibility by coefficient of variation (CV) of cycle threshold values, as previously described (Xu et al., 2011). Conventional PCR for Anaplasma ovis Two hundred and fifty-four blood samples were detected using real-time PCR and compared with a conventional PCR using conditions described by de la Fuente et al. (2007), which target the A. ovis msp4 gene using primers MSP43: 5′CCGGATCCTTAGCTGAACAGGAATCTTGC-3′ and MSP45: 5′-GGGAGCTCCTATGAATTACAGAGAATTGTTTAC-3′. The PCR products were subjected to electrophoresis on 1% agarose gels containing 0.5 lg/ml ethidium bromide and visualized under UV light. Results Sensitivity and specificity of real-time PCR The optimized real-time PCR was evaluated for the RSq value and Eff value. When the real-time PCR was used to amplify 10-fold serial dilutions (101–107 copies) of the
standard plasmid, RSq and Eff values were 0.995 and 1.10, respectively (Fig. 2). The lower limit of detection was found to be 10 copies. Neither negative control nor DNA templates from other pathogens produced detectable fluorescence signals (Fig. 3), indicating that the real-time PCR was specific to A. ovis. Reproducibility of real-time PCR The assay was tested for both intra- and inter-assay reproducibility. For intra-assay reproducibility, 10-fold dilutions of the standard plasmid DNA from 101 to 107 copies were tested four times in one run. Coefficient of variation values were found to range from 0.26% to 0.97% (Table 1). For inter-assay reproducibility, 10-fold dilutions of the standard plasmid DNA (101–107) were tested separately on 3 days, CV values ranged from 0.42% to 1.5% (Table 2). Comparison of real-time and conventional PCR by testing field samples Real-time PCR showed that 65 of 254 (25.6%) blood samples were positive for A. ovis, in which the DNA titres ranged from 3.36 9 104 to 3.32 9 109/ml infected blood. In comparison, the positive rate using conventional PCR was 9.06% (23/254). The 23 positive samples were also positive for real-time PCR. The prevalence with the real-time PCR was significantly higher than with the conventional PCR (v2 = 24.25, P < 0.01). In the 42 real-time PCR positive samples that were negative by conventional PCR, the DNA titres ranged from 3.36 9 104 to 1.06 9 106 A. ovis/ml infected blood. In the 23 samples that were positive by both assays, DNA titres ranged from 5.82 9 106 to 3.32 9 109 A. ovis/ml infected blood (Table 3). These results indicated the high sensitivity of real-time PCR compared with conventional PCR. Discussion Disease prevention strategies are centred on reliable diagnostic tests for accurately and precisely identifying infection. The real-time PCR method that combines PCR, chemistry and fluorescent probe detection of the amplified products has greatly enhanced the ability to determine the infection status of a pathogen (Reinbold et al., 2010). The nucleic acid amplification and detection steps are performed in the same closed vessel; therefore, the risk of release of amplified nucleic acids into the environment, and contamination of subsequent analyses, is negligible compared with conventional PCR methods. Real-time PCR instrumentation requires considerably less hands-on time, and testing is much simpler to perform than for conventional PCR methods. Additionally, accelerated PCR thermocycling and
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
121
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
(a)
(b)
Fig. 2. Establishment of the standard curve for quantification of Anaplasma ovis. (a) Amplification plots of real-time PCR for detecting standard plasmids containing the gltA gene; the copy number of standard plasmid ranged from 107 to 101 (left to right). (b) Corresponding standard curve. It showed DNA amplification plots with cycle threshold (CT) values plotted against the logarithm of the input copy number. The standard curve showed a slope of 3.0 and an RSq value of 0.995.
detection of amplified products permits the provision of a test result much sooner for real-time than for conventional PCR. The combination of excellent sensitivity and specificity, low contamination risk, and ease and speed of performance, has made real-time PCR an appealing alterna122
tive to conventional immunoassay-based testing methods used in clinical microbiology for diagnosing many infectious diseases (Heid et al., 1996; Espy et al., 2006). In the present study, a real-time PCR assay was developed for detection and quantification of A. ovis in blood of naturally
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
Fig. 3. Specificity of the real-time PCR.
