Original Article

ZEBRAFISH Volume 00, Number 00, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/zeb.2014.1012

Development and Use of Retinal Pigmented Epithelial Cell Line from Zebrafish (Danio rerio) for Evaluating the Toxicity of Ultraviolet-B Kalaiselvi S. Nathiga Nambi,1 Seepoo Abdul Majeed,1 Gani Taju,1 Sridhar Sivasubbu,2 Nithiyanandam Sundar Raj,1 Nithiyanandam Madan,1 and Azeez Sait Sahul Hameed1

Abstract

Danio rerio retinal pigmented epithelial (DrRPE) cell line, derived from the RPE tissue, was established and characterized. The cells were able to grow at a wide range of temperatures from 25C to 32C in Leibovitz’s L15 medium. The DrRPE cell line consists of epithelial cells with a diameter of 15–19 lm. The cell line was characterized by mitochondrial 12S rRNA gene, immunocytochemical analysis, and karyotyping. DrRPE cells treated with 10 lM of all-trans-retinol for 24 h readily formed lipid droplets. DrRPE cells were irradiated with narrowband ultraviolet-B (UV-B) radiation at different time periods of 0, 10, 20, and 40 min. The cells were subsequently examined for changes in morphology, cell viability, phagocytotic activity, mitochondrial distribution, nuclei morphology, generation of reactive oxygen species, and expression of apoptotic-related genes p53 and Cas3 by quantitative polymerase chain reaction. The results demonstrate that UV-B radiation can cause a considerable decrease in DrRPE cell viability as well as in phagocytotic activity. In addition, the results demonstrate that UV-B radiation can induce the degradation of mitochondria and DNA in cultured DrRPE cells.

retina is required for the visual signal, and the excess energy is thought to be absorbed mainly by the RPE.25 Similar to other melanin-producing cells, RPE cells are characterized by the presence of the melanosome, a lysosome-related organelle dedicated for the biosynthesis, and storage of melanin pigments.26 Furthermore, the RPE cells phagocytise and digest shed photoreceptor outer segment material. Dysfunction of RPE results in several eye diseases, including retinitis pigmentosa27 and age-related macular degeneration.28 Blanks et al.29 reported that light injures the RPE cells and photoreceptors by increasing the formation of reactive oxygen species (ROS), and that those antioxidants can rescue lightdamaged photoreceptors and RPE. The sun is the source of the full spectrum of ultraviolet (UV) radiation, which is commonly subdivided into UV-A (400–315 nm), UV-B (315–280 nm), and UV-C (280–100 nm). Among these, almost no UV-C reaches the earth’s surface, and it is estimated that about 1%–10% of UV radiation on the earth’s surface is UV-B and more than 90% is UV-A.30 Exposure to UV radiation invariably damages the living cells, with DNA being the major target for photochemical modification. UV-C and UV-B photons absorbed directly by DNA are most deleterious; however, UV-A can also damage

Introduction

C

ell culture has become one of the major tools in the life sciences these days. Tissue culture and the development of cell lines from fish are priorities for virological applications, carcinogenesis, toxicological studies, cellular physiology, and gene expression studies. The first fish cell line, designated as RTG-2, was developed in 1962 from gonad of rainbow trout (Oncorhynchus mykiss) and even these days, this cell line has tremendous applications in virological and toxicological studies.1 Since then, development of fish cell lines has progressed and the number of fish cell lines increased enormously to 283.2 Some of the areas in which fish cell lines have made significant contributions are virology,3–5 fish immunology,6,7 ecotoxicology,8–10 toxicology,11–17 endocrinology,18 biomedical research,19 disease control,20 biotechnology and aquaculture,21 and radiation biology.22 Cell cultures also offer the most suitable source for chromosome preparation for the application of banding techniques.23 The retinal pigment epithelium (RPE) is a thin monolayer of highly polarized and specialized cells underlining the retina and supports the function and development of photoreceptors.24 Only a small proportion of light entering the 1 2

OIE Reference Laboratory for WTD, PG and Research Department of Zoology, C. Abdul Hakeem College, Vellore, India. Institute of Genomics and Integrative Biology (IGIB), New Delhi, India.

