Science of the Total Environment 609 (2017) 854–860
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Development of a phage chemiluminescent enzyme immunoassay with high sensitivity for the determination of imidaclothiz in agricultural and environmental samples Yuan Ding, Xiude Hua ⁎, Nana Sun, Jiachuan Yang, Jiaqi Deng, Haiyan Shi, Minghua Wang College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China State & Local Joint Engineering Research Center of Green Pesticide Invention and Application, Nanjing 210095, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• Imidaclothiz peptidomimetics have been isolated and used to develop PELISA and P-CLEIA. • The P-ELISA and P-CLEIA have higher sensitivity than conventional ELISA. • The P-CLEIA shows high sensitivity and broad linear range compared to the PELISA. • The P-CLEIA is simple and good accuracy is obtained. • The immunoassays are successful applied to authentic samples.
a r t i c l e
i n f o
Article history: Received 16 June 2017 Received in revised form 21 July 2017 Accepted 21 July 2017 Available online 7 August 2017 Editor: Jay Gan Keywords: Imidaclothiz Phage enzyme-linked immunosorbent assay Phage chemiluminescent enzyme immunoassay Phage-displayed peptide Peptidomimetics
a b s t r a c t In this study, we isolated six phage-displayed peptides by biopanning phage-displayed peptide libraries on an immobilized anti-imidaclothiz monoclonal antibody. After analyzing the relative sensitivity of the individual phage-displayed peptides, we subsequently developed and optimized both a phage enzyme immunoassay (PELISA) and a phage chemiluminescent enzyme immunoassay (P-CLEIA) to improve the sensitivity and linear range of imidaclothiz assays. The P-CLEIA (50% inhibition concentration (IC50) of 0.86 ng mL−1, linear range of 0.13–5.84 ng mL−1) was more sensitive and had a wider linear range compared to the P-ELISA (IC50 of 1.45 ng mL−1, linear range of 0.55–3.82 ng mL−1). Besides, the sensitivities of the P-ELISA and P-CLEIA were increased by N 4-fold and 8-fold, respectively as compared to homologous immunoassays developed using the same monoclonal antibody. Neither method had significant cross-reactivity with the analogues of imidaclothiz except for imidacloprid. Recoveries of the P-ELISA and P-CLEIA for imidaclothiz in paddy water, soil, cabbage, rice, apple, pakchoi, pear and tomato samples were 72.3–101.3% and 73.9–102.6%, respectively. The P-ELISA and P-CLEIA detected imidaclothiz in the authentic samples, and showed good correlation with results obtained from high-performance liquid chromatography (HPLC). © 2017 Elsevier B.V. All rights reserved.
1. Introduction
⁎ Corresponding author at: College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China. E-mail address: [email protected] (X. Hua).
http://dx.doi.org/10.1016/j.scitotenv.2017.07.214 0048-9697/© 2017 Elsevier B.V. All rights reserved.
Immunoassay techniques that are remarkably simple, sensitive, and specific are widely used for detecting small molecular weight compounds including pesticides, biological toxins, and antibiotics (Morozova et al., 2005; Knopp, 2006). Small molecular weight compounds are often
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
detected with the competitive format, because they cannot be simultaneously recognized by two antibodies. In the competitive format, a hapten coupled to a carrier protein or tracer that competes with the analyte for binding to the antibody (Kim et al., 2008). Many previous studies have shown that the use of a heterologous hapten, whose structure is different from that of the immunizing hapten, can significantly improve the sensitivity of the immunoassay (Lee et al., 2006; Vasylieva et al., 2015; Xu et al., 2010). The conventional approach is to design and synthesize a heterologous hapten to conjugate to carrier proteins. However, it is often difficult, expensive and potentially hazardous to chemically synthesize a series of heterologous haptens (Lee et al., 2006; Gui et al., 2009). Thus, the development of heterologous haptens for many competitive immunoassays has remained an experimental challenge. The phage display technique has proven itself to be an attractive alternative approach to producing heterologous competitors that may increase the sensitivity and thus enhance assay performance. A vast repertoire of candidate peptides can be expressed in phage-displayed peptide libraries, where randomly generated amino acid sequences are fused to coat proteins of the filamentous phage (Smith, 1985). This technique can be used to obtain analyte peptidomimetics to use as heterologous competitors, which may then provide better sensitivity than the chemically-synthesized homologous and heterologous competing haptens (Arévalo et al., 2012; Cardozo et al., 2005; He et al., 2011; Hua et al., 2015; Wang et al., 2013a). Kim et al. described a phage enzymelinked immunosorbent assay (P-ELISA) for 3-phenoxybenzoic acid where sensitivity was increased 100-fold compared with the homologous ELISA (Kim et al., 2008). Similarly, a P-ELISA for determination of 2,2′,4,4′-tetrabromodiphenyl ether had an 11-fold improvement in sensitivity over the ELISA (Wang et al., 2013a). Although the phage display technique has offered high quality heterologous competitors to improve the sensitivity of the immunoassays, the analyses are mainly P-ELISAs. These P-ELISAs often show narrow linear ranges, such as the P-ELISAs for benzothiostrobin (0.22–3.94 ng mL−1) (Hua et al., 2015), aflatoxins (0.09–0.5 ng mL− 1) (Wang et al., 2013b), and ochratoxin A (0.2– 8 ng mL−1) (Liu et al., 2007). Assays with a narrow linear range generally require more steps to bring the concentration of the sample to that appropriate for quantitative analysis, which is inconvenient and may decrease the accuracy. The sensitivity and detection range of ELISA can be enhanced when chemiluminescent substrates are used in the enzyme immunoassay. Chemiluminescent enzyme immunoassays (CLEIAs) based on horseradish peroxidase (HRP) and alkaline phosphatase (ALP) have been widely used in the research of clinical diagnosis and analytical testing, because of their high sensitivity and wide detection range (Liu et al., 2013; Shu et al., 2016; Zangheri et al., 2015; Zeng et al., 2016). For example, a CLEIA for the determination of aflatoxin B1 showed a 12-fold increase in linear range compared with the ELISA (Fang et al., 2011a) while the linear range for a CLEIA for detection of human albumin was expanded N30-fold (Vashist et al., 2012). Imidaclothiz is a systemic and broad-spectrum neonicotinoid insecticide that is highly toxic to bees and other pollinating insects (Dussaubat et al., 2016; Wu-Smart and Spivak, 2016) and thus can contaminate the ecosystem (Beketov et al., 2013). Although instrumentbased methods, such as high-performance liquid chromatography (HPLC) (Wu et al., 2010) and HPLC coupled to tandem mass spectrometry (HPLC-MS/MS) (Jiao et al., 2016; Zhang et al., 2012; Zheng et al., 2015) have been successfully used to detect imidaclothiz in environmental samples, these methods depend on expensive instrumentations and may be time-consuming for analysis of a large number of samples. In our previous study, ELISA (Fang et al., 2011b), fluorescence polarization immunoassay (FPIA) (Ma et al., 2016), inner filter effect (IFE)-based competitive immunoassay (You et al., 2017), quantum dots-based fluoroimmunoassay (QDFIA) and time-resolved fluoroimmunoassay (TRFIA) (Hua et al., 2017) have been developed to detect imidaclothiz using a homologous hapten. In the present study, we detail the isolation of heterologous haptens from phage displayed random peptide libraries
855
and their subsequent use in the development phage ELISA (P-ELISA) and phage CLEIAs (P-CLEIAs) for imidaclothiz. The sensitivities and linear ranges of the two immunoassays were compared to each other and then compared with the homologous immunoassays reported previously (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). The accuracies of the P-ELISA and P-CLEIA were validated by HPLC in the analysis of the authentic samples. 2. Materials and methods 2.1. Chemicals Imidaclothiz (97.82%) was provided by Nantong Jiangshan Agrochemical and Chemicals Co., Ltd. (Jiangsu, China), other pesticide standards were supplied by Dr. Ehrenstorfer (Germany). Nonfat dry milk was purchased from Bio-Rad (Hercules, CA). 4-Iodophenol (PIP) was purchased from ACROS (Belgium). HRP-labeled anti-M13 monoclonal antibody (mAb), and reagents required for protein A purification of mAbs were the product of GE Healthcare (Piscataway, NJ). Polyoxyethylene sorbitan monolaurate (Tween-20), 5-bromo-4chloro-3-indolyl-β-D-galactoside (Xgal), isopropyl-β-D-thiogalactoside (IPTG), tetramethyl-benzidine (TMB) and luminol were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO). The cyclic 7-amino-acid and 12-amino-acid random peptide libraries and Escherichia coli ER2738 were purchased from NEB (Ipswich, MA). The cyclic 8-aminoacid random peptide library was developed previously (Wang et al., 2013b). The mAb 1E7 was prepared as previously described (Fang et al., 2011b). 2.2. Biopanning Three wells of each microtiter plate (Nunc, MaxiSorp) were coated with protein A-purified mAb 1E7 at 75 μg mL−1 in PBS by incubating overnight at 4 °C (100 μL per well). After blocking with 5% milk in PBS (incubation at 37 °C for 2 h), each well was washed 5 times with PBST (PBS containing 0.1% (v/v) Tween 20). Then, the phage libraries (2 × 1011 pfu mL−1) diluted with PBS containing 3% milk (final concentration) were added to the plate and gently shaken at room temperature for 1 h. The wells were washed with PBST 10 times, and then 100 μL of imidaclothiz (2 μg mL−1 in PBS) was added to elute the binding phage with shaking for 1 h. After elution, the supernatants were transferred to the wells coated with 100 μL of 5% milk in PBS to remove nonspecific binders. Then, the supernatants were collected to infect ER2738 for amplification and titration. The biopanning was repeated twice, with the concentration of coating antibody at 50 and 25 μg mL−1 in the second and third rounds, respectively. In addition, the concentration of imidaclothiz was reduced to 0.5 and 0.1 μg mL−1, respectively in the second and third round. Thirty-eight clones were picked from the third output titer plate. The diluted ER2738 culture was inoculated with the clones and grown at 37 °C with shaking for 4.5 h. The cultures were centrifuged at 12000 rpm for 10 min followed by collection of the supernatant for P-ELISAs. The positive clones were further amplified and prepared for phage DNA isolation. The sequencing of the phage DNA product was then conducted with the primer 96gIII (CCCTCATAGTTAGCGTAACG). 2.3. P-ELISA A microtiter plate was coated with 100 μL of 1E7 at a concentration of 10 μg mL−1 in PBS by incubating overnight at 4 °C and blocked with 3% skimmed milk in PBS for 2 h at 37 °C. Fifty microliters of phage solution and 50 μL of imidaclothiz standard or prepared sample in 5% methanolPBS were added to the wells and incubated at 37 °C for 1 h. The wells were then washed 6 times with 0.05% PBST (PBS containing 0.05% Tween 20), followed by addition of 100 μL of HRP-labeled anti-M13 mAb (5000-fold dilution with PBS) and 1 h incubation. After washing
