Journal of Virological Methods 200 (2014) 29–34

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Development of a high resolution melting analysis for detection and differentiation of human astroviruses Akihiko Hata a,∗ , Masaaki Kitajima b , Etsuko Tajiri-Utagawa c , Hiroyuki Katayama a a

Department of Urban Engineering, Graduate School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656, Japan Center for Environmental Sensing and Modeling Singapore-MIT Alliance for Research and Technology 1 CREATE Way, #09-03 CREATE Tower, Singapore 138602 c Second Department of Virology, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashimurayama-shi, Tokyo 208-0012, Japan b

a b s t r a c t Article history: Received 14 October 2013 Received in revised form 16 January 2014 Accepted 21 January 2014 Available online 6 February 2014 Keywords: HRM Human astroviruses Phylogenetic analysis RT-PCR

Human astroviruses (AstVs), the common causes of viral gastroenteritis, consist of 8 different seroor genotypes in which a variety of subtypes have been found. In the present study, a rapid and highthroughput method for detection and sequence-discrimination of AstVs by high resolution melting (HRM) analysis was developed. A newly designed primer set for the assay targeting ORF1b–ORF2 junction region of AstVs successfully reacted with all 8 serotypes of AstVs and allowed genotyping using their amplicons. The HRM assay consists of intercalating dye based real time quantitative PCR (qPCR) and melting curve analysis. The qPCR assay was sensitive enough to detect 1.0 × 101 copies/reaction of AstV serotypes. However, 1.0 × 103 copies/reaction of AstVs gene was required to obtain a sequence-specific difference curve, indicating that pre-amplification is necessary to apply the assay to samples containing low numbers of AstVs. AstVs in clinical specimens were subjected to the HRM assay after pre-amplification. The strains possessing same nucleotide sequences at the target region showed an identical difference curve and those possessing different nucleotide sequences showed a distinguishable difference curve. The newly developed HRM assay is an effective technique for screening of AstVs to quantify and discriminate the strains. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Human astroviruses (AstVs), which belong to the family Astroviridae, are known as the common cause of infantile viral gastroenteritis worldwide (Mustafa et al., 2000; Nadan et al., 2003; Malasao et al., 2008; Guo et al., 2010; Verma et al., 2010). AstVs are excreted in feces by infected individuals (up to 1015 copies g stool−1 ) (Zhang et al., 2006) and transmit via the fecal-oral route (Schwab, 2007). AstVs are small (28 nm in diameter), icosahedral shaped and non-enveloped viruses containing a 6.8 kb single stranded positive-sense RNA. Their viral genome consists of open reading frame (ORF) 1a, ORF1b and ORF2 encoding serine protease, RNA-dependent RNA polymerase and viral capsid, respectively (Madeley and Cosgrove, 1975; Matsui and Greenberg, 2001; Guix et al., 2005). Currently, AstVs are divided into 8 genetically and antigenically distinct types (AstV-1 to -8). Genotyping surveys have shown that AstV-1 is the most common type, followed by AstV2, -3, -4 and -5, whereas AstV-6, -7, and -8 have been detected more rarely (Wang et al., 2001; Gabbay et al., 2007; De Grazia

∗ Corresponding author. Tel.: +81 3 5841 6242; fax: +81 3 5841 6244. E-mail address: [email protected] (A. Hata). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.023

et al., 2011, 2013). It is known that genotype of AstVs correlates well with serotype (Noel et al., 1995) and currently, genotyping is applied more commonly than serotyping for characterization of AstV strains. Sequence analysis of short fragments at either the 5 or 3 -end of ORF2 and RT-PCR genotyping protocols with typespecific primers have been used for genetic characterization of AstV-1 to -8 (Noel et al., 1995; Guix et al., 2005). High resolution melting (HRM) analysis, an intercalating dyebased real-time quantitative PCR (qPCR) coupled with melting curve analysis, is a tool for screening nucleotide substitutions. A previous study demonstrated that the HRM assay is sensitive enough to detect single-nucleotide substitution (Lee et al., 2011). Compared to other techniques for molecular characterization such as Sanger sequencing and pyrosequencing, HRM is superior in respect to rapidity and simplicity (Lee et al., 2011). Several HRM assays have been developed successfully and applied for detection and genotyping of viruses such as polyomaviruses (Dumonceaux et al., 2008; Matsuda et al., 2011), noroviruses (Tajiri-Utagawa et al., 2009; Hara et al., 2010), influenza A viruses (Lin et al., 2008; Curd et al., 2011; Lee et al., 2011), and fowl adenovirus (Marek et al., 2010). However, HRM assay for AstVs has not been reported yet. In the present study, we aimed to develop an HRM assay that would allow simultaneous detection and differentiation of AstVs.