1

2

DNA indirectly through the action of photosensitizers.31 The depletion of the ozone layer increases the levels of UV radiation, particularly UV-B, reaching the earth’s surface.32 Very few gene expression studies have been performed on RPE in zebrafish,33–35 which is partly due to the difficulty in obtaining intact RPE tissue. Several workers have developed continuous stable cell cultures from zebrafish, embryo, and adult tissues,36 ZF4 cell line derived from 1 day post fertilization (dpf) embryos,37 ZFL cell line derived from normal adult livers,38,39 zebrafish fibroblast-like cell lines ZF13 and ZF29 generated from 20 h embryos,40 zebrafish spleen cell line, ZSSJ,41 and PAC2 cell line from 24 h zebrafish embryos.42 Laale43 reported in vitro RPE migration and monolayer formation from blastoderm explants of zebrafish for the first time. Even these days, in vitro approaches utilizing RPE cell cultures for cellular and molecular studies of zebrafish have not been exploited due to the absence of suitable cell culture systems. In this context, this study describes the development and characterization of an RPE cell line of Danio rerio and its application to evaluate Ultraviolet-B (UV-B) toxicity. Materials and Methods RPE isolation, culture and passage

Young adult zebrafish wild-type outbred strains (3 months old, 4.0 cm in length, and 0.5 g in weight) were obtained from the zebrafish facility at the Institute of Genomics and Integrative Biology (IGIB), and transported live to the laboratory. The fish were maintained as described by Westerfield44 and reared at 28C in water containing 60 mg/L coral pro salt (Red sea) in reverse osmosis water.45 The animal protocols and procedures were approved by the Committee for the Purpose of Control and Supervision of Experiments on Animals, Ministry of Environment and Forests, Government of India. The fish were euthanized with 0.2% tricaine in water, wiped with 70% ethanol, and rinsed in sterile phosphatebuffered saline (PBS). Micro dissection of zebrafish RPE was performed based on the reference of Leung and Dowling33 with minor modifications. RPE tissues 10 mg, dissected from 15 fishes (i.e., 30 eyes), were combined; aseptically minced into small pieces (*1 mm3 in size); and washed four times in Leibovitz’s L-15 (GIBCO) medium containing antibiotic (500 lg/mL kanamycin and 2.5 lg/mL fungizone). The tissue fragments were inoculated into 12.5 cm2 cell culture flasks containing 3 mL of complete growth medium (L-15 supplemented with 20% fetal bovine serum [FBS]), antibiotic (kanamycin, 100 lg/mL), and fungizone (2.5 lg/mL). The flasks were incubated at 28C in a normal atmospheric incubator, and half the medium was changed every 3 or 4 days. On reaching 95% confluence, the cells were sub-cultured at a ratio of 1:2–1:3 following the standard trypsinization method using trypsin-ethylenediaminetetraaceticacid (EDTA) solution (trypsin 0.25%, EDTA 0.02%) in PBS. Growth studies

To determine the optimum temperature and serum concentration, the RPE cells were grown in different temperatures and FBS concentrations. Temperature effect was determined by seeding at a concentration of 106 cells/mL in 25 cm2 tissue culture flasks and incubation at 28C for 2 h for

NATHIGA NAMBI ET AL.

attachment. Then, the batches of culture flasks were incubated at temperatures of 25, 28, 32, 37, and 40C for growth studies. For five consecutive days, cell densities were measured using a hemocytometer and expressed as cells/mm2 following the protocol of Tong et al.46 The experiments were conducted in triplicate. The growth response to various concentrations of FBS (2%, 5%, 10%, 15%, and 20%) was studied using the same procedure as mentioned earlier, at 28C. Plating efficiency and doubling time