856
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
the plate 6 times, 100 μL of peroxidase substrate (0.1 mL of 1% H2O2 and 0.4 mL of 6 mg mL− 1 TMB in dimethyl sulfoxide added to 25 mL of 0.1 mol L−1 citrate acetate buffer, pH 5.5) was added for quantification of the amount of bound enzyme. After a 15 min incubation, the reaction was stopped by adding 50 μL of 2 mol L−1 H2SO4 per well and the absorbance at 450 nm was measured (Fig. 1). 2.4. P-CLEIA The P-CLEIA was performed on 96 well white microplates (Corning). The P-CLEIA procedure was similar to P-ELISA. The bound enzyme was quantified by adding 150 μL of chemiluminescent enhanced solution (1.5 mL of 10 mmol L− 1 luminol in 0.02 mol L−1 NaOH, 7.5 μL of 50 mmol L−1 PIP in dimethylformamide, and 0.3 mL of 75 mmol L−1 H2O2 added to 13 mL of 0.1 mol L−1 Tris-HCl buffer, pH 8.5) per well. The chemiluminescence intensity (relative light units, RLU) was determined using a SpectraMax M5 at 425 nm after 5 min reaction in the dark (Fig. 1). 2.5. Optimization of the P-ELISA and P-CLEIA The concentration of coating antibody and phage-displayed peptide were determined using a two-dimensional checkerboard. The optimal conditions were determined by sequential examination of the experimental parameters (ionic strength, pH value and organic solvent). The P-ELISA and P-CLEIA for imidaclothiz were carried out in PBS solutions with various concentrations of NaCl (from 0.035 to 3.2 mol L−1) and methanol (from 2.5 to 20%, v/v) as well as solutions of different pH values (from 5 to 9), and the evaluations were based on the Amax/IC50 and IC50 for P-ELISA, RLUmax/IC50 and IC50 for P-CLEIA. The combination of low IC50 and high Amax/IC50 (or RLUmax/IC50) was used to select the most desirable assay format. 2.6. Cross-reactivity (CR) A series of concentrations of analogues were tested by using the PELISA and P-CLEIA. The CRs were calculated according to the following formula: CR ð%Þ ¼ ½IC50 ðimidaclothizÞ=IC50 ðanalogueÞ 100:
area. Paddy water samples were filtered and spiked with imidaclothiz in methanol at final concentrations of 1.2, 2.0, 4.0 ng mL−1. Other samples were chopped into pieces and homogenized. The homogenates were spiked with imidaclothiz in methanol at final concentrations of 100, 200, 300 ng g−1. The spiked samples were allowed to stand at room temperature overnight after thorough mixing. The paddy water samples were detected directly with the 2× optimal buffer containing phage-displayed peptides. The solid samples (10 g) were extracted using 20 mL of PBS containing 25% methanol by a vortex mixer for 3 min and sonicated for 15 min. The mixture was then centrifuged at 4000 rpm for 5 min, and the supernatant was collected and adjusted to 25 mL with PBS. The solutions were diluted appropriately and analyzed by the P-ELISA and P-CLEIA. 2.8. HPLC analysis and validation Paddy water and pear were obtained from local farms where imidaclothiz had been applied. The amounts of imidaclothiz in the paddy water and pear samples were analyzed in parallel by the PELISA, P-CLEIA and HPLC. The extraction and analysis for P-ELISAs and P-CLEIAs followed the procedures of the spiked samples. For HPLC, 20 mL filtered paddy water samples were extracted with 30 mL acetonitrile, and the mixture was allowed to separate after the addition of 5 g NaCl. Then, the organic phase was collected and the water phase was extracted again by adding 20 mL acetonitrile. The combined organic phases were filtered through anhydrous sodium sulfate and evaporated to dryness. The pear samples (20 g) were mixed with 50 mL of acetonitrile and 5 mL of water and extracted by shaking for 1 h. The mixture was vacuum filtered and allowed to separate in a mixing stoppered cylinder by adding 5 g NaCl. The organic phase was filtered through anhydrous sodium sulfate and evaporated to dryness. The residues were dissolved with 2 mL of methanol-water (30:70, v/ v) and analyzed by HPLC (Agilent 1260) with an Eclipse plus-C18 column (250 mm × 4.6 mm, 5 μm). The detection was performed using methanol-water (30:70, v/v) as the mobile phase at a flow rate of 0.9 mL min−1 at 30 °C, a detection wavelength of 270 nm and an injection volume of 20 μL. 3. Results and discussion 3.1. Isolation of phage-displayed peptides
2.7. Analysis of spiked samples Cabbage, rice, apple, pakchoi, pear and tomato samples used for spiked recovery assessments were purchased from a local supermarket in Nanjing, China. Soil and paddy water were collected from the Nanjing
In order to increase the chances of obtaining phage-displayed peptides that specifically bound to the anti-imidaclothiz mAb 1E7, cyclic 7-amino-acid, cyclic 8-amino-acid and 12-amino-acid random peptide libraries were panned. Twenty-two clones out of 38, twenty-five clones out of 38 and all clones showed significant signal differences with or
Fig. 1. Schematic diagram of P-ELISA and P-CLEIA. The 96-well microtiter plates were coated with imidaclothiz antibody. Then 50 μL of phage and 50 μL of PBS with or without imidaclothiz were added to the wells. A 1:5000 dilution of anti-M13 phage antibody–HRP was added to detect the bound phage. The amounts of bound enzyme (HRP) for P-ELISA and P-CLEIA were quantified by adding peroxidase substrate and chemiluminescent enhanced solution, respectively.
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
without imidaclothiz (100 ng mL− 1) by P-ELISA from the cyclic 7amino-acid random peptide library, cyclic 8-amino-acidrandom peptide library and 12-amino-acid random peptide library, respectively (Fig. S1). Six different sequences were identified from the positive clones. The sequences of PRIWADS (C6-4) and TYLNSAK (C23-2) were isolated from the cyclic 7-amino-acid random peptide library. The sequence of LPPRMIYE (C2-15) was isolated from the cyclic 8-aminoacid random peptide library. The sequences of SQPWCPPSICGD (L5-8), TMHLPYCPTNIC (L4-29) and DYHDPSLPTLRK (L22-1) were isolated from the 12-amino-acid random peptide library (Table 1). There was no obvious consensus motif among the sequences. The isolated phage-displayed peptides were used to establish PELISAs for imidaclothiz. The IC50 values of the six P-ELISAs were in the range of 2.97–5.74 ng mL− 1 (Table S1). The sensitivity of the six PELISAs decreased in the following order: L4-29 N C2-15 N C23-2 N C6-4 N L5-8 N L22-1. L4-29 with the IC50 value of 2.97 ng mL− 1 was the best competitor according to sensitivity. 3.2. Optimization of the P-ELISA and P-CLEIA
857
Fig. 2. Standard curves for imidaclothiz by P-ELISA and P-CLEIA. Serial dilutions of imidaclothiz standard were mixed with phage-displayed peptides (L4-29) in optimized buffer. Then 100 μL of the mixtures were added to the antibody-coated wells. Each point represents the mean value of three replicates.
Proper coating antibody and phage-displayed peptide concentrations are very important for antibody performance and sensitivity of immunoassays. The optimal concentrations of L4-29 and antibody were 2.5 × 108 pfu mL− 1 and 5 μg mL−1 for P-ELISA, while the P-CLEIA were 2.5 × 109 pfu mL−1 and 5 μg mL−1. The experimental parameters of ionic strength and pH are often optimized to increase the sensitivity of immunoassay. The P-ELISA and PCLEIA showed the highest Amax/IC50 or RLUmax/IC50 and lower IC50 in pH 8, PBS buffer containing 0.14 mol L−1 NaCl (Tables S2 and S3). The organic solvent is necessary for sample pretreatment and dissolution of analyte in immunoassays, but organic solvent at high concentrations often affects antigen-antibody binding. Methanol is a commonly used organic co-solvent due to its relatively weak effect on antigenantibody interaction. At the final concentration of methanol, no N 2.5% in reaction solutions, negligible effects on P-ELISAs and P-CLEIAs were seen (Figs. S2 and S3). Taken together, the optimal parameters of the P-ELISA and P-CLEIA procedures were 2.5% methanol, pH 8, and 0.14 mol L−1 NaCl.
study are unlikely to have a close resemblance to this immunogen. Since the antibody should bind less tightly to the phage displayed peptides than to the immunizing hapten, the soluble imidaclothiz analyte will be able to compete more successfully for antibody binding sites in a heterologous assay format that uses the phage displayed peptide. The sensitivity of P-CLEIA was slightly higher than the P-ELISA, and the linear range was wider by 6.5-fold ([IC90 (a)/IC10 (a)]/[IC90 (b)/IC10 (b)]), which is consistent with previous reports that CLEIAs have a higher sensitivity and wider detection range (Fang et al., 2011a; Torabi et al., 2007; Vashist et al., 2012). The cause for the improvements of sensitivity and linear range in the P-CLEIA is due to the enhanced chemiluminescence reaction, which offers the possibility of improving the sensitivity and linear range of immunoassays compared to conventional colorimetric detection (Botchkareva et al., 2003). These results indicated that the P-CLEIA could combine the advantages of phage-displayed peptide and CLEIA to improve the sensitivity and linear range of P-ELISA.