Table 1. Intra-assay reproducibility of real-time PCR for detecting Anaplasma ovis standard plasmid Copies/ll
101
102
103
104
105
106
Ct1 Ct2 Ct3 Ct4 CV (%)
37.16 37.85 37.65 38.01 0.98
34.98 34.74 34.72 34.23 0.91
31.19 31.24 31.04 30.99 0.38
27.27 27.94 27.84 27.8 0.26
24.72 24.37 24.24 24.38 0.84
20.88 21.04 21.16 20.8 0.77
Table 3. Comparative evolution of real-time and conventional PCR methods for detection of field samples Conventional PCR qPCR
Positive
Negative
Total
Positive Negative Total
23 0 23 (9.06%)
42 189 231
65 (25.6%) 189 254
CV, coefficient of variation. Table 2. Inter-assay reproducibility of real-time PCR for detecting Anaplasma ovis standard plasmid Copies/ll
101
102
103
104
105
106
Ct1 Ct2 Ct3 CV (%)
37.79 37.93 37.1 1.2
34.59 34.28 34.35 0.47
30.97 31.46 31.11 0.81
28.24 27.87 27.94 0.7
24.71 25.33 24.54 1.7
21.61 21.16 21.27 1.1
CV, coefficient of variation.
infected sheep and goats. To the best of our knowledge, this is the first study to describe a real-time PCR assay for the detection of A. ovis. The selection of a suitable target gene for the accurate determination of animal infection status is crucial for the
development of real-time PCR for pathogens. In the present study, the real-time assay primers were designed on the basis of the citrate synthase gene (gltA). After alignment of the gltA sequences from 12 A. ovis isolates, we confirmed 99% sequence identity. Using such a conserved gene as a target for real-time PCR is critical. This ensured the specificity of the diagnostic method. The assay was highly sensitive and was able to detect as few as 10 copies/ll standard plasmid DNA, and it was presumed to be able to detect 3.33 9 106 A. ovis in a millilitre of infected blood. When compared with conventional PCR, the detection rates (25.6% versus 9.06%, v2 = 24.25, P < 0.01) significantly differed from those with the field samples. Real-time PCR detected 42 positive samples with bacteraemia ranging from 3.36 9 104 to 1.06 9 106, and these samples were negative with conventional PCR, indi-
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
123
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
cating the high sensitivity of the real-time PCR compared with the conventional PCR. Regarding the specificity of the assay, the real-time PCR in our study did not show any cross-reactions with the DNA from closely related organisms, including A. marginale, A. bovis, A. phagocytophilum, B. burgdorferi s. l., C. psittaci, M. mycoides, T. luwenshuni and Babesia sp. Xinjiang isolate, which indicated the high specificity of the real-time PCR. Successful detection of the different A. ovis isolates from a wide range of endemic areas demonstrated the usefulness of the assay for epidemiological and screening studies. The intra-assay and inter-assay CVs were satisfactorily low (0.26–0.97% and 0.42–1.5%, respectively), indicating high reproducibility of the established real-time PCR. In conclusion, we developed a real-time PCR method that was sensitive and specific for the detection of A. ovis. This assay has the potential to be a rapid confirmatory method for detection by regional reference laboratories of A. ovis in disease endemic regions. Acknowledgements This study was financially supported by the 973 Programme (2010CB530206), Key Project of Gansu Province (1002NKDA035), NBCITS. MOA (CARS-38), Specific Fund for Sino-Europe Cooperation, MOST, China, State Key Laboratory of Veterinary Etiological Biology Project (SKLVEB2008ZZKT019); The research was also facilitated by EPIZONE (FOOD-CT-2006-016236) of the European Commission, Brussels, Belgium. Conflicts of interest The authors declare no conflicts of interest in relation to this work. References Aubry, P., and D. W. Geale, 2011: A review of bovine anaplasmosis. Transbound. Emerg. Dis. 58, 1–30. Dumler, J. S., and P. Brouqui, 2004: Molecular diagnosis of human granulocytic anaplasmosis. Expert Rev. Mol. Diagn. 4, 559–569. Espy, M. J., J. R. Uhl, L. M. Sloan, S. P. Buckwalter, M. F. Jones, E. A. Vetter, J. D. C. Yao, N. L. Wengenack, J. E. Rosenblatt, F. R. Cockerill, and T. F. Smith, 2006: Real-time PCR in clinical microbiology: applications for a routine laboratory testing. Clin. Microbiol. Rev. 19, 165–256. Friedhoff, K. T., 1997: Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia 39, 99–109.