30

A. Hata et al. / Journal of Virological Methods 200 (2014) 29–34

Table 1 Primers used in this study. Application

Primer

Sequence(5 –3 )a

Polarity

Locationb

Pre-amplification

AHAstVF1 AHAstVR1 AHAstVF2 AHAstVR2

AATCACTCCATGGGAAGCTCCT CCTARCGCYTGCACDGG CAGAAGAGCAACTCCATCGCAT GTRCTYCCWGTAGCRTCCTTAAC

+ − + −

4139–4160 4697–4713 4280–4301 4664–4686

HRM a b

Mix bases in degenerated primers and probes are as follows: R stands for A or G; Y stands for C or T; D stands A, G or T; W stands for A or T. Corresponding nucleotide position of AstV-1 strain Oxford (accession number: L23513).

2. Materials and methods 2.1. AstVs and clinical specimens Each serotype of isolated AstV strain was obtained from Centers for Disease Control and Prevention (CDC). The strains were propagated in CaCo-2 cell line. A total of 13 clinical specimens (F1–F13) were collected from gastroenteritis patients aged under 5 years diagnosed with diarrhea by pediatric clinics in Japan. Electron microscopy showed all the specimens were positive for AstVs. The AstV isolates and stool specimens were kept at −80 ◦ C until use. 2.2. Nucleotide sequence alignment of AstVs A total of 281 nucleotide sequences of AstVs (AstV-1: 17 sequences; -2: 67 sequences; -3: 43 sequences; -4: 63 sequences; -5: 24 sequences; -6: 14 sequences; -7: 8 sequences; -8: 45 sequences) taken from GenBank database were aligned with Clustal W version 1.83 software (http://clustalw.ddbj.nig.ac.jp/top-j.html). The accession numbers for the sequences used in the present study are listed in the supplemental material. Based on the obtained alignment, two sets of primer-pairs to amplify 575 bp and 407 bp fragments of ORF1b–ORF2 junction region of all types of AstVs were designed (Table 1). 2.3. RNA extraction and reverse-transcription (RT) Viral RNA in 140 ␮L of the 10% stool suspension was extracted using a QIAamp Viral RNA mini kit (Qiagen, Hilden, Germany) to obtain a 60 ␮L of RNA extract, following the manufacture’s protocol. The RNA extract was subjected to RT reaction using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Tokyo, Japan). Briefly, RNA (15 ␮L) was added to 15 ␮L of RT mixture containing RT buffer and 75 U of MultiScribe reverse transcriptase (Applied Biosystems). The RT reaction mixture was incubated at 25 ◦ C for 10 min, then at 37 ◦ C for 120 min, and then at 85 ◦ C for 5 min to inactivate the enzyme. 2.4. Construction of the plasmid DNAs To construct standard plasmid DNAs for each AstV type, 575 nucleotides (nts) encoding ORF1b–ORF2 junction of each type of the isolated AstV strains were amplified by PCR with KOD -PlusVer.2 DNA polymerase (TOYOBO, Osaka, Japan) and the primers for pre-amplification (AHAstVF1 and AHAstVR1) (Table 1). A 50 ␮L of PCR mixture containing 400 nM each of forward and reverse primer, 5 ␮L of 10× Buffer for KOD -Plus- Ver.2, 200 nM of dNTPs, 1.5 mM of MgSO4 , 1.0 U of KOD -Plus- and 5 ␮L of template cDNA was subjected to a reaction consists of initial denaturation of 2 min at 94 ◦ C, 30 cycles of amplification of 10 s at 98 ◦ C, 30 s at 54 ◦ C and 30 s at 68 ◦ C and final extension of 7 min at 68 ◦ C. The PCR products were subjected to electrophoresis using 2% agarose gel and those of expected sizes were excised with a QIAquick Gel Extraction kit (Qiagen). The excised PCR products were cloned into a Zero Blunt TOPO pCR 2.1 vector (Invitrogen, Carlsbad, CA) and the

plasmid was transformed into One Shot TOP10 chemically competent Escherichia coli (Invitrogen), according to the manufacturer’s protocol. Plasmid DNA was extracted from the transformed competent cells using a QIAprep spin mini prep kit (Qiagen). The concentration of the purified plasmid DNA was determined by measuring the optical density at 260 nm with NanoDrop ND-1000 instrument (LMS, Tokyo, Japan).