3.3. Sensitivity of the P-ELISA and P-CLEIA
3.4. Specificity of the P-ELISA and P-CLEIA
Using optimal parameters, the standard curves of the P-ELISA and PCLEIA for imidaclothiz were obtained by plotting the mean values of OD450 or RLU versus the concentration of imidaclothiz (Fig. 2). The IC50 values, LOD and linear range (IC10 to IC90) of the P-ELISA were 1.45, 0.55 and 0.55 to 3.82 ng mL−1, while the P-CLEIA were 0.86, 0.13 and 0.13 to 5.84 ng mL−1, respectively. As compared with the IC50 (or SC50) value of the homologous immunoassays (ELISA, FPIA, IFE-based competitive immunoassay, QDFIA and TRFIA) developed by using the same mAb 1E7 (Table 2), the sensitivities of the P-ELISA and P-CLEIA were increased by N 4-fold and 8-fold, respectively. This an expected result, since the 1E7 antibody was prepared by using an imidaclothiz-protein conjugate as the immunogen (Fang et al., 2011b), and the phage-displayed peptides isolated in the present
The specificities of the P-ELISA and P-CLEIA were evaluated by using CR results (Table 3). The P-ELISA and P-CLEIA exhibited no significant CR (less than or equal to 1.7%) with the analogues except for imidacloprid with CR of 90.4% and 92.2%, respectively. These results were similar to those from the homologous competitive immunoassays in our previous studies (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). 3.5. Analysis of spiked samples Dilution with buffers is the easiest and most immediate way to minimize or remove matrix interferences, and even a modest increase in Table 2 An overview on the immunoassays based on mAb 1E7 for determination of imidaclothiz.
Table 1 Amino acid sequences of phage-displayed peptides. Clone name
Library
Sequencea
C6-4 C23-2 C2-15 L5-8 L4-29 L22-1
Cyclic 7-amino-acid Cyclic 7-amino-acid Cyclic 8-amino-acid 12-Amino-acid 12-Amino-acid 12-Amino-acid
PRIWADS (12) TYLNSAK (10) LPPRMIYE (25) SQPWCPPSICGD (8) TMHLPYCPTNIC (29) DYHDPSLPTLRK (1)
a A total of 85 clones were sequenced. The numbers of isolates bearing the same sequence are indicated in parentheses.
Method
IC50 or SC50 (ng mL−1)
Linear range (ng mL−1)
Reference
P-ELISA P-CLEIA ELISA FPIA IFE-based competitive immunoassay QDFIA TRFIA
1.45 0.86 87.5 87.49 18.9
0.55–3.82 0.13–5.84 18.0–750 0.57–90,900 2.1–171.2
Present study Present study (Fang et al., 2011b) (Ma et al., 2016) (You et al., 2017)
20.41 6.91
0.52–808 0.018–2713
(Hua et al., 2017) (Hua et al., 2017)
858
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
Table 3 IC50 values and cross-reactivity of a set of analogues structurally related to imidaclothiz by P-ELISA and P-CLEIA. Compound
Chemical structure
P-ELISA
P-CLEIA
IC50 (ng mL−1)
CR (%)
IC50 (ng mL−1)
CR (%)
Imidaclothiz
1.45
100
0.86
100
Imidacloprid
1.61
90.4
0.93
92.2
Thiacloprid
85.51
1.7
51.00
1.7
Clothianidin
212.04
0.7
152.74
0.6
Acetamiprid
437.11
0.3
298.90
0.3
Thiamethoxam
732.57
0.2
492.23
0.2
Nitenpyram
N10,000
b0.1
N10,000
b0.1
Dinotefuran
N10,000
b0.1
N10,000
b0.1
assay sensitivity can have a profound effect on the useful range of an environmental immunoassay. The matrix interferences of paddy water samples were investigated by testing no dilution, 2-fold dilution, and 4-fold dilution (the total dilution was 2-, 4- and 8-fold, after mixing with phage in the immunoassay procedures). The matrix interference of solid samples were studied by testing 4-, 8-, 16- and 32-fold (the total dilution was 20-, 40-, 80- and 160-fold, after extraction and mixing with phage in the immunoassay procedures) dilution of extracts with the PBS. A 2-fold dilution of paddy water, a 20-fold dilution of rice, a 40-fold dilution of soil, pakchoi, tomato and pear, an 80-fold dilution
of apple, or a 160-fold dilution of cabbage removed the matrix interferences in the P-ELISA, because the standard inhibition curves that were prepared during the dilutions were similar to those in the 2.5% methanol-PBS buffer (Fig. S4). For P-CLEIA, the dilution ratios were the same with the P-ELISA except for tomato that required an 80-fold dilution (Fig. S5). The mean recoveries and the RSDs were 72.3– 101.3% and 1.4–9.4% for the P-ELISA, and 73.9–102.6% and 1.2–10.8% for the P-CLEIA, respectively (Table 4). The imidaclothiz standard, blank sample of paddy water, and spiked sample of paddy water and pear at final concentrations of 100, 200 and
Table 4 Average recoveries of samples spiked with imidaclothiz by P-ELISAs and P-CLEIAs (n = 3). Sample
Paddy water
Cabbage
Rice
Apple
Pakchoi
Tomato
Soil
Pear
Spiked (ng g−1 or ng mL−1)
P-ELISA Measured ± SD (ng g−1 or ng mL−1)
Average recovery (%)
RSD (%)
Measured ± SD (ng g−1 or ng mL−1)
Average recovery (%)
RSD (%)
1.2 2.0 4.0 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300
1.17 ± 0.02 1.92 ± 0.03 3.89 ± 0.05 79.1 ± 4.8 144.6 ± 4.7 251.6 ± 10.2 87.3 ± 3.8 202.7 ± 10.7 280.3 ± 5.9 83.8 ± 3.8 171.6 ± 3.9 250.0 ± 8.9 81.9 ± 5.9 169.3 ± 4.2 277.2 ± 8.2 80.8 ± 3.4 147.5 ± 13.8 217.1 ± 5.6 74.3 ± 7.0 148 ± 9.0 245 ± 5.3 73.5 ± 4.5 158.5 ± 9.5 244.5 ± 5.5
97.5 96.0 97.2 79.1 72.3 83.9 87.3 101.3 93.4 83.8 85.8 83.0 81.9 84.6 92.4 80.1 73.8 72.4 74.3 74.0 81.7 73.5 79.2 81.5
2.6 2.1 1.4 6.1 3.2 4.0 4.3 5.3 2.1 4.5 2.3 3.6 7.3 2.5 2.9 4.2 9.4 2.5 9.4 6.1 2.2 6.1 6.0 2.2
1.14 ± 0.01 1.93 ± 0.04 4.11 ± 0.02 77.2 ± 3.1 163.6 ± 5.8 250.3 ± 15.5 85.1 ± 3.7 171.8 ± 18.5 277.4 ± 8.6 73.9 ± 4.0 169.6 ± 4.8 234.3 ± 12.8 82.0 ± 3.5 166.3 ± 14.0 262.8 ± 17.4 92.5 ± 2.5 178.5 ± 4.1 239.6 ± 11.1 78.3 ± 2.8 162.1 ± 6.9 254.5 ± 6.2 81.7 ± 9.5 177.2 ± 7.2 268.7 ± 16.4
95.0 96.5 102.6 77.2 81.8 83.4 85.1 85.9 92.5 73.9 84.8 78.1 82.0 83.1 87.6 92.4 89.2 79.9 78.3 81.1 84.8 81.7 88.6 89.6
1.8 3.6 2.2 4.0 3.5 6.2 4.3 10.8 3.1 5.4 2.8 5.4 4.2 8.4 6.6 2.7 2.3 4.6 3.6 4.2 2.4 1.2 4.0 6.1
P-CLEIA
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
859
Fig. 3. Correlations between the immunoassays and HPLC for the authentic samples. Fourteen authentic water and pear samples were detected by P-ELISA, P-CLEIA and HPLC, and the line equation and correlation coefficient obtained from linear regression of the combined immunoassays and HPLC data for imidaclothiz in water or pear samples.
300 ng g−1 or ng mL−1 were analyzed by HPLC to evaluate its accuracy and precision. The representative chromatograms (Fig. S6) showed that the matrix interferences of paddy water and pear were removed by the sample treatments. The average recoveries were in the range of 74.2% to 106.7% with the RSDs of 0.6% to 6.2%.
Appendix A. Supplementary data
3.6. Validation with HPLC
References
As shown in Table S4, concentrations of imidaclothiz in authentic samples ranged 5.3–152.8 ng mL−1 (or ng g− 1), 5.1–142.8 ng mL− 1 (or ng g−1) and 4.6–147.2 ng mL−1 (or ng g−1) as determined using the P-ELISA, P-CLEIA and HPLC, respectively. The linear regression equations and correlation coefficients obtained from linear regression of the combined immunoassays and HPLC data for imidaclothiz are shown in Fig. 3. The slopes of the lines and the R2 values were both close to 1. These results indicated that the detection results of P-ELISA and PCLEIA showed good correlations with those of HPLC.