124
de la Fuente, J., M. W. Atkinson, J. T. Hogg, D. S. Miller, V. Naranjo, C. Almazan, N. Anderson, and K. M. Kocan, 2006: Genetic characterization of Anaplasma ovis strains from bighorn sheep in Montana. J. Wildl. Dis. 42, 381–385. de la Fuente, J., M. W. Atkinson, V. Naranjo, I. G. Fernandez de Mera, A. J. Mangold, K. A. Keating, and K. M. Kocan, 2007: Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet. Microbiol. 119, 375–381. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams, 1996: Real time quantitative PCR. Genome Res. 6, 986–994. Krier, J. P., and M. Ristic, 1963: Anaplasmosis. VII. Experimental Anaplasma ovis infection in white-tailed deer (Dama virginiana). Am. J. Vet. Res. 24, 567–572. Liu, Z., M. Ma, Z. Wang, J. Wang, Y. Peng, Y. Li, G. Guan, J. Luo, and H. Yin, 2012: Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Appl. Environ. Microbiol. 78, 464–470. Lu, W. S., W. X. Lu, Q. C. Zhang, F. Yu, H. F. Dou, and H. Yin, 1997: Ovine anaplasmosis in northwest China. Trop. Anim. Health Prod. 29, 16s–18s. Ma, M., Z. Liu, M. Sun, J. Yang, G. Guan, Y. Li, J. Luo, and H. Yin, 2011: Development and evaluation of a loop-mediated isothermal amplification method for rapid detection of Anaplasma ovis. J. Clin. Microbiol. 49, 2143–2146. Ndung’u, L. W., C. Aguirre, F. R. Rurangirwa, T. F. McElwain, T. C. McGuire, D. P. Knowles, and G. H. Palmer, 1995: Detection of Anaplasma ovis infection in goats by major surface protein 5 competitive inhibition enzyme-linked immunosorbent assay. J. Clin. Microbiol. 33, 675–679. Reinbold, J. B., J. F. Coetzee, K. R. Sirigireddy, and R. R. Ganta, 2010: Detection of Anaplasma marginale and A. phagocytophilum in bovine peripheral blood samples by duplex real-time reverse transcriptase PCR assay. J. Clin. Microbiol. 48, 2424– 2432. Shompole, S., S. D. Waghela, F. R. Rurangirwa, and T. C. McGuire, 1989: Cloned DNA probes identify Anaplasma ovis in goats and reveal a high prevalence of infection. J. Clin. Microbiol. 27, 2730–2735. Splitter, E. J., H. D. Anthony, and M. J. Twiehaus, 1956: Anaplasma ovis in the United States; experimental studies with sheep and goats. Am. J. Vet. Res. 17, 487–491. Visser, E. S., T. C. McGuire, G. H. Palmer, W. C. Davis, V. Shkap, E. Pipano, and D. P. Jr Knowles, 1992: The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species. Infect. Immun. 60, 5139–5144. Xu, Z. Q., W. X. Cheng, B. W. Li, J. Li, B. Lan, and Z. J. Duan, 2011: Development of a real-time PCR assay for detecting and quantifying human bocavirus 2. J. Clin. Microbiol. 49, 1537–1541. Zhou, Z., K. Nie, C. Tang, Z. Wang, R. Zhou, S. Hu, and Z. Zhang, 2010: Phylogenetic analysis of the genus Anaplasma in southwestern China based on 16S rRNA sequence. Res. Vet. Sci. 89, 262–265.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
ORIGINAL ARTICLE
Development of a Real-Time PCR Assay for Detection and Quantification of Anaplasma ovis Infection Q. Chi1,2, Z. Liu1, Y. Li1, J. Yang1, Z. Chen1, C. Yue2, J. Luo1 and H. Yin1 1
2
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Grazing Animal Diseases MOA, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China College of Veterinary Medicine, Xinjiang Agricultural University, Urumqi, China
Keywords: Anaplasma ovis; real-time PCR; small ruminant Correspondence: H. Yin. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu 730046, China. Tel.: +86 931 8342515; Fax: +86 931 8342515; E-mail: [email protected] J. Luo. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu 730046, China. Tel.: +86 931 8342551; Fax: +86 931 8340977; E-mail: [email protected] Received for publication November 15, 2012
Summary Anaplasma ovis is a tick-borne intra-erythrocytic rickettsial pathogen of small ruminants. Real-time PCR possesses merits of rapidity, accuracy, reliability, automation and ease of standardization, but has not been used for detection of A. ovis, to the best of our knowledge. In this study, a real-time PCR assay was developed for detection and quantification of A. ovis. Species-specific primers and TaqMan probe were designed based on the gltA gene. No cross-reactions were observed with Anaplasma marginale, Anaplasma bovis, Anaplasma phagocytophilum, Borrelia burgdorferi s. l., Chlamydia psittaci, Mycoplasma mycoides, Theileria luwenshuni and Babesia sp. Xinjiang isolate. Analytic sensitivity results revealed that realtime PCR could detect as few as 10 copies of the gltA gene. The performance of real-time PCR was assessed by testing 254 blood samples from goats and comparing with the results from conventional PCR. This demonstrated that the real-time PCR assay was significantly more sensitive than conventional PCR. Our results indicated that real-time PCR is a useful approach for detecting A. ovis infections and has potential as an alternative tool for ecological and epidemiological surveillance of ovine anaplasmosis.