2.5. HRM assay HRM assay, which consists of PCR amplification and melting curve acquisition and analysis, was performed on the LightCycler 480 instrument (Roche Diagnostics, Tokyo, Japan). Prior to applying the HRM assay to clinical specimens, pre-amplification was performed with KOD -Plus- Ver.2 DNA polymerase under the PCR condition described in Section 2.4. A 20 ␮L of mixture containing 10 ␮L of 2× LightCycler 480 HRM master mix (Roche Diagnostics), 2.5 mM of MgCl2 , 200 nM each of the forward and reverse primers for the HRM assay (AHAstVF2 and AHAstVR2) (Table 1) and 2 ␮L of PCR product or plasmid DNA was subjected to the reaction. The qPCR was performed as follows: initial denaturation at 95 ◦ C for 10 min to activate DNA polymerase, 45 cycles of amplification with denaturation at 95 ◦ C for 10 s and annealing at 62 ◦ C to 58 ◦ C in 0.5 ◦ C cycle−1 increments for 10 s, and extension at 72 ◦ C for 15 s, and 1 cycle of 95 ◦ C for 60 s and 40 ◦ C for 60 s. Subsequently, the high-resolution melting curve analysis was performed by raising the temperature from 60 ◦ C to 97 ◦ C, with an increment of 0.11 ◦ C s−1 to obtain the melting curves. The melting-curve data was analyzed with the LightCycler 480 gene-scanning software module (Roche) to obtain the difference curves. Discrepancies among the difference curves of the samples were analyzed by the software.

2.6. Sequencing and phylogenetic analysis The PCR products obtained from clinical specimens using preamplification primers with KOD -Plus- Ver.2 and plasmid DNAs were sequenced with the BigDye cycle sequencing kit, version 3.1, and the 3130 genetic analyzer (Applied Biosystems). The preamplification primers and the universal M13 primers were used for sequencing reaction for the PCR products and plasmid DNAs, respectively. Nucleotide sequences were assembled using the program Sequencher version 4.2.2 (Gene Codes Corporation, Ann Arbor, MI) and aligned with Clustal W version 1.83 with previously assigned sequences of AstV-1 (GenBank accession number: L23513), -2 (GenBank accession number: L13745), -3 (AF141381), -4 (DQ344027), -5 (DQ28633), -6 (GQ495608), -7 (AF248738) and -8 (AF292073) as referential AstV sequences. The distances were calculated using Kimura’s two-parameter method (Kimura, 1980), and phylogenetic dendrogram from a bootstrap analysis with 1000 replicates were constructed by the neighbor-joining method.

A. Hata et al. / Journal of Virological Methods 200 (2014) 29–34

31

Fig. 1. Alignment of nucleotide sequences of partial ORF1b–ORF2 junction region of AstV serotypes. Primer binding sites for pre-amplification (AHAstV F1 and AHAstVR1) and HRM (AHAstV F2 and AHAstV R2) are indicated with arrows. Numbers shown both ends of the sequences indicate nucleotide position corresponding to AstV-1 (Oxford strain, GenBank accession number: L23513).