Arévalo, F.J., González-Techera, A., Zon, M.A., González-Sapienza, G., Fernández, H., 2012. Ultra-sensitive electrochemical immunosensor using analyte peptidomimetics selected from phage display peptide libraries. Biosens. Bioelectron. 32, 231–237. Beketov, M.A., Kefford, B.J., Schafer, R.B., Liess, M., 2013. Pesticides reduce regional biodiversity of stream invertebrates. Proc. Natl. Acad. Sci. U. S. A. 110, 11039–11043. Botchkareva, A.E., Eremin, S.A., Montoya, A., Manclus, J.J., Mickova, B., Rauch, P., Fini, F., Girotti, S., 2003. Development of chemiluminescent ELISAs to DDT and its metabolites in food and environmental samples. J. Immunol. Methods 283, 45–47. Cardozo, S., González-Techera, A., Last, J.A., Hammock, B.D., Kramer, K., GonzálezSapienza, G.G., 2005. Analyte peptidomimetics selected from phage display peptide libraries: a systematic strategy for the development of environmental immunoassays. Environ. Sci. Technol. 39, 4234–4241. Dussaubat, C., Maisonnasse, A., Crauser, D., Tchamitchian, S., Bonnet, M., Cousin, M., Kretzschmar, A., Brunet, J.L., Conte, Y.L., 2016. Combined neonicotinoid pesticide and parasite stress alter honeybee queens' physiology and survival. Sci. Rep. 6, 31430. Fang, L.Q., Hui, C., Ying, X.T., Lin, J.M., 2011a. Micro-plate chemiluminescence enzyme immunoassay for aflatoxin B1 in agricultural products. Talanta 84, 216–222. Fang, S., Zhang, B., Ren, K.W., Cao, M.M., Shi, H.Y., Wang, M.H., 2011b. Development of a sensitive indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) based on the monoclonal antibody for the detection of the imidaclothiz residue. J. Agric. Food Chem. 59, 1594–1597. Gui, W.J., Liu, Y.H., Wang, C.M., Liang, X., Zhu, G.N., 2009. Development of a direct competitive enzyme-linked immunosorbent assay for parathion residue in food samples. Anal. Biochem. 393, 88–94. He, Q.H., Xu, Y., Huang, Y.H., Liu, R.R., Huang, Z.B., Li, Y.P., 2011. Phage-displayed peptides that mimic zearalenone and its application in immunoassay. Food Chem. 126, 1312–1315. Hua, X.D., Zhou, L.L., Feng, L., Ding, Y., Shi, H.Y., Wang, L.M., Gee, S.J., Hammock, B.D., Wang, M.H., 2015. Competitive and noncompetitive phage immunoassays for the determination of benzothiostrobin. Anal. Chim. Acta 890, 150–156. Hua, X.D., Ding, Y., Yang, J.C., Ma, M., Shi, H.Y., Wang, M.H., 2017. Direct competitive fluoroimmunoassays for detection of imidaclothiz in environmental and agricultural samples using quantum dots and europium as labels. Sci. Total Environ. 583, 222–227. Jiao, W.T., Xiao, Y., Qian, X.S., Tong, M.M., Hu, Y.Z., Hou, R.Y., Hua, R.M., 2016. Optimized combination of dilution and refined QuEChERS to overcome matrix effects of six types of tea for determination eight neonicotinoid insecticides by ultra performance liquid chromatography-electrospray tandem mass spectrometry. Food Chem. 210, 26–34. Kim, H.J., González-Techera, A., González-Sapienza, G.G., Ahn, K.C., Gee, S.J., Hammock, B.D., 2008. Phage-borne peptidomimetics accelerate the development of polyclonal antibody-based heterologous immunoassays for the detection of pesticide metabolites. Environ. Sci. Technol. 42, 2047–2053. Knopp, D., 2006. Immunoassay development for environmental analysis. Anal. Bioanal. Chem. 385, 425–427.
4. Conclusions Six phage-displayed peptides were isolated from the cyclic 7-aminoacid, cyclic 8-amino-acid and 12-amino-acid random peptide libraries for the development of P-ELISA and P-CLEIA. The IC50 values of the PELISA and P-CLEIA were 1.45 and 0.86 ng mL−1 respectively, which were 4-fold and 8-fold more sensitive compared to the homologous immunoassays (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). The linear range of P-CLEIA was 0.13 to 5.84 ng mL−1, which was improved 6.5 fold compared to the P-ELISA with a linear range of 0.55 to 3.82 ng mL−1. The P-ELISA and P-CLEIA exhibited similar accuracies and precisions in analyzing environmental and agricultural samples, which were validated by HPLC, and the slopes of the linear regression equations were close to 1. Therefore, the developed P-ELISA and P-CLEIA are alternative tools for monitoring imidaclothiz in environmental and agricultural products. The present study validates that P-CLEIA, a novel immunoassay for a small molecule, can combine the advantages of phage-displayed peptides and CLEIA to improve the sensitivity and linear range of the P-ELISA. Acknowledgements This work was supported by the National Natural Science Foundation of China (31301690) and the National Key Research and Development Program of China (2016YFD0200207).
Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.scitotenv.2017.07.214.
860
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
Lee, W.Y., Lee, E.K., Kim, Y.J., Park, W.C., Chung, T., Lee, Y.T., 2006. Monoclonal antibodybased enzyme-linked immunosorbent assays for the detection of the organophosphorus insecticide isofenphos. Anal. Chim. Acta 557, 169–178. Liu, R.R., Yu, Z., He, Q.H., Xu, Y., 2007. An immunoassay for ochratoxin A without the mycotoxin. Food Control 18, 872–877. Liu, R.P., Wang, C., Jiang, Q., Zhang, W., Yue, Z., Liu, G.H., 2013. Magnetic-particle-based, ultrasensitive chemiluminescence enzymeimmunoassay for free prostate-specific antigen. Anal. Chim. Acta 801, 911–996. Ma, M., Chen, M., Feng, L., You, H.J., Yang, R., Boroduleva, A., Hua, X.D., Eremin, S.A., Wang, M.H., 2016. Fluorescence polarizationimmunoassay for highly efficient detection of imidaclothiz in agricultural samples. Food Anal. Methods 9, 2471–2478. Morozova, V.S., Levashova, A.I., Eremin, S.A., 2005. Determination of pesticides by enzyme immunoassay. J. Anal. Chem. 60, 202–217. Shu, M., Xu, Y., Liu, X., Li, Y.P., He, Q.H., Tu, Z., Fu, J.H., Gee, S.J., Hammock, B.D., 2016. Antiidiotypic nanobody-alkaline phosphatase fusion proteins: development of a one-step competitive enzyme immunoassay for fumonisin B1 detection in cereal. Anal. Chim. Acta 924, 53–59. Smith, G.P., 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315–1317. Torabi, F., Far, H.R.M., Danielsson, B., Khayyami, M., 2007. Development of a plasma panel test for detection of human myocardial proteins by capillary immunoassay. Biosens. Bioelectron. 22, 1218–1223. Vashist, S.K., Saraswat, M., Holthšfer, H., 2012. Comparative study of the developed chemiluminescent, ELISA and SPR immunoassay formats for the highly sensitive detection of human albumin. Procedia Chem. 6, 184–193. Vasylieva, N., Ahn, K.C., Barnych, B., Gee, S.J., Hammock, B.D., 2015. Development of an immunoassay for the detection of the phenylpyrazole insecticide fipronil. Environ. Sci. Technol. 49, 10038–10047. Wang, J., Liu, Z.P., Li, G.Q., Li, J., Kim, H.J., Shelver, W.L., Li, Q.X., Xu, T., 2013a. Simultaneous development of both competitive and noncompetitive immunoassays for 2,2′,4,4′tetrabromodiphenyl ether using phage-displayed peptides. Anal. Bioanal. Chem. 405, 9579–9583.
Wang, Y.R., Wang, H., Li, P.W., Zhang, Q., Kim, H.J., Gee, S.J., Hammock, B.D., 2013b. Phagedisplayed peptide that mimics aflatoxins and its application in immunoassay. J. Agric. Food Chem. 61, 2426–2433. Wu, M., Cai, J.G., Yao, J.Y., Dai, B.J., Lu, Y.T., 2010. Study of imidaclothiz residues in cabbage and soil by HPLC with UV detection. Bull. Environ. Contam. Toxicol. 84, 289–293. Wu-Smart, J., Spivak, M., 2016. Sub-lethal effects of dietary neonicotinoid insecticide exposure on honey bee queen fecundity and colony development. Sci. Rep. 6, 32108. Xu, Z.L., Shen, Y.D., Zheng, W.X., Beier, R.C., Xie, G.M., Dong, J.X., Yang, J.Y., Wang, H., Lei, H.T., She, Z.G., Sun, Y.M., 2010. Broad-specificity immunoassay for O,O-diethyl organophosphorus pesticides: application of molecular modeling to improve assay sensitivity and study antibody recognition. Anal. Chem. 82, 9314–9321. You, H.J., Hua, X.D., Feng, L., Sun, N.N., Rui, Q., Wang, L.M., Wang, M.H., 2017. Competitive immunoassay for imidaclothiz using upconversion nanoparticles and gold nanoparticles as labels. Microchim. Acta 184, 1085–1092. Zangheri, M., Cevenini, L., Anfossi, L., Baggiani, C., Simoni, P., Di Nardo, F., Roda, A., 2015. A simple and compact smartphone accessory for quantitative chemiluminescencebased lateral flow immunoassay for salivary cortisol detection. Biosens. Bioelectron. 64, 63–68. Zeng, H.P., Chen, J.H., Zhang, C.J., Huang, X.A., Sun, Y.M., Xu, Z.L., Lei, H.T., 2016. Broadspecificity chemiluminescence enzyme immunoassay for (fluoro)quinolones: hapten design and molecular modeling study of antibody recognition. Anal. Chem. 88, 3909–3916. Zhang, F.Z., Li, Y.J., Yu, C.S., Pan, C.P., 2012. Determination of six neonicotinoid insecticides residues in spinach, cucumber, apple and pomelo by QuEChERS method and LC–MS/ MS. Bull. Environ. Contam. Toxicol. 88, 885–890. Zheng, S.L., Wu, H.Z., Li, Z.J., Wang, J.M., Zhang, H., Qian, M.J., 2015. Ultrasound/ microwave-assisted solid-liquid-solid dispersive extraction with high-performance liquid chromatography coupled to tandem mass spectrometry for the determination of neonicotinoid insecticides in Dendrobium officinale. J. Sep. Sci. 38, 121–127.