The Danio rerio retinal pigmented epithelial (DrRPE) cell line at the 45th passage was used to determine the plating efficiency. Plating efficiency of the cell line was determined at seeding concentrations of 100, 500, and 1000 cells per flask (25 cm2 tissue culture flasks) in duplicate. The cells were incubated at 28C in L-15 medium with 10% FBS. After 12 days, the medium was discarded and the cells were fixed with 5 mL of crystal violet (1%)–formalin (25%) stain fixative for 15 min, rinsed with tap water, and air dried. The stained colonies were then counted under an inverted microscope, and plating efficiency was calculated as described by Freshney.47 The population-doubling time of the DrRPE cell line was calculated using the methodology described by Freshney47 by cell counts in a hemocytometer at 37 and 60 passages. Cryopreservation

The DrRPE cells were cryopreserved in L-15 medium with 10% FBS and 10% dimethyl sulphoxide (DMSO) at a density of 106 cells/mL and stored in liquid nitrogen ( - 196C). For cryopreservation, 48- or 72 h-old cultures at different passage levels were used. The viability of cells after cryopreservation in liquid nitrogen was evaluated by the method described by Chen et al.48 Ribosomal RNA gene analysis by polymerase chain reaction

Template DNA for polymerase chain reaction (PCR) assays was prepared by extraction from RPE tissues and DrRPE cells following the method described by Lo et al.49 for authentication of origin of cell line from the same species. Briefly, the samples were homogenized separately in sodium chloride-tris-EDTA buffer (0.2 M NaCl, 0.02 M Tris-HCl and 0.02 M EDTA, pH 7.4) and centrifuged at 3000 g at 4C, after which the supernatant fluids were placed in fresh 1.5 mL centrifuge tubes along with an appropriate amount of digestion buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 50 mM EDTA, pH 8.0, 0.5% sodium dodecyl sulphate, and 0.1 mg/ mL proteinase K). After incubation at 65C for 2 h, the digests were deproteinized with successive phenol/chloroform/ iso-amyl alcohol extraction and DNA was recovered by ethanol precipitation, drying, and resuspension in Tris-EDTA buffer. Primers were designed based on the Genbank sequences of 12S rRNA gene of D. rerio using Primer Premier 5.0 software. The sequence of the primers used is provided in Table 1. A fragment of 237 bp was amplified. PCR was carried out in an Eppendorf thermal cycler (Eppendorf AG). Polymerase Chain Reaction Description and Conditions (Supplementary Data). Amplified products were analyzed in 1% agarose gels that were stained with ethidium bromide and

ZEBRAFISH RPE CELL LINE FOR TOXICITY OF UV-B

3

Table 1. Primers and Their Nucleotide Sequences Used in this Study Primers b-Actin F b-Actin R 12s F 12s R Cas3 F Cas3 R p53 F p53 R

Sequence (5¢-3¢)

GenBank accession no.

TCACCACCACAGCCGAAAG TCCGCAAGATTCCAAACCC GGGGACGAGGAGCAGGTAT GCCGTTTGGCTTTATTTT CCGCTGCCCATCACTA ATCCTTTCACGACCATCT CTATAAGAAGTCCGAGCATGTGG GGTTTTGGTCTCTTGGTCTTTCT

AF057040.1

visualized with a UV transilluminator. The fragment of 12S rRNA gene was sequenced by an (Applied Biosystem) ABI 3730 DNA Analyzer.

AC024175.3 NM131877 Deng et al.89 U60804 Sandrini et al.90

tion, at which point cell viability was evaluated. UV-B dose of different time periods (10, 20, and 40 min) on DrRPE cell line was chosen based on the cytotoxic effect by neutral red (NR) assay.

Morphological confirmation by cell-specific markers

Morphological confirmation of the DrRPE cells was done by immunocytochemical staining with antibodies against anti-RPE65, Cytokeratin 19, anti-Fibronectin, and antivimentin (Sigma-Aldrich) at the 35th passage following the protocol described by Shiras et al.50

Cell morphology. After 24 h of recovery, morphological changes of post-UV radiated RPE cells were observed using phase-contrast microscopy. In each exposure condition, 100 cells were randomly chosen and morphological changes were observed and compared with control cells.