32

A. Hata et al. / Journal of Virological Methods 200 (2014) 29–34

Relative signal difference

40

0.05

AstV-1

20

TurkeyAstrovirus1/Y15936 F12 F8 F13 F5 & F6

AstV-2

0

AstV-3

-20

AstV-4

F10 F7 AstV-1 AstV-1/Oxford/L23513 F1 F2 AstV-5/Goiania/DQ028633 AstV-5 1000 1000 AstV-7/Oxford/AF248738 AstV-7 F3 AstV-3 1000 AstV-3/Berlin/AF141381 F4 1000 AstV-2/Oxford/L13745 AstV-2 998 AstV-4 AstV-8 1000 AstV-8/As20/AF292073 F9 F11 AstV-4/Guangzhou/DQ344027 AstV-6/192-BJ07/GQ495608 AstV-6 1000

AstV-5

-40

1000

AstV-6

-60

AstV-7 AstV-8

-80 83

84

85

86

87

Temperature (oC) Fig. 2. HRM different curves obtained from 105 copies/reaction of plasmid DNAs constructed from each serotype of isolated AstV strains. The curve obtained from AstV-7 was selected as a baseline. Pre-melt and post-melt temperatures in the normalization step were set as 77.17–80.00 ◦ C and 94.71–95.73 ◦ C, respectively. The threshold value in the temperature shift step was set as 5.

2.7. Nucleotide sequence accession numbers The nucleotide sequences determined in this study have been deposited in GenBank under accession numbers AB856988–AB856999.

AstV-1

AstV-5 AstV-7 AstV-3 AstV-2

AstV-4 & -8

AstV-6

Fig. 3. Phylogenetic tree of AstV strains using approximately 365 nt fragment at ORF1b–ORF2 junction region. Isolated strains (marked as “”) and strains from clinical specimens (marked as “䊉”) along with corresponding historical human strains and a turkey strain (turkey astrovirus1, as an out-group, GenBank accession number: Y159603) are included. Bootstrap values larger than 950 among 1000 replicates were shown on each branch.

3. Results 3.1. Development of HRM assay The nucleotide sequences of the 281 AstV strains were aligned, and a region located on the ORF1b–ORF2 junction region was selected as the target of the HRM assay. Based on the nucleotide sequence alignment, we designed a primer set for pre-amplification (AHAstVF1 and AHAstVR1) and an HRM primer set (AHAstV2F and AHAstV2R) that amplify 575 and 407 bp, respectively (Table 1 and Fig. 1). A nucleotide BLAST search of the primer sets showed no significant homology to non-AstV sequences, and we observed no cross-reactions with other human gastroenteritis viruses (genogroup II [GII] norovirus, poliovirus type 1, group A rotavirus, and adenovirus type 40) by the pre-amplification PCR and the HRM assay (data not shown). The primer set for pre-amplification amplified each serotype of isolated AstV genes successfully, and the PCR products were cloned to construct plasmid DNAs. Ten-fold serial dilutions of the plasmid DNAs (1.0 × 107 to 1.0 × 101 copies/reaction) were tested with the HRM assay (N = 3 for each dilution). For all serotypes, the HRM assay was able to amplify plasmid standard of as low as 1.0 × 101 copies/reaction (data not shown). The difference curves obtained from 105 copies/reaction of each type of plasmid DNAs were shown in Fig. 2. Each type of the plasmid DNAs generated

a distinguished difference curves from other types. As low as 102 copies/reaction of the DNA was enough for generating the distinguishable difference curve reproducibly for AstV-1, -4, -6, -7 and -8, while 103 copies/reaction was required for AstV-2 and -5 and 104 copies/reaction for AstV-3 (data not shown).

3.2. Characterization of AstV strains To characterize the AstV isolates and the AstV strains identified in clinical stool specimens, the nucleotide sequences of ORF1b–ORF2 region were determined and phylogenetic analysis was performed (Fig. 3). The isolated AstV were classified into different clusters except for AstV-4 and -8 that showed close phylogenetic distance (Fig. 3). Among the 13 AstV sequences derived from clinical stool specimens, 9, 2, and 2 strains were classified into AstV-1, -3, and AstV-4/8, respectively (Fig. 3). The nucleotide identity of the 13 AstV strains of clinical specimens is shown in Table 2.