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Development of a phage chemiluminescent enzyme immunoassay with high sensitivity for the determination of imidaclothiz in agricultural and environmental samples Yuan Ding, Xiude Hua ⁎, Nana Sun, Jiachuan Yang, Jiaqi Deng, Haiyan Shi, Minghua Wang College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China State & Local Joint Engineering Research Center of Green Pesticide Invention and Application, Nanjing 210095, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• Imidaclothiz peptidomimetics have been isolated and used to develop PELISA and P-CLEIA. • The P-ELISA and P-CLEIA have higher sensitivity than conventional ELISA. • The P-CLEIA shows high sensitivity and broad linear range compared to the PELISA. • The P-CLEIA is simple and good accuracy is obtained. • The immunoassays are successful applied to authentic samples.
a r t i c l e
i n f o
Article history: Received 16 June 2017 Received in revised form 21 July 2017 Accepted 21 July 2017 Available online 7 August 2017 Editor: Jay Gan Keywords: Imidaclothiz Phage enzyme-linked immunosorbent assay Phage chemiluminescent enzyme immunoassay Phage-displayed peptide Peptidomimetics
a b s t r a c t In this study, we isolated six phage-displayed peptides by biopanning phage-displayed peptide libraries on an immobilized anti-imidaclothiz monoclonal antibody. After analyzing the relative sensitivity of the individual phage-displayed peptides, we subsequently developed and optimized both a phage enzyme immunoassay (PELISA) and a phage chemiluminescent enzyme immunoassay (P-CLEIA) to improve the sensitivity and linear range of imidaclothiz assays. The P-CLEIA (50% inhibition concentration (IC50) of 0.86 ng mL−1, linear range of 0.13–5.84 ng mL−1) was more sensitive and had a wider linear range compared to the P-ELISA (IC50 of 1.45 ng mL−1, linear range of 0.55–3.82 ng mL−1). Besides, the sensitivities of the P-ELISA and P-CLEIA were increased by N 4-fold and 8-fold, respectively as compared to homologous immunoassays developed using the same monoclonal antibody. Neither method had significant cross-reactivity with the analogues of imidaclothiz except for imidacloprid. Recoveries of the P-ELISA and P-CLEIA for imidaclothiz in paddy water, soil, cabbage, rice, apple, pakchoi, pear and tomato samples were 72.3–101.3% and 73.9–102.6%, respectively. The P-ELISA and P-CLEIA detected imidaclothiz in the authentic samples, and showed good correlation with results obtained from high-performance liquid chromatography (HPLC). © 2017 Elsevier B.V. All rights reserved.
1. Introduction
⁎ Corresponding author at: College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China. E-mail address: [email protected] (X. Hua).
http://dx.doi.org/10.1016/j.scitotenv.2017.07.214 0048-9697/© 2017 Elsevier B.V. All rights reserved.
Immunoassay techniques that are remarkably simple, sensitive, and specific are widely used for detecting small molecular weight compounds including pesticides, biological toxins, and antibiotics (Morozova et al., 2005; Knopp, 2006). Small molecular weight compounds are often
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
detected with the competitive format, because they cannot be simultaneously recognized by two antibodies. In the competitive format, a hapten coupled to a carrier protein or tracer that competes with the analyte for binding to the antibody (Kim et al., 2008). Many previous studies have shown that the use of a heterologous hapten, whose structure is different from that of the immunizing hapten, can significantly improve the sensitivity of the immunoassay (Lee et al., 2006; Vasylieva et al., 2015; Xu et al., 2010). The conventional approach is to design and synthesize a heterologous hapten to conjugate to carrier proteins. However, it is often difficult, expensive and potentially hazardous to chemically synthesize a series of heterologous haptens (Lee et al., 2006; Gui et al., 2009). Thus, the development of heterologous haptens for many competitive immunoassays has remained an experimental challenge. The phage display technique has proven itself to be an attractive alternative approach to producing heterologous competitors that may increase the sensitivity and thus enhance assay performance. A vast repertoire of candidate peptides can be expressed in phage-displayed peptide libraries, where randomly generated amino acid sequences are fused to coat proteins of the filamentous phage (Smith, 1985). This technique can be used to obtain analyte peptidomimetics to use as heterologous competitors, which may then provide better sensitivity than the chemically-synthesized homologous and heterologous competing haptens (Arévalo et al., 2012; Cardozo et al., 2005; He et al., 2011; Hua et al., 2015; Wang et al., 2013a). Kim et al. described a phage enzymelinked immunosorbent assay (P-ELISA) for 3-phenoxybenzoic acid where sensitivity was increased 100-fold compared with the homologous ELISA (Kim et al., 2008). Similarly, a P-ELISA for determination of 2,2′,4,4′-tetrabromodiphenyl ether had an 11-fold improvement in sensitivity over the ELISA (Wang et al., 2013a). Although the phage display technique has offered high quality heterologous competitors to improve the sensitivity of the immunoassays, the analyses are mainly P-ELISAs. These P-ELISAs often show narrow linear ranges, such as the P-ELISAs for benzothiostrobin (0.22–3.94 ng mL−1) (Hua et al., 2015), aflatoxins (0.09–0.5 ng mL− 1) (Wang et al., 2013b), and ochratoxin A (0.2– 8 ng mL−1) (Liu et al., 2007). Assays with a narrow linear range generally require more steps to bring the concentration of the sample to that appropriate for quantitative analysis, which is inconvenient and may decrease the accuracy. The sensitivity and detection range of ELISA can be enhanced when chemiluminescent substrates are used in the enzyme immunoassay. Chemiluminescent enzyme immunoassays (CLEIAs) based on horseradish peroxidase (HRP) and alkaline phosphatase (ALP) have been widely used in the research of clinical diagnosis and analytical testing, because of their high sensitivity and wide detection range (Liu et al., 2013; Shu et al., 2016; Zangheri et al., 2015; Zeng et al., 2016). For example, a CLEIA for the determination of aflatoxin B1 showed a 12-fold increase in linear range compared with the ELISA (Fang et al., 2011a) while the linear range for a CLEIA for detection of human albumin was expanded N30-fold (Vashist et al., 2012). Imidaclothiz is a systemic and broad-spectrum neonicotinoid insecticide that is highly toxic to bees and other pollinating insects (Dussaubat et al., 2016; Wu-Smart and Spivak, 2016) and thus can contaminate the ecosystem (Beketov et al., 2013). Although instrumentbased methods, such as high-performance liquid chromatography (HPLC) (Wu et al., 2010) and HPLC coupled to tandem mass spectrometry (HPLC-MS/MS) (Jiao et al., 2016; Zhang et al., 2012; Zheng et al., 2015) have been successfully used to detect imidaclothiz in environmental samples, these methods depend on expensive instrumentations and may be time-consuming for analysis of a large number of samples. In our previous study, ELISA (Fang et al., 2011b), fluorescence polarization immunoassay (FPIA) (Ma et al., 2016), inner filter effect (IFE)-based competitive immunoassay (You et al., 2017), quantum dots-based fluoroimmunoassay (QDFIA) and time-resolved fluoroimmunoassay (TRFIA) (Hua et al., 2017) have been developed to detect imidaclothiz using a homologous hapten. In the present study, we detail the isolation of heterologous haptens from phage displayed random peptide libraries
855
and their subsequent use in the development phage ELISA (P-ELISA) and phage CLEIAs (P-CLEIAs) for imidaclothiz. The sensitivities and linear ranges of the two immunoassays were compared to each other and then compared with the homologous immunoassays reported previously (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). The accuracies of the P-ELISA and P-CLEIA were validated by HPLC in the analysis of the authentic samples. 2. Materials and methods 2.1. Chemicals Imidaclothiz (97.82%) was provided by Nantong Jiangshan Agrochemical and Chemicals Co., Ltd. (Jiangsu, China), other pesticide standards were supplied by Dr. Ehrenstorfer (Germany). Nonfat dry milk was purchased from Bio-Rad (Hercules, CA). 4-Iodophenol (PIP) was purchased from ACROS (Belgium). HRP-labeled anti-M13 monoclonal antibody (mAb), and reagents required for protein A purification of mAbs were the product of GE Healthcare (Piscataway, NJ). Polyoxyethylene sorbitan monolaurate (Tween-20), 5-bromo-4chloro-3-indolyl-β-D-galactoside (Xgal), isopropyl-β-D-thiogalactoside (IPTG), tetramethyl-benzidine (TMB) and luminol were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO). The cyclic 7-amino-acid and 12-amino-acid random peptide libraries and Escherichia coli ER2738 were purchased from NEB (Ipswich, MA). The cyclic 8-aminoacid random peptide library was developed previously (Wang et al., 2013b). The mAb 1E7 was prepared as previously described (Fang et al., 2011b). 2.2. Biopanning Three wells of each microtiter plate (Nunc, MaxiSorp) were coated with protein A-purified mAb 1E7 at 75 μg mL−1 in PBS by incubating overnight at 4 °C (100 μL per well). After blocking with 5% milk in PBS (incubation at 37 °C for 2 h), each well was washed 5 times with PBST (PBS containing 0.1% (v/v) Tween 20). Then, the phage libraries (2 × 1011 pfu mL−1) diluted with PBS containing 3% milk (final concentration) were added to the plate and gently shaken at room temperature for 1 h. The wells were washed with PBST 10 times, and then 100 μL of imidaclothiz (2 μg mL−1 in PBS) was added to elute the binding phage with shaking for 1 h. After elution, the supernatants were transferred to the wells coated with 100 μL of 5% milk in PBS to remove nonspecific binders. Then, the supernatants were collected to infect ER2738 for amplification and titration. The biopanning was repeated twice, with the concentration of coating antibody at 50 and 25 μg mL−1 in the second and third rounds, respectively. In addition, the concentration of imidaclothiz was reduced to 0.5 and 0.1 μg mL−1, respectively in the second and third round. Thirty-eight clones were picked from the third output titer plate. The diluted ER2738 culture was inoculated with the clones and grown at 37 °C with shaking for 4.5 h. The cultures were centrifuged at 12000 rpm for 10 min followed by collection of the supernatant for P-ELISAs. The positive clones were further amplified and prepared for phage DNA isolation. The sequencing of the phage DNA product was then conducted with the primer 96gIII (CCCTCATAGTTAGCGTAACG). 2.3. P-ELISA A microtiter plate was coated with 100 μL of 1E7 at a concentration of 10 μg mL−1 in PBS by incubating overnight at 4 °C and blocked with 3% skimmed milk in PBS for 2 h at 37 °C. Fifty microliters of phage solution and 50 μL of imidaclothiz standard or prepared sample in 5% methanolPBS were added to the wells and incubated at 37 °C for 1 h. The wells were then washed 6 times with 0.05% PBST (PBS containing 0.05% Tween 20), followed by addition of 100 μL of HRP-labeled anti-M13 mAb (5000-fold dilution with PBS) and 1 h incubation. After washing