Chromosomal analysis

Neutral red uptake assay. After UV-B exposure, DrRPE cell viability was assayed using neutral red assay (SigmaAldrich), where viable cells uptake and accumulate the dye in intracellular lysosomes, via active transport.52 In brief, cells were incubated with neutral red dye at a concentration of 0.033%, for 2 h at room temperature, and subsequently washed with HBSS. Cells were allowed to air dry for 20 min, and the retained dye was eluted using ice-cold solubilization buffer (1% acetic acid/50% ethanol; 300 lL). Twenty minutes later, 100 lL aliquots were transferred to 96-well plates and absorption was measured at 490 nm on a microplate reader (Thermo Electron Corporation).

Chromosomal analysis was carried out on DrRPE cell line at 39 passage level, following the protocol described by Freshney47 and Sahul Hameed et al.51 with minor modifications. Chromosome counts were performed in > 100 metaphase plates of DrRPE cell line. Transfection

DrRPE cells at the 50th passage were propagated in a sixwell plate at a density of 3.5 · 105 cells/well. Sub-confluent monolayers were transfected with 2 lg of pEGFP-N1 eukaryotic expression vector (Clontech) using lipofectamine 2000 (Invitrogen Corporation). After 24 h, the cells were observed under a fluorescence microscope (Carl Zeiss) for the presence of green fluorescence signal. Analysis of lipid droplet formation in DrRPE cell line

The DrRPE cells were seeded in 35 mm petri dishes at a density of 3.5 · 105 cells/well. Cells were incubated with 10 lM of all-trans-retinol (Sigma-Aldrich) for 24 h before imaging. The formations of lipid droplets were observed under a fluorescence microscope. In vitro UV-B irradiation

The DrRPE cells were seeded as described earlier. Cellfree culture supernatants were removed from confluent cells, and incubated with fresh media at 28C for 30 min before UV irradiation. The UV irradiation lamp (Philips) has a midrange wavelength of 311 nm and an exposure intensity of 7000 lW/cm2. After incubation, culture medium was aspirated and replaced with Hank’s Balanced Salt Solution (HBSS) for UV exposure. During the irradiation, the cultures were exposed to UV-B irradiation at 311 nm and unexposed cells served as controls. The cells were subsequently washed twice with HBSS, and cell-free culture supernatant was replaced. The experiment was concluded after 24 h of incuba-

Phagocytic activity assay. To observe the effect of UV-B on DrRPE phagocytic activity, microfluorometric phagocytosis assay was performed according to Wan et al.,53 with minor modifications. DrRPE cells were seeded at a density of 4000 cells per well into 96-well plates. After adherence overnight at 28C, half of the plate was exposed to UV-B for 10 min and the remaining half served as a control and was covered with aluminum foil to block UV exposure. A suspension of carboxylated fluorescent latex beads (Sigma) of 0.03 lm diameter was prepared by adding 0.2 lL of commercial bead (2.5% solid latex) to 1 mL of growth medium. Immediately after UV-B exposure, cells were incubated with fluorescent latex beads at a volume of 100 lL/well. After 4 h of incubation, the medium with microspheres was removed and extracellular fluorescent signals were quenched by adding 30 lL of trypan blue (1 mg/mL) per well. After 5 min, trypan blue was removed and the fluorescence intensity (relative fluorescence unit) was measured using a microplate reader with an excitation wavelength of 485 nm and an emission wavelength of 530 nm. Data analysis was based on the average of fluorescence values of at least five wells. Mitochondrial and nuclear morphologies. Fluorescent stains Hoechst 33258 (Sigma-Aldrich) and Rhodamine 123 (Sigma-Aldrich) were used to observe the changes in