Table 2 Sequence similarities among the AstVs in clinical samples using approximately 370 nt fragments on ORF1b–ORF2 junction region. Sample ID

F1

F2

F3

F4

F5

F6

F7

F8

F9

F10

F11

F12

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 F13

0.997 0.817 0.822 0.989 0.989 0.986 0.991 0.817 0.963 0.817 0.989 0.989

0.820 0.825 0.986 0.986 0.983 0.989 0.820 0.960 0.820 0.986 0.986

0.989 0.820 0.820 0.820 0.817 0.835 0.803 0.835 0.814 0.814

0.825 0.825 0.825 0.822 0.841 0.808 0.841 0.820 0.820

1.000 0.991 0.997 0.823 0.968 0.823 0.994 0.994

0.991 0.997 0.823 0.968 0.823 0.994 0.994

0.994 0.823 0.971 0.823 0.991 0.991

0.823 0.971 0.823 0.997 0.997

0.813 0.989 0.820 0.820

0.813 0.968 0.968

0.820 0.820

0.994

A. Hata et al. / Journal of Virological Methods 200 (2014) 29–34

33

those obtained from F5 and F6, which showed 100% of nucleotide identity (Fig. 4C). 4. Discussion

Fig. 4. HRM different curves obtained from clinical specimens. The curve obtained from F9 sample was selected as a baseline. Pre-melt and post-melt temperatures for the normalization step were set as 77.17–80.00 ◦ C and 94.71–95.73 ◦ C, respectively, for all analysis. (A) HRM different curves from all clinical specimens under the threshold value in the temperature shift step of 5. (B) HRM different curves from sample F5, F6 and F13 under the threshold value in the temperature shift step of 5. (C) HRM different curves from sample F5, F6 and F13 under the threshold value in the temperature shift step of 2.

3.3. Validation of HRM assay using AstVs in fecal specimens To validate the applicability of the newly developed HRM assay for the detection and differentiation of AstVs in clinical stool specimens, the 13 stool samples positive for AstV were tested with the HRM assay. Since the PCR for HRM assay failed to amplify AstV genomes in some samples, pre-amplification was conducted in advance to increase the assay sensitivity. All 13 clinical specimens were positive with the HRM assay following the pre-amplification. When the threshold value in the temperature shift step was set to be 5, all samples generated unique difference curves except for F5, F6 and F13 (Fig. 4A and B). When the threshold value was changed to be 2, the difference curve obtained from F13 was discriminated from

AstVs are divided into 8 different genotypes and a number of strains have been found in each genotype. In order to screen and identify subtype of AstVs, gene sequencing targeting 5 -end and 3 -end of ORF2, are used widely (Noel et al., 1995; Sakon et al., 2000; Guix et al., 2005). In this study, we designed AstV-universal primers and developed an HRM assay for detection and differentiation of AstV strains. The target region of the assay is around 400 nt fragment of ORF1b–ORF2 junction region that has both conserved and variable sequences (Fig. 1). The novel primer sets reacted successfully with 8 genotypes of AstVs and did not react with viral genes other than AstVs, indicating that our assay is broadly reactive and specific to AstVs. The phylogenetic analysis demonstrated that the amplicons of the PCR using internal primers allow genotyping of AstVs except for AstV-4 and -8. It is known that sequences of AstV-4 and -8 are related closely at 5 -end of ORF2 but are related more distantly at 3 -end of ORF2 (Méndez-Toss et al., 2000). Further, genetic variability is higher at 5 -end than at 3 -end of ORF2, indicating 3 -end of ORF2 is more suitable target for genotyping and further subtyping (Mustafa et al., 2000). However, its genetic diversity at 3 -end of ORF2 makes it difficult to design universal primer that can produce appropriate amplicon size for HRM (∼500 bp). Our HRM assay using plasmid DNAs differentiated AstV sequences of 8 different serotypes successfully. However, low copy number of template resulted in the occurrence of unexpected difference curve. As shown in this study, pre-amplification before the HRM assay is able to improve the sensitivity in case that the sample contains low number of AstVs. Sequencing analysis demonstrated that all amplicons obtained from the specimens differed at least 1 nucleotide with the exception of F5 and F6 strains, which showed 100% of nucleotide identity. The HRM assay discriminated the AstV sequences successfully. Therefore, the HRM assay is effective for molecular screening of outbreak samples to reduce the labor of nucleotide sequence by excluding samples containing identical sequences. Despite the 100% of nucleotide identity, F5 and F6 showed slightly different difference curves. This may be because degenerate primer was utilized. Employment of uniform primers was desirable but it is difficult to design HRM primers for AstVs without degeneration. This is one possible limitation for the assay. The optimization of HRM assay using plasmid DNAs revealed that required copy number for HRM assay varied depending on serotype. This may also be due to primer degeneration. Recently, novel AstV strains whose nucleotide sequences are highly divergent from the previously known AstVs were found (Finkbeiner et al., 2008a,b, 2009; Kapoor et al., 2009). As noted above, the newly designed primer sets were specific to the previously known AstVs and it is unlikely that the primer sets react with the novel strains. Future establishment of characterization methods for the novel AstV strains is desirable. The results indicate that our HRM assay is effective for molecular screening of outbreak samples. Although nucleotide sequencing is still essential to determine the genotypes and to characterize the AstV strains, our assay is effective to reduce the labor of the nucleotide sequence by excluding the samples that showed the same difference curves. Acknowledgement This study was supported by Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Corporation (JST).