856
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
the plate 6 times, 100 μL of peroxidase substrate (0.1 mL of 1% H2O2 and 0.4 mL of 6 mg mL− 1 TMB in dimethyl sulfoxide added to 25 mL of 0.1 mol L−1 citrate acetate buffer, pH 5.5) was added for quantification of the amount of bound enzyme. After a 15 min incubation, the reaction was stopped by adding 50 μL of 2 mol L−1 H2SO4 per well and the absorbance at 450 nm was measured (Fig. 1). 2.4. P-CLEIA The P-CLEIA was performed on 96 well white microplates (Corning). The P-CLEIA procedure was similar to P-ELISA. The bound enzyme was quantified by adding 150 μL of chemiluminescent enhanced solution (1.5 mL of 10 mmol L− 1 luminol in 0.02 mol L−1 NaOH, 7.5 μL of 50 mmol L−1 PIP in dimethylformamide, and 0.3 mL of 75 mmol L−1 H2O2 added to 13 mL of 0.1 mol L−1 Tris-HCl buffer, pH 8.5) per well. The chemiluminescence intensity (relative light units, RLU) was determined using a SpectraMax M5 at 425 nm after 5 min reaction in the dark (Fig. 1). 2.5. Optimization of the P-ELISA and P-CLEIA The concentration of coating antibody and phage-displayed peptide were determined using a two-dimensional checkerboard. The optimal conditions were determined by sequential examination of the experimental parameters (ionic strength, pH value and organic solvent). The P-ELISA and P-CLEIA for imidaclothiz were carried out in PBS solutions with various concentrations of NaCl (from 0.035 to 3.2 mol L−1) and methanol (from 2.5 to 20%, v/v) as well as solutions of different pH values (from 5 to 9), and the evaluations were based on the Amax/IC50 and IC50 for P-ELISA, RLUmax/IC50 and IC50 for P-CLEIA. The combination of low IC50 and high Amax/IC50 (or RLUmax/IC50) was used to select the most desirable assay format. 2.6. Cross-reactivity (CR) A series of concentrations of analogues were tested by using the PELISA and P-CLEIA. The CRs were calculated according to the following formula: CR ð%Þ ¼ ½IC50 ðimidaclothizÞ=IC50 ðanalogueÞ 100:
area. Paddy water samples were filtered and spiked with imidaclothiz in methanol at final concentrations of 1.2, 2.0, 4.0 ng mL−1. Other samples were chopped into pieces and homogenized. The homogenates were spiked with imidaclothiz in methanol at final concentrations of 100, 200, 300 ng g−1. The spiked samples were allowed to stand at room temperature overnight after thorough mixing. The paddy water samples were detected directly with the 2× optimal buffer containing phage-displayed peptides. The solid samples (10 g) were extracted using 20 mL of PBS containing 25% methanol by a vortex mixer for 3 min and sonicated for 15 min. The mixture was then centrifuged at 4000 rpm for 5 min, and the supernatant was collected and adjusted to 25 mL with PBS. The solutions were diluted appropriately and analyzed by the P-ELISA and P-CLEIA. 2.8. HPLC analysis and validation Paddy water and pear were obtained from local farms where imidaclothiz had been applied. The amounts of imidaclothiz in the paddy water and pear samples were analyzed in parallel by the PELISA, P-CLEIA and HPLC. The extraction and analysis for P-ELISAs and P-CLEIAs followed the procedures of the spiked samples. For HPLC, 20 mL filtered paddy water samples were extracted with 30 mL acetonitrile, and the mixture was allowed to separate after the addition of 5 g NaCl. Then, the organic phase was collected and the water phase was extracted again by adding 20 mL acetonitrile. The combined organic phases were filtered through anhydrous sodium sulfate and evaporated to dryness. The pear samples (20 g) were mixed with 50 mL of acetonitrile and 5 mL of water and extracted by shaking for 1 h. The mixture was vacuum filtered and allowed to separate in a mixing stoppered cylinder by adding 5 g NaCl. The organic phase was filtered through anhydrous sodium sulfate and evaporated to dryness. The residues were dissolved with 2 mL of methanol-water (30:70, v/ v) and analyzed by HPLC (Agilent 1260) with an Eclipse plus-C18 column (250 mm × 4.6 mm, 5 μm). The detection was performed using methanol-water (30:70, v/v) as the mobile phase at a flow rate of 0.9 mL min−1 at 30 °C, a detection wavelength of 270 nm and an injection volume of 20 μL. 3. Results and discussion 3.1. Isolation of phage-displayed peptides
2.7. Analysis of spiked samples Cabbage, rice, apple, pakchoi, pear and tomato samples used for spiked recovery assessments were purchased from a local supermarket in Nanjing, China. Soil and paddy water were collected from the Nanjing
In order to increase the chances of obtaining phage-displayed peptides that specifically bound to the anti-imidaclothiz mAb 1E7, cyclic 7-amino-acid, cyclic 8-amino-acid and 12-amino-acid random peptide libraries were panned. Twenty-two clones out of 38, twenty-five clones out of 38 and all clones showed significant signal differences with or
Fig. 1. Schematic diagram of P-ELISA and P-CLEIA. The 96-well microtiter plates were coated with imidaclothiz antibody. Then 50 μL of phage and 50 μL of PBS with or without imidaclothiz were added to the wells. A 1:5000 dilution of anti-M13 phage antibody–HRP was added to detect the bound phage. The amounts of bound enzyme (HRP) for P-ELISA and P-CLEIA were quantified by adding peroxidase substrate and chemiluminescent enhanced solution, respectively.
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
without imidaclothiz (100 ng mL− 1) by P-ELISA from the cyclic 7amino-acid random peptide library, cyclic 8-amino-acidrandom peptide library and 12-amino-acid random peptide library, respectively (Fig. S1). Six different sequences were identified from the positive clones. The sequences of PRIWADS (C6-4) and TYLNSAK (C23-2) were isolated from the cyclic 7-amino-acid random peptide library. The sequence of LPPRMIYE (C2-15) was isolated from the cyclic 8-aminoacid random peptide library. The sequences of SQPWCPPSICGD (L5-8), TMHLPYCPTNIC (L4-29) and DYHDPSLPTLRK (L22-1) were isolated from the 12-amino-acid random peptide library (Table 1). There was no obvious consensus motif among the sequences. The isolated phage-displayed peptides were used to establish PELISAs for imidaclothiz. The IC50 values of the six P-ELISAs were in the range of 2.97–5.74 ng mL− 1 (Table S1). The sensitivity of the six PELISAs decreased in the following order: L4-29 N C2-15 N C23-2 N C6-4 N L5-8 N L22-1. L4-29 with the IC50 value of 2.97 ng mL− 1 was the best competitor according to sensitivity. 3.2. Optimization of the P-ELISA and P-CLEIA
857
Fig. 2. Standard curves for imidaclothiz by P-ELISA and P-CLEIA. Serial dilutions of imidaclothiz standard were mixed with phage-displayed peptides (L4-29) in optimized buffer. Then 100 μL of the mixtures were added to the antibody-coated wells. Each point represents the mean value of three replicates.
Proper coating antibody and phage-displayed peptide concentrations are very important for antibody performance and sensitivity of immunoassays. The optimal concentrations of L4-29 and antibody were 2.5 × 108 pfu mL− 1 and 5 μg mL−1 for P-ELISA, while the P-CLEIA were 2.5 × 109 pfu mL−1 and 5 μg mL−1. The experimental parameters of ionic strength and pH are often optimized to increase the sensitivity of immunoassay. The P-ELISA and PCLEIA showed the highest Amax/IC50 or RLUmax/IC50 and lower IC50 in pH 8, PBS buffer containing 0.14 mol L−1 NaCl (Tables S2 and S3). The organic solvent is necessary for sample pretreatment and dissolution of analyte in immunoassays, but organic solvent at high concentrations often affects antigen-antibody binding. Methanol is a commonly used organic co-solvent due to its relatively weak effect on antigenantibody interaction. At the final concentration of methanol, no N 2.5% in reaction solutions, negligible effects on P-ELISAs and P-CLEIAs were seen (Figs. S2 and S3). Taken together, the optimal parameters of the P-ELISA and P-CLEIA procedures were 2.5% methanol, pH 8, and 0.14 mol L−1 NaCl.
study are unlikely to have a close resemblance to this immunogen. Since the antibody should bind less tightly to the phage displayed peptides than to the immunizing hapten, the soluble imidaclothiz analyte will be able to compete more successfully for antibody binding sites in a heterologous assay format that uses the phage displayed peptide. The sensitivity of P-CLEIA was slightly higher than the P-ELISA, and the linear range was wider by 6.5-fold ([IC90 (a)/IC10 (a)]/[IC90 (b)/IC10 (b)]), which is consistent with previous reports that CLEIAs have a higher sensitivity and wider detection range (Fang et al., 2011a; Torabi et al., 2007; Vashist et al., 2012). The cause for the improvements of sensitivity and linear range in the P-CLEIA is due to the enhanced chemiluminescence reaction, which offers the possibility of improving the sensitivity and linear range of immunoassays compared to conventional colorimetric detection (Botchkareva et al., 2003). These results indicated that the P-CLEIA could combine the advantages of phage-displayed peptide and CLEIA to improve the sensitivity and linear range of P-ELISA.