doi:10.1111/tbed.12139
Introduction Anaplasma ovis is a tick-borne intra-erythrocytic rickettsial pathogen of sheep, goats and wild ruminants (Krier and Ristic, 1963; de la Fuente et al., 2006, 2007). It induces acute anaemia in sheep and goats following invasion and replication within erythrocytes (Splitter et al., 1956). This pathogen is classified in the genus Anaplasma (Rickettsiales: Anaplasmataceae), along with Anaplasma marginale, Anaplasma phagocytophilum and Anaplasma bovis that infect ruminants and Anaplasma platys that infects dogs (Dumler and Brouqui, 2004; de la Fuente et al., 2007; Aubry and Geale, 2011). Anaplasma ovis is transmitted by Rhipicephalus bursa in the Old World and by Dermacentor andersoni in the New World (Friedhoff, 1997). It has been demonstrated that A. ovis is widely distributed in China (Lu et al., 1997; Zhou et al., 2010; Liu et al., 2012).
To date, the most commonly used method for diagnosis of A. ovis is microscopic examination of Giemsa-stained blood smears taken during the acute phase of the disease, but it is inefficient for detection of presymptomatic and carrier animals. Serologically, a competitive inhibition ELISA based on a major surface protein (MSP 5) B-cell epitope is used to detect goats infected with A. ovis (Ndung’u et al., 1995). However, the test cannot differentiate A. ovis from A. marginale infection, because they both express the MSP5 antigen (Visser et al., 1992). Regarding nucleotide detection methods, a DNA probe-based method was established and used to identify infected goats in Kenya; however, the limited sensitivity of the probe may prohibit detection of persistently infected carrier goats with lowlevel rickettsemia (Shompole et al., 1989). In addition, a sensitive and specific loop-mediated isothermal amplification for detection of A. ovis has been recently described
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
119
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
(Ma et al., 2011), although this method still needs to be validated by testing large-scale samples in the field. The present study describes a quantitative real-time PCR with a TaqMan fluorogenic detection system for detection of A. ovis. Quantification of A. ovis in unknown samples was performed by comparison of the fluorescence signals of the sample with those of a standard curve. Blood specimens collected from goats in Southern China were used to evaluate its performance. Materials and Methods Strains, field blood specimens and DNA extraction Twelve A. ovis isolates were used in this study: GN27, Yuzhong and Yongjing isolates from Gansu; Dangxiong from Dermacentor niveus in Tibet; Haibei from Qinghai; H15 from Henan; WG7 and YD4 from Hubei; XT3 and YX10 from Zhejang; and G45 and G54 from Guizhou. Field blood specimens were collected from 254 goats in four regions of Southern China (Henan, Zhejiang, Hubei and Guizhou; Fig. 1). DNA was extracted from 300 ll of blood using a Gentra Puregene Blood Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The DNA of each sample was eluted in 100 ll DNA hydration solution and stored at 20°C. PCR application of Anaplasma ovis gltA gene Specific primers were AOgltA-F, ACAGAGGGTATGATGTCGC and AOgltA-R, GCATTCTGCTCGTGGTCT, which generated a product of 481 bp. The reactions were performed in a final volume of 50 ll, containing 20 pmol each primer, 5 ll PCR buffer, 4 ll dNTPs, 0.25 ll Taq (5 U/ml; TaKaRa, Dalian, China) and 1 ll DNA sample. Reactions