34

A. Hata et al. / Journal of Virological Methods 200 (2014) 29–34

Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jviromet. 2014.01.023. References Curd, E., Pollinger, J., Toffelmier, E., Smith, T., 2011. Rapid influenza A detection and quantitation in birds using a one-step real-time reverse transcriptase PCR and high resolution melting. J. Virol. Methods 176, 125–130. De Grazia, S., Platia, M.A., Rotolo, V., Colomba, C., Martella, V., Giammanco, G.M., 2011. Surveillance of human astrovirus circulation in Italy 2002–2005: emergence of lineage 2c strains. Clin. Microbiol. Infect. 17, 97–101. De Grazia, S., Martella, V., Chironna, M., Bonura, F., Tummolo, F., Calderaro, A., Moschidou, P., Giammanco, G.M., Medici, M.C., 2013. Nationwide surveillance study of human astrovirus infections in an Italian paediatric population. Epidemiol. Infect. 141, 524–528. Dumonceaux, T.J., Mesa, C., Severini, A., 2008. Internally controlled triplex quantitative PCR assay for human polyomaviruses JC and BK. J. Clin. Microbiol. 46, 2829–2836. Finkbeiner, S.R., Allred, A.F., Tarr, P.I., Klein, E.J., Kirkwood, C.D., Wang, D., 2008a. Metagenomic analysis of human diarrhea: viral detection and discovery. PLoS Pathog. 4, e1000011. Finkbeiner, S.R., Kirkwood, C.D., Wang, D., 2008b. Complete genome sequence of a highly divergent astrovirus isolated from a child with acute diarrhea. Virol. J. 5, 117. Finkbeiner, S.R., Li, Y., Ruone, S., Conrardy, C., Gregoricus, N., Toney, D., Virgin, H.W., Anderson, L.J., Vinjé, J., Wang, D., Tong, S., 2009. Identification of a novel astrovirus (astrovirus VA1) associated with an outbreak of acute gastroenteritis. J. Virol. 83, 10836–10839. Gabbay, Y.B., Leite, J.P., Oliveira, D.S., Nakamura, L.S., Nunes, M.R., Mascarenhas, J.D., Heinemann, M.B., Linhares, A.C., 2007. Molecular epidemiology of astrovirus type 1 in Belém Brazil, as an agent of infantile gastroenteritis, over a period of 18 years (1982–2000): identification of two possible new lineages. Virus Res. 29, 166–174. Guo, L., Xu, X., Song, J., Wang, W., Wang, J., Hung, T., 2010. Molecular characterization of astrovirus infection in children with diarrhea in Beijing, 2005–2007. J. Med. Virol. 82, 415–423. Guix, S., Bosch, A., Pintó, R.M., 2005. Human astrovirus diagnosis and typing: current and future prospects. Lett. Appl. Microbiol. 41, 103–105. Hara, M., Yano, K., Utagawa, E., 2010. Rapid high-throughput development on highresolution melting (HRM) analysis for noroviruses. Kansenshogaku Zasshi 84, 315–316 (in Japanese). Kapoor, A., Li, L., Victoria, J., Oderinde, B., Mason, C., Pandey, P., Zaidi, S.Z., Delwart, E., 2009. Multiple novel astrovirus species in human stool. J. Gen. Virol. 90, 2965–2972. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Lee, H.K., Lee, C.K., Loh, T.P., Tang, J.W., Tambyah, P.A., Koay, E.S., 2011. Highresolution melting approach to efficient identification and quantification of