3.3. Sensitivity of the P-ELISA and P-CLEIA
3.4. Specificity of the P-ELISA and P-CLEIA
Using optimal parameters, the standard curves of the P-ELISA and PCLEIA for imidaclothiz were obtained by plotting the mean values of OD450 or RLU versus the concentration of imidaclothiz (Fig. 2). The IC50 values, LOD and linear range (IC10 to IC90) of the P-ELISA were 1.45, 0.55 and 0.55 to 3.82 ng mL−1, while the P-CLEIA were 0.86, 0.13 and 0.13 to 5.84 ng mL−1, respectively. As compared with the IC50 (or SC50) value of the homologous immunoassays (ELISA, FPIA, IFE-based competitive immunoassay, QDFIA and TRFIA) developed by using the same mAb 1E7 (Table 2), the sensitivities of the P-ELISA and P-CLEIA were increased by N 4-fold and 8-fold, respectively. This an expected result, since the 1E7 antibody was prepared by using an imidaclothiz-protein conjugate as the immunogen (Fang et al., 2011b), and the phage-displayed peptides isolated in the present
The specificities of the P-ELISA and P-CLEIA were evaluated by using CR results (Table 3). The P-ELISA and P-CLEIA exhibited no significant CR (less than or equal to 1.7%) with the analogues except for imidacloprid with CR of 90.4% and 92.2%, respectively. These results were similar to those from the homologous competitive immunoassays in our previous studies (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). 3.5. Analysis of spiked samples Dilution with buffers is the easiest and most immediate way to minimize or remove matrix interferences, and even a modest increase in Table 2 An overview on the immunoassays based on mAb 1E7 for determination of imidaclothiz.
Table 1 Amino acid sequences of phage-displayed peptides. Clone name
Library
Sequencea
C6-4 C23-2 C2-15 L5-8 L4-29 L22-1
Cyclic 7-amino-acid Cyclic 7-amino-acid Cyclic 8-amino-acid 12-Amino-acid 12-Amino-acid 12-Amino-acid
PRIWADS (12) TYLNSAK (10) LPPRMIYE (25) SQPWCPPSICGD (8) TMHLPYCPTNIC (29) DYHDPSLPTLRK (1)
a A total of 85 clones were sequenced. The numbers of isolates bearing the same sequence are indicated in parentheses.
Method
IC50 or SC50 (ng mL−1)
Linear range (ng mL−1)
Reference
P-ELISA P-CLEIA ELISA FPIA IFE-based competitive immunoassay QDFIA TRFIA
1.45 0.86 87.5 87.49 18.9
0.55–3.82 0.13–5.84 18.0–750 0.57–90,900 2.1–171.2
Present study Present study (Fang et al., 2011b) (Ma et al., 2016) (You et al., 2017)
20.41 6.91
0.52–808 0.018–2713
(Hua et al., 2017) (Hua et al., 2017)
858
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
Table 3 IC50 values and cross-reactivity of a set of analogues structurally related to imidaclothiz by P-ELISA and P-CLEIA. Compound
Chemical structure
P-ELISA
P-CLEIA
IC50 (ng mL−1)
CR (%)
IC50 (ng mL−1)
CR (%)
Imidaclothiz
1.45
100
0.86
100
Imidacloprid
1.61
90.4
0.93
92.2
Thiacloprid
85.51
1.7
51.00
1.7
Clothianidin
212.04
0.7
152.74
0.6
Acetamiprid
437.11
0.3
298.90
0.3
Thiamethoxam
732.57
0.2
492.23
0.2
Nitenpyram
N10,000
b0.1
N10,000
b0.1
Dinotefuran
N10,000
b0.1
N10,000
b0.1
assay sensitivity can have a profound effect on the useful range of an environmental immunoassay. The matrix interferences of paddy water samples were investigated by testing no dilution, 2-fold dilution, and 4-fold dilution (the total dilution was 2-, 4- and 8-fold, after mixing with phage in the immunoassay procedures). The matrix interference of solid samples were studied by testing 4-, 8-, 16- and 32-fold (the total dilution was 20-, 40-, 80- and 160-fold, after extraction and mixing with phage in the immunoassay procedures) dilution of extracts with the PBS. A 2-fold dilution of paddy water, a 20-fold dilution of rice, a 40-fold dilution of soil, pakchoi, tomato and pear, an 80-fold dilution
of apple, or a 160-fold dilution of cabbage removed the matrix interferences in the P-ELISA, because the standard inhibition curves that were prepared during the dilutions were similar to those in the 2.5% methanol-PBS buffer (Fig. S4). For P-CLEIA, the dilution ratios were the same with the P-ELISA except for tomato that required an 80-fold dilution (Fig. S5). The mean recoveries and the RSDs were 72.3– 101.3% and 1.4–9.4% for the P-ELISA, and 73.9–102.6% and 1.2–10.8% for the P-CLEIA, respectively (Table 4). The imidaclothiz standard, blank sample of paddy water, and spiked sample of paddy water and pear at final concentrations of 100, 200 and
Table 4 Average recoveries of samples spiked with imidaclothiz by P-ELISAs and P-CLEIAs (n = 3). Sample
Paddy water
Cabbage
Rice
Apple
Pakchoi
Tomato
Soil
Pear
Spiked (ng g−1 or ng mL−1)
P-ELISA Measured ± SD (ng g−1 or ng mL−1)
Average recovery (%)
RSD (%)
Measured ± SD (ng g−1 or ng mL−1)
Average recovery (%)
RSD (%)
1.2 2.0 4.0 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300 100 200 300
1.17 ± 0.02 1.92 ± 0.03 3.89 ± 0.05 79.1 ± 4.8 144.6 ± 4.7 251.6 ± 10.2 87.3 ± 3.8 202.7 ± 10.7 280.3 ± 5.9 83.8 ± 3.8 171.6 ± 3.9 250.0 ± 8.9 81.9 ± 5.9 169.3 ± 4.2 277.2 ± 8.2 80.8 ± 3.4 147.5 ± 13.8 217.1 ± 5.6 74.3 ± 7.0 148 ± 9.0 245 ± 5.3 73.5 ± 4.5 158.5 ± 9.5 244.5 ± 5.5
97.5 96.0 97.2 79.1 72.3 83.9 87.3 101.3 93.4 83.8 85.8 83.0 81.9 84.6 92.4 80.1 73.8 72.4 74.3 74.0 81.7 73.5 79.2 81.5
2.6 2.1 1.4 6.1 3.2 4.0 4.3 5.3 2.1 4.5 2.3 3.6 7.3 2.5 2.9 4.2 9.4 2.5 9.4 6.1 2.2 6.1 6.0 2.2
1.14 ± 0.01 1.93 ± 0.04 4.11 ± 0.02 77.2 ± 3.1 163.6 ± 5.8 250.3 ± 15.5 85.1 ± 3.7 171.8 ± 18.5 277.4 ± 8.6 73.9 ± 4.0 169.6 ± 4.8 234.3 ± 12.8 82.0 ± 3.5 166.3 ± 14.0 262.8 ± 17.4 92.5 ± 2.5 178.5 ± 4.1 239.6 ± 11.1 78.3 ± 2.8 162.1 ± 6.9 254.5 ± 6.2 81.7 ± 9.5 177.2 ± 7.2 268.7 ± 16.4
95.0 96.5 102.6 77.2 81.8 83.4 85.1 85.9 92.5 73.9 84.8 78.1 82.0 83.1 87.6 92.4 89.2 79.9 78.3 81.1 84.8 81.7 88.6 89.6
1.8 3.6 2.2 4.0 3.5 6.2 4.3 10.8 3.1 5.4 2.8 5.4 4.2 8.4 6.6 2.7 2.3 4.6 3.6 4.2 2.4 1.2 4.0 6.1
P-CLEIA
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
859
Fig. 3. Correlations between the immunoassays and HPLC for the authentic samples. Fourteen authentic water and pear samples were detected by P-ELISA, P-CLEIA and HPLC, and the line equation and correlation coefficient obtained from linear regression of the combined immunoassays and HPLC data for imidaclothiz in water or pear samples.
300 ng g−1 or ng mL−1 were analyzed by HPLC to evaluate its accuracy and precision. The representative chromatograms (Fig. S6) showed that the matrix interferences of paddy water and pear were removed by the sample treatments. The average recoveries were in the range of 74.2% to 106.7% with the RSDs of 0.6% to 6.2%.
Appendix A. Supplementary data
3.6. Validation with HPLC
References
As shown in Table S4, concentrations of imidaclothiz in authentic samples ranged 5.3–152.8 ng mL−1 (or ng g− 1), 5.1–142.8 ng mL− 1 (or ng g−1) and 4.6–147.2 ng mL−1 (or ng g−1) as determined using the P-ELISA, P-CLEIA and HPLC, respectively. The linear regression equations and correlation coefficients obtained from linear regression of the combined immunoassays and HPLC data for imidaclothiz are shown in Fig. 3. The slopes of the lines and the R2 values were both close to 1. These results indicated that the detection results of P-ELISA and PCLEIA showed good correlations with those of HPLC.