were conducted in an automated DNA C1000 thermal cycler (Bio-Rad, Beijing, China). The cycling conditions were denaturation for 4 min at 94°C, and then 35 cycles at 94°C for 30 s, 53°C for 30 s and 72°C for 30 s, followed by a final extension for 5 min at 72°C. The PCR products were subjected to electrophoresis on 1% agarose gels containing 0.5 lg/ml ethidium bromide and visualized under UV light. Positive PCR products from primers AOgltA-F/AOgltA-R were cloned into pGEM-T vector (Promega, Madison, WI, USA) and then sequenced by Sangon Biotech Company (Shanghai, China). Probe and primers Primers (sense primer: 5′-AGGTACCGGGTATCGTTGCA-3′; anti-sense primer: 5′-AGGTTTGGATCTGCCTCTGTGA-3′) and probe [TaqMan probe: 5′-(FAM)ACATTTACAGGCACACCTCTGGCATGC(BHQ1)-3′] were designed on the basis of a conserved region of A. ovis gltA gene using the Primer Express software (version 3.0; Applied Biosystems, Foster City, CA, USA), which were then synthesized by Sangon Biotech Company. The conserved region of the A. ovis gltA gene was identified through alignments of nucleotide sequences obtained in this study and the available sequences from GenBank (JX559680, JX559681, JX559682, JX559683, JX559684, JX559685, JX559686, JX559687, JX559688, JX559689, JX559690 and JX559691 for A. ovis; AF304139 and AF304140 for A. marginale; AF304141 for Anaplasma centrale; AY464137, AY464135, AY464133, AY464138, AY464136, AY464134, AY464132, AF304138 and AF304137 for A. phagocytophilum; AY077620, AY530807, DQ525686, EU516387, DQ525688, DQ525687 and AB058782 for A. platys) using the ClustalW method in the MegAlign software (DNAStar, Madison, WI, USA). Plasmid construction
Fig. 1. Map of the sampling sites.
120
For construction of a plasmid containing A. ovis gltA gene, the PCR product of 481 bp was cloned into pGEM-T vector (Promega) and then propagated in competent Escherichia coli JM109 cells (TaKaRa). Plasmid DNA was purified from transformed cells using EasyPure Plasmid MiniPrep Kit (TransGen Biotech, Beijing, China) and quantified by NanoDrop 2000 Spectrophotometer (ThermoScientific, Beijing, China). To generate standard curves for quantitative determinations and to assess the amplification efficiency, 10-fold dilutions of the plasmid by Easy Dilution Solution (TaKaRa) were made, representing 100–107 copies/ll of DNA template. Aliquots of each dilution were frozen at 20°C until use. To minimize the potential for contamination, the A. ovis standard plasmid DNA was stored in a separate freezer. © 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
Real-time PCR The real-time PCR assays were performed using Premix Ex Taq (TaKaRa); each 25-ll reaction mixture contained 10 pmol of each forward and reverse primer, 5 pmol of probe, 0.5 ll ROX Reference Dye II, 12.5 ll Premix Ex Taq, 8.0 ll distilled water and 2.0 ll sample DNA. The Agilent Stratagene Mx 3005P QPCR System (Agilent Technologies, Beijing, China) was used for DNA amplification. The thermocycling conditions consisted of 30 s at 95°C for activating the Ex Taq HS DNA Polymerase, and 40 cycles of 5 s at 95°C, 15 s at 58°C and 20 s at 72°C. The real-time PCR was carried out in duplicate for each unknown, and serial 10-fold dilutions of standard plasmid and a no-template control were included in each run. The results of realtime PCR were analysed by MxPro QPCR software (Agilent Technologies). Evaluation of specificity, sensitivity and reproducibility To exclude cross-reaction with other closely related pathogens of ruminants, the specificity of the assay was evaluated by testing positive control DNA from infected blood samples of A. marginale, A. bovis, A. phagocytophilum, Borrelia burgdorferi s. l., Chlamydia psittaci, Mycoplasma mycoides, Theileria luwenshuni, Babesia sp. Xinjiang isolate and negative control DNA from uninfected goats. To evaluate the detection limits of the real-time PCR, 10-fold dilutions of the standard plasmid DNA were used to test the analytic sensitivity in the range of 100–107 copies. Reproducibility of the assay was evaluated by testing 10-fold dilutions of the standard plasmid DNA from 101 to 107 copies, then evaluated reproducibility by coefficient of variation (CV) of cycle threshold values, as previously described (Xu et al., 2011). Conventional PCR for Anaplasma ovis Two hundred and fifty-four blood samples were detected using real-time PCR and compared with a conventional PCR using conditions described by de la Fuente et al. (2007), which target the A. ovis msp4 gene using primers MSP43: 5′CCGGATCCTTAGCTGAACAGGAATCTTGC-3′ and MSP45: 5′-GGGAGCTCCTATGAATTACAGAGAATTGTTTAC-3′. The PCR products were subjected to electrophoresis on 1% agarose gels containing 0.5 lg/ml ethidium bromide and visualized under UV light. Results Sensitivity and specificity of real-time PCR The optimized real-time PCR was evaluated for the RSq value and Eff value. When the real-time PCR was used to amplify 10-fold serial dilutions (101–107 copies) of the