H275Y mutant influenza H1N1/2009 virus in mixed-virus-population samples. J. Clin. Microbiol. 49, 3555–3559. Lin, J.H., Tseng, C.P., Chen, Y.J., Lin, C.Y., Chang, S.S., Wu, H.S., Cheng, J.C., 2008. Rapid differentiation of influenza A virus subtypes and genetic screening for virus variants by high-resolution melting analysis. J. Clin. Microbiol. 46, 1090–1097. Madeley, C.R., Cosgrove, B.P., 1975. 28 nm particles in faeces in infantile gastroenteritis. Lancet 306, 451–452. Malasao, R., Maneekarn, N., Khamrin, P., Pantip, C., Tonusin, S., Ushijima, H., Peerakome, S., 2008. Genetic diversity of norovirus, sapovirus, and astrovirus isolated from children hospitalized with acute gastroenteritis in Chiang Mai, Thailand. J. Med. Virol. 80, 1749–1755. Marek, A., Günes, A., Schulz, E., Hess, M., 2010. Classification of fowl adenoviruses by use of phylogenetic analysis and high-resolution melting-curve analysis of the hexon L1 gene region. J. Virol. Methods 170, 147–154. Matsuda, Y., Qazi, Y., Iwaki, Y., 2011. A rapid and efficient method BK polyomavirus genotyping by high-resolution melting analysis. J. Med. Virol. 83, 2128–2134. Matsui, S.M., Greenberg, H.B., 2001. Astroviruses. In: Fileds, B.N., Peter, M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E., Knipe, D.M. (Eds.), Fields Vorlogy. Lippincott Williams & Wilkins, Philadelphia, pp. 811–824. Méndez-Toss, M., Romero-Guido, P., Munguía, M.E., Méndez, E., Arias, C.F., 2000. Molecular analysis of a serotype 8 human astrovirus genome. J. Gen. Virol. 81, 2891–2897. Mustafa, H., Palombo, E.A., Bishop, R.F., 2000. Epidemiology of astrovirus infection in young children hospitalized with acute gastroenteritis in Melbourne, Australia, over a period of four consecutive years, 1995–1998. J. Clin. Microbiol. 38, 1058–1062. Nadan, S., Walter, J.E., Grabow, W.O., Mitchell, D.K., Taylor, M.B., 2003. Molecular characterization of astroviruses by reverse transcriptase PCR and sequence analysis: comparison of clinical and environmental isolates from South Africa. Appl. Environ. Microbiol. 69, 747–753. Noel, J.S., Lee, T.W., Kurtz, J.B., Glass, R.I., Monroe, S.S., 1995. Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing. J. Clin. Microbiol. 33, 797–801. Sakon, N., Yamazaki, K., Utagawa, E., Okuno, Y., Oishi, I., 2000. Genomic characterization of human astrovirus type 6 Katano virus and the establishment of a rapid and effective reverse transcription-polymerase chain reaction to detect all serotypes of human astrovirus. J. Med. Virol. 61, 125–131. Schwab, K.J., 2007. Waterborne Gastroenteritis Viruses, in Human Viruses in Water. Elsevier B.V., Amsterdam, pp. 27–38 (Chapter 2). Tajiri-Utagawa, E., Hara, M., Takahashi, K., Watanabe, M., Wakita, T., 2009. Development of a rapid high-throughput method for high-resolution melting analysis for routine detection and genotyping of noroviruses. J. Clin. Microbiol. 47, 435–440. Verma, H., Chitambar, S.D., Gopalkrishna, V., 2010. Astrovirus associated acute gastroenteritis in western India: predominance of dual serotype strains. Infect. Genet. Evol. 10, 575–579. Wang, Q.H., Kakizawa, J., Wen, L.Y., Shimizu, M., Nishio, O., Fang, Z.Y., Ushijima, H., 2001. Genetic analysis of the capsid region of astroviruses. J. Med. Virol. 64, 245–255. Zhang, Z., Mitchell, D.K., Afflerbach, C., Jakab, F., Walter, J., Zhang, Y.J., Staat, M.A., Azimi, P., Matson, D.O., 2006. Quantitation of human astrovirus by real-time reverse-transcription-polymerase chain reaction to examine correlation with clinical illness. J. Virol. Methods 134, 190–196.