Arévalo, F.J., González-Techera, A., Zon, M.A., González-Sapienza, G., Fernández, H., 2012. Ultra-sensitive electrochemical immunosensor using analyte peptidomimetics selected from phage display peptide libraries. Biosens. Bioelectron. 32, 231–237. Beketov, M.A., Kefford, B.J., Schafer, R.B., Liess, M., 2013. Pesticides reduce regional biodiversity of stream invertebrates. Proc. Natl. Acad. Sci. U. S. A. 110, 11039–11043. Botchkareva, A.E., Eremin, S.A., Montoya, A., Manclus, J.J., Mickova, B., Rauch, P., Fini, F., Girotti, S., 2003. Development of chemiluminescent ELISAs to DDT and its metabolites in food and environmental samples. J. Immunol. Methods 283, 45–47. Cardozo, S., González-Techera, A., Last, J.A., Hammock, B.D., Kramer, K., GonzálezSapienza, G.G., 2005. Analyte peptidomimetics selected from phage display peptide libraries: a systematic strategy for the development of environmental immunoassays. Environ. Sci. Technol. 39, 4234–4241. Dussaubat, C., Maisonnasse, A., Crauser, D., Tchamitchian, S., Bonnet, M., Cousin, M., Kretzschmar, A., Brunet, J.L., Conte, Y.L., 2016. Combined neonicotinoid pesticide and parasite stress alter honeybee queens' physiology and survival. Sci. Rep. 6, 31430. Fang, L.Q., Hui, C., Ying, X.T., Lin, J.M., 2011a. Micro-plate chemiluminescence enzyme immunoassay for aflatoxin B1 in agricultural products. Talanta 84, 216–222. Fang, S., Zhang, B., Ren, K.W., Cao, M.M., Shi, H.Y., Wang, M.H., 2011b. Development of a sensitive indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) based on the monoclonal antibody for the detection of the imidaclothiz residue. J. Agric. Food Chem. 59, 1594–1597. Gui, W.J., Liu, Y.H., Wang, C.M., Liang, X., Zhu, G.N., 2009. Development of a direct competitive enzyme-linked immunosorbent assay for parathion residue in food samples. Anal. Biochem. 393, 88–94. He, Q.H., Xu, Y., Huang, Y.H., Liu, R.R., Huang, Z.B., Li, Y.P., 2011. Phage-displayed peptides that mimic zearalenone and its application in immunoassay. Food Chem. 126, 1312–1315. Hua, X.D., Zhou, L.L., Feng, L., Ding, Y., Shi, H.Y., Wang, L.M., Gee, S.J., Hammock, B.D., Wang, M.H., 2015. Competitive and noncompetitive phage immunoassays for the determination of benzothiostrobin. Anal. Chim. Acta 890, 150–156. Hua, X.D., Ding, Y., Yang, J.C., Ma, M., Shi, H.Y., Wang, M.H., 2017. Direct competitive fluoroimmunoassays for detection of imidaclothiz in environmental and agricultural samples using quantum dots and europium as labels. Sci. Total Environ. 583, 222–227. Jiao, W.T., Xiao, Y., Qian, X.S., Tong, M.M., Hu, Y.Z., Hou, R.Y., Hua, R.M., 2016. Optimized combination of dilution and refined QuEChERS to overcome matrix effects of six types of tea for determination eight neonicotinoid insecticides by ultra performance liquid chromatography-electrospray tandem mass spectrometry. Food Chem. 210, 26–34. Kim, H.J., González-Techera, A., González-Sapienza, G.G., Ahn, K.C., Gee, S.J., Hammock, B.D., 2008. Phage-borne peptidomimetics accelerate the development of polyclonal antibody-based heterologous immunoassays for the detection of pesticide metabolites. Environ. Sci. Technol. 42, 2047–2053. Knopp, D., 2006. Immunoassay development for environmental analysis. Anal. Bioanal. Chem. 385, 425–427.
4. Conclusions Six phage-displayed peptides were isolated from the cyclic 7-aminoacid, cyclic 8-amino-acid and 12-amino-acid random peptide libraries for the development of P-ELISA and P-CLEIA. The IC50 values of the PELISA and P-CLEIA were 1.45 and 0.86 ng mL−1 respectively, which were 4-fold and 8-fold more sensitive compared to the homologous immunoassays (Fang et al., 2011b; Hua et al., 2017; Ma et al., 2016; You et al., 2017). The linear range of P-CLEIA was 0.13 to 5.84 ng mL−1, which was improved 6.5 fold compared to the P-ELISA with a linear range of 0.55 to 3.82 ng mL−1. The P-ELISA and P-CLEIA exhibited similar accuracies and precisions in analyzing environmental and agricultural samples, which were validated by HPLC, and the slopes of the linear regression equations were close to 1. Therefore, the developed P-ELISA and P-CLEIA are alternative tools for monitoring imidaclothiz in environmental and agricultural products. The present study validates that P-CLEIA, a novel immunoassay for a small molecule, can combine the advantages of phage-displayed peptides and CLEIA to improve the sensitivity and linear range of the P-ELISA. Acknowledgements This work was supported by the National Natural Science Foundation of China (31301690) and the National Key Research and Development Program of China (2016YFD0200207).
Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.scitotenv.2017.07.214.
860
Y. Ding et al. / Science of the Total Environment 609 (2017) 854–860
Lee, W.Y., Lee, E.K., Kim, Y.J., Park, W.C., Chung, T., Lee, Y.T., 2006. Monoclonal antibodybased enzyme-linked immunosorbent assays for the detection of the organophosphorus insecticide isofenphos. Anal. Chim. Acta 557, 169–178. Liu, R.R., Yu, Z., He, Q.H., Xu, Y., 2007. An immunoassay for ochratoxin A without the mycotoxin. Food Control 18, 872–877. Liu, R.P., Wang, C., Jiang, Q., Zhang, W., Yue, Z., Liu, G.H., 2013. Magnetic-particle-based, ultrasensitive chemiluminescence enzymeimmunoassay for free prostate-specific antigen. Anal. Chim. Acta 801, 911–996. Ma, M., Chen, M., Feng, L., You, H.J., Yang, R., Boroduleva, A., Hua, X.D., Eremin, S.A., Wang, M.H., 2016. Fluorescence polarizationimmunoassay for highly efficient detection of imidaclothiz in agricultural samples. Food Anal. Methods 9, 2471–2478. Morozova, V.S., Levashova, A.I., Eremin, S.A., 2005. Determination of pesticides by enzyme immunoassay. J. Anal. Chem. 60, 202–217. Shu, M., Xu, Y., Liu, X., Li, Y.P., He, Q.H., Tu, Z., Fu, J.H., Gee, S.J., Hammock, B.D., 2016. Antiidiotypic nanobody-alkaline phosphatase fusion proteins: development of a one-step competitive enzyme immunoassay for fumonisin B1 detection in cereal. Anal. Chim. Acta 924, 53–59. Smith, G.P., 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315–1317. Torabi, F., Far, H.R.M., Danielsson, B., Khayyami, M., 2007. Development of a plasma panel test for detection of human myocardial proteins by capillary immunoassay. Biosens. Bioelectron. 22, 1218–1223. Vashist, S.K., Saraswat, M., Holthšfer, H., 2012. Comparative study of the developed chemiluminescent, ELISA and SPR immunoassay formats for the highly sensitive detection of human albumin. Procedia Chem. 6, 184–193. Vasylieva, N., Ahn, K.C., Barnych, B., Gee, S.J., Hammock, B.D., 2015. Development of an immunoassay for the detection of the phenylpyrazole insecticide fipronil. Environ. Sci. Technol. 49, 10038–10047. Wang, J., Liu, Z.P., Li, G.Q., Li, J., Kim, H.J., Shelver, W.L., Li, Q.X., Xu, T., 2013a. Simultaneous development of both competitive and noncompetitive immunoassays for 2,2′,4,4′tetrabromodiphenyl ether using phage-displayed peptides. Anal. Bioanal. Chem. 405, 9579–9583.
Wang, Y.R., Wang, H., Li, P.W., Zhang, Q., Kim, H.J., Gee, S.J., Hammock, B.D., 2013b. Phagedisplayed peptide that mimics aflatoxins and its application in immunoassay. J. Agric. Food Chem. 61, 2426–2433. Wu, M., Cai, J.G., Yao, J.Y., Dai, B.J., Lu, Y.T., 2010. Study of imidaclothiz residues in cabbage and soil by HPLC with UV detection. Bull. Environ. Contam. Toxicol. 84, 289–293. Wu-Smart, J., Spivak, M., 2016. Sub-lethal effects of dietary neonicotinoid insecticide exposure on honey bee queen fecundity and colony development. Sci. Rep. 6, 32108. Xu, Z.L., Shen, Y.D., Zheng, W.X., Beier, R.C., Xie, G.M., Dong, J.X., Yang, J.Y., Wang, H., Lei, H.T., She, Z.G., Sun, Y.M., 2010. Broad-specificity immunoassay for O,O-diethyl organophosphorus pesticides: application of molecular modeling to improve assay sensitivity and study antibody recognition. Anal. Chem. 82, 9314–9321. You, H.J., Hua, X.D., Feng, L., Sun, N.N., Rui, Q., Wang, L.M., Wang, M.H., 2017. Competitive immunoassay for imidaclothiz using upconversion nanoparticles and gold nanoparticles as labels. Microchim. Acta 184, 1085–1092. Zangheri, M., Cevenini, L., Anfossi, L., Baggiani, C., Simoni, P., Di Nardo, F., Roda, A., 2015. A simple and compact smartphone accessory for quantitative chemiluminescencebased lateral flow immunoassay for salivary cortisol detection. Biosens. Bioelectron. 64, 63–68. Zeng, H.P., Chen, J.H., Zhang, C.J., Huang, X.A., Sun, Y.M., Xu, Z.L., Lei, H.T., 2016. Broadspecificity chemiluminescence enzyme immunoassay for (fluoro)quinolones: hapten design and molecular modeling study of antibody recognition. Anal. Chem. 88, 3909–3916. Zhang, F.Z., Li, Y.J., Yu, C.S., Pan, C.P., 2012. Determination of six neonicotinoid insecticides residues in spinach, cucumber, apple and pomelo by QuEChERS method and LC–MS/ MS. Bull. Environ. Contam. Toxicol. 88, 885–890. Zheng, S.L., Wu, H.Z., Li, Z.J., Wang, J.M., Zhang, H., Qian, M.J., 2015. Ultrasound/ microwave-assisted solid-liquid-solid dispersive extraction with high-performance liquid chromatography coupled to tandem mass spectrometry for the determination of neonicotinoid insecticides in Dendrobium officinale. J. Sep. Sci. 38, 121–127.