standard plasmid, RSq and Eff values were 0.995 and 1.10, respectively (Fig. 2). The lower limit of detection was found to be 10 copies. Neither negative control nor DNA templates from other pathogens produced detectable fluorescence signals (Fig. 3), indicating that the real-time PCR was specific to A. ovis. Reproducibility of real-time PCR The assay was tested for both intra- and inter-assay reproducibility. For intra-assay reproducibility, 10-fold dilutions of the standard plasmid DNA from 101 to 107 copies were tested four times in one run. Coefficient of variation values were found to range from 0.26% to 0.97% (Table 1). For inter-assay reproducibility, 10-fold dilutions of the standard plasmid DNA (101–107) were tested separately on 3 days, CV values ranged from 0.42% to 1.5% (Table 2). Comparison of real-time and conventional PCR by testing field samples Real-time PCR showed that 65 of 254 (25.6%) blood samples were positive for A. ovis, in which the DNA titres ranged from 3.36 9 104 to 3.32 9 109/ml infected blood. In comparison, the positive rate using conventional PCR was 9.06% (23/254). The 23 positive samples were also positive for real-time PCR. The prevalence with the real-time PCR was significantly higher than with the conventional PCR (v2 = 24.25, P < 0.01). In the 42 real-time PCR positive samples that were negative by conventional PCR, the DNA titres ranged from 3.36 9 104 to 1.06 9 106 A. ovis/ml infected blood. In the 23 samples that were positive by both assays, DNA titres ranged from 5.82 9 106 to 3.32 9 109 A. ovis/ml infected blood (Table 3). These results indicated the high sensitivity of real-time PCR compared with conventional PCR. Discussion Disease prevention strategies are centred on reliable diagnostic tests for accurately and precisely identifying infection. The real-time PCR method that combines PCR, chemistry and fluorescent probe detection of the amplified products has greatly enhanced the ability to determine the infection status of a pathogen (Reinbold et al., 2010). The nucleic acid amplification and detection steps are performed in the same closed vessel; therefore, the risk of release of amplified nucleic acids into the environment, and contamination of subsequent analyses, is negligible compared with conventional PCR methods. Real-time PCR instrumentation requires considerably less hands-on time, and testing is much simpler to perform than for conventional PCR methods. Additionally, accelerated PCR thermocycling and
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
121
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
(a)
(b)
Fig. 2. Establishment of the standard curve for quantification of Anaplasma ovis. (a) Amplification plots of real-time PCR for detecting standard plasmids containing the gltA gene; the copy number of standard plasmid ranged from 107 to 101 (left to right). (b) Corresponding standard curve. It showed DNA amplification plots with cycle threshold (CT) values plotted against the logarithm of the input copy number. The standard curve showed a slope of 3.0 and an RSq value of 0.995.
detection of amplified products permits the provision of a test result much sooner for real-time than for conventional PCR. The combination of excellent sensitivity and specificity, low contamination risk, and ease and speed of performance, has made real-time PCR an appealing alterna122
tive to conventional immunoassay-based testing methods used in clinical microbiology for diagnosing many infectious diseases (Heid et al., 1996; Espy et al., 2006). In the present study, a real-time PCR assay was developed for detection and quantification of A. ovis in blood of naturally
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
Fig. 3. Specificity of the real-time PCR.
Table 1. Intra-assay reproducibility of real-time PCR for detecting Anaplasma ovis standard plasmid Copies/ll
101
102
103
104
105
106
Ct1 Ct2 Ct3 Ct4 CV (%)
37.16 37.85 37.65 38.01 0.98
34.98 34.74 34.72 34.23 0.91
31.19 31.24 31.04 30.99 0.38
27.27 27.94 27.84 27.8 0.26
24.72 24.37 24.24 24.38 0.84
20.88 21.04 21.16 20.8 0.77
Table 3. Comparative evolution of real-time and conventional PCR methods for detection of field samples Conventional PCR qPCR
Positive
Negative
Total
Positive Negative Total
23 0 23 (9.06%)
42 189 231
65 (25.6%) 189 254
CV, coefficient of variation. Table 2. Inter-assay reproducibility of real-time PCR for detecting Anaplasma ovis standard plasmid Copies/ll
101
102
103
104
105
106
Ct1 Ct2 Ct3 CV (%)
37.79 37.93 37.1 1.2
34.59 34.28 34.35 0.47
30.97 31.46 31.11 0.81
28.24 27.87 27.94 0.7
24.71 25.33 24.54 1.7
21.61 21.16 21.27 1.1
CV, coefficient of variation.
infected sheep and goats. To the best of our knowledge, this is the first study to describe a real-time PCR assay for the detection of A. ovis. The selection of a suitable target gene for the accurate determination of animal infection status is crucial for the
development of real-time PCR for pathogens. In the present study, the real-time assay primers were designed on the basis of the citrate synthase gene (gltA). After alignment of the gltA sequences from 12 A. ovis isolates, we confirmed 99% sequence identity. Using such a conserved gene as a target for real-time PCR is critical. This ensured the specificity of the diagnostic method. The assay was highly sensitive and was able to detect as few as 10 copies/ll standard plasmid DNA, and it was presumed to be able to detect 3.33 9 106 A. ovis in a millilitre of infected blood. When compared with conventional PCR, the detection rates (25.6% versus 9.06%, v2 = 24.25, P < 0.01) significantly differed from those with the field samples. Real-time PCR detected 42 positive samples with bacteraemia ranging from 3.36 9 104 to 1.06 9 106, and these samples were negative with conventional PCR, indi-
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
123
Real-Time PCR for Detection of A. ovis
Q. Chi et al.
cating the high sensitivity of the real-time PCR compared with the conventional PCR. Regarding the specificity of the assay, the real-time PCR in our study did not show any cross-reactions with the DNA from closely related organisms, including A. marginale, A. bovis, A. phagocytophilum, B. burgdorferi s. l., C. psittaci, M. mycoides, T. luwenshuni and Babesia sp. Xinjiang isolate, which indicated the high specificity of the real-time PCR. Successful detection of the different A. ovis isolates from a wide range of endemic areas demonstrated the usefulness of the assay for epidemiological and screening studies. The intra-assay and inter-assay CVs were satisfactorily low (0.26–0.97% and 0.42–1.5%, respectively), indicating high reproducibility of the established real-time PCR. In conclusion, we developed a real-time PCR method that was sensitive and specific for the detection of A. ovis. This assay has the potential to be a rapid confirmatory method for detection by regional reference laboratories of A. ovis in disease endemic regions. Acknowledgements This study was financially supported by the 973 Programme (2010CB530206), Key Project of Gansu Province (1002NKDA035), NBCITS. MOA (CARS-38), Specific Fund for Sino-Europe Cooperation, MOST, China, State Key Laboratory of Veterinary Etiological Biology Project (SKLVEB2008ZZKT019); The research was also facilitated by EPIZONE (FOOD-CT-2006-016236) of the European Commission, Brussels, Belgium. Conflicts of interest The authors declare no conflicts of interest in relation to this work. References Aubry, P., and D. W. Geale, 2011: A review of bovine anaplasmosis. Transbound. Emerg. Dis. 58, 1–30. Dumler, J. S., and P. Brouqui, 2004: Molecular diagnosis of human granulocytic anaplasmosis. Expert Rev. Mol. Diagn. 4, 559–569. Espy, M. J., J. R. Uhl, L. M. Sloan, S. P. Buckwalter, M. F. Jones, E. A. Vetter, J. D. C. Yao, N. L. Wengenack, J. E. Rosenblatt, F. R. Cockerill, and T. F. Smith, 2006: Real-time PCR in clinical microbiology: applications for a routine laboratory testing. Clin. Microbiol. Rev. 19, 165–256. Friedhoff, K. T., 1997: Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia 39, 99–109.
124
de la Fuente, J., M. W. Atkinson, J. T. Hogg, D. S. Miller, V. Naranjo, C. Almazan, N. Anderson, and K. M. Kocan, 2006: Genetic characterization of Anaplasma ovis strains from bighorn sheep in Montana. J. Wildl. Dis. 42, 381–385. de la Fuente, J., M. W. Atkinson, V. Naranjo, I. G. Fernandez de Mera, A. J. Mangold, K. A. Keating, and K. M. Kocan, 2007: Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet. Microbiol. 119, 375–381. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams, 1996: Real time quantitative PCR. Genome Res. 6, 986–994. Krier, J. P., and M. Ristic, 1963: Anaplasmosis. VII. Experimental Anaplasma ovis infection in white-tailed deer (Dama virginiana). Am. J. Vet. Res. 24, 567–572. Liu, Z., M. Ma, Z. Wang, J. Wang, Y. Peng, Y. Li, G. Guan, J. Luo, and H. Yin, 2012: Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Appl. Environ. Microbiol. 78, 464–470. Lu, W. S., W. X. Lu, Q. C. Zhang, F. Yu, H. F. Dou, and H. Yin, 1997: Ovine anaplasmosis in northwest China. Trop. Anim. Health Prod. 29, 16s–18s. Ma, M., Z. Liu, M. Sun, J. Yang, G. Guan, Y. Li, J. Luo, and H. Yin, 2011: Development and evaluation of a loop-mediated isothermal amplification method for rapid detection of Anaplasma ovis. J. Clin. Microbiol. 49, 2143–2146. Ndung’u, L. W., C. Aguirre, F. R. Rurangirwa, T. F. McElwain, T. C. McGuire, D. P. Knowles, and G. H. Palmer, 1995: Detection of Anaplasma ovis infection in goats by major surface protein 5 competitive inhibition enzyme-linked immunosorbent assay. J. Clin. Microbiol. 33, 675–679. Reinbold, J. B., J. F. Coetzee, K. R. Sirigireddy, and R. R. Ganta, 2010: Detection of Anaplasma marginale and A. phagocytophilum in bovine peripheral blood samples by duplex real-time reverse transcriptase PCR assay. J. Clin. Microbiol. 48, 2424– 2432. Shompole, S., S. D. Waghela, F. R. Rurangirwa, and T. C. McGuire, 1989: Cloned DNA probes identify Anaplasma ovis in goats and reveal a high prevalence of infection. J. Clin. Microbiol. 27, 2730–2735. Splitter, E. J., H. D. Anthony, and M. J. Twiehaus, 1956: Anaplasma ovis in the United States; experimental studies with sheep and goats. Am. J. Vet. Res. 17, 487–491. Visser, E. S., T. C. McGuire, G. H. Palmer, W. C. Davis, V. Shkap, E. Pipano, and D. P. Jr Knowles, 1992: The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species. Infect. Immun. 60, 5139–5144. Xu, Z. Q., W. X. Cheng, B. W. Li, J. Li, B. Lan, and Z. J. Duan, 2011: Development of a real-time PCR assay for detecting and quantifying human bocavirus 2. J. Clin. Microbiol. 49, 1537–1541. Zhou, Z., K. Nie, C. Tang, Z. Wang, R. Zhou, S. Hu, and Z. Zhang, 2010: Phylogenetic analysis of the genus Anaplasma in southwestern China based on 16S rRNA sequence. Res. Vet. Sci. 89, 262–265.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 119–124