4

morphologic features of nuclei and mitochondria of the cells after UV-B radiation. Hoechst 33258 is a cell-permeant nuclear stain that emits blue fluorescence when bound to dsDNA.54 A cationic dye Rhodamine 123 stains mitochondria in live cells in a membrane potential-dependent fashion.55 DrRPE cells were trypsinized, seeded at a density of 3.5 · 105/mL in Petri dishes, and grown to confluence at 28C for 24 h. The cells were then exposed to UV-B for 10 and 20 min and incubated for another 24 h; unexposed cells were kept as controls. Since only 17% of the cells were found to be viable by NR assay after 40 min of UV-B exposure, they were not included for this assay. After incubation, the medium was aspirated from each dish and rinsed with 1 mL of HBSS. After aspirating the HBSS, the cells were then stained with Rhodamine 123 (10 lg/mL) and Hoechst 33258 (0.05 lg/ mL) for 15 min at 28C. After 15 min of incubation, the dishes were rinsed once more with 1 mL of HBSS. Stained cells were examined, and photographs were taken (400 · magnification). The excitation/emission wavelengths for Hoechst 33258 and rhodamine 123 were 355/465 nm and 505/534 nm, respectively. Intracellular redox assay. ROS was detected using fluorescent probe 2¢,7¢-dichlorofluorescein diacetate (H2DCFDA; Sigma) as previously described.56 Aliquots of 10 mM H2DCF-DA were prepared in DMSO and stored at - 20C. The DrRPE cells were seeded as described earlier. Cells were allowed to attach and were subsequently exposed to UV-B for 10, 20, and 40 min. Unexposed cells served as controls. Immediately after UV-B exposure, cells were incubated for 1 h in the presence of 10 lM H2DCF-DA and ROS accumulations were observed. Quantification of apoptosis-related gene expression. The 2 - DDCT method as described by Livak and Schmittgen57 was

FIG. 1. Photomicrographs of Danio rerio cells derived from retinal pigmented epithelial (RPE) tissue. (A) Primary culture on the fifth day after tissue explantation shows RPE cell migration, and spreading (arrows) indicates binucleated cells. (B) Monolayer on passage 4 at 100· magnification (arrows) indicates perinuclear pigment granules. (C) Monolayer on passage 49 at 100· magnification and (D) monolayer on passage 75 at 200· magnification.

NATHIGA NAMBI ET AL.

used to determine the relative gene expression of apoptosisrelated genes (p53 and caspase 3) in DrRPE cell line exposed to UV-B for 20 min, which was the dose that affected viable cell number reduction by approximately 55% when compared with the control. After 12 h of exposure to UV-B, total RNA was extracted from DrRPE cell line. For total RNA extraction, the supernatant prepared from DrRPE cells was used and total RNA was extracted using TRIzol reagent (GIBCO-BRL, Life Technologies) according to the manufacturer’s protocol. RNA was treated with DNase1, according to the manufacturer’s protocol (New England Biolabs). Total RNA was further purified by Qiagen RNeasyR Mini kit and finally eluted in nuclease-free water. RNA was quantified by measuring absorbance at 260 and 280 nm on a NanoDrop 2000C Spectrophotometer (Thermo Scientific). First-strand cDNA was synthesized in accordance with the manufacturer’s protocol (New England Biolabs). Briefly, 1 lg of total RNA was mixed with 1 lL of primer and the final reaction was made up of 10 lL with Rnase-free water. The reaction mixture was carried out at 25C for 10 min and subsequently at 55C for at least 15 min. For reverse transcription (RT), the reaction mixture in 10 lL contained 5 · RT buffer, 1 lL RNase inhibitor, and 1 lL RT enzyme. The reaction was carried out at 37C for 60 min and was terminated by incubating the mixture at 95C for 5 min. The cDNA reaction products were quantified. The gene-specific primers used for real-time PCR analysis can be found in Table 1. The mRNA levels were determined by SYBR green quantitative realtime PCR Step One PlusTM system (Applied Biosystems). Reaction mixtures of 10 lL were analyzed in triplicate. Each PCR plate had a negative control. The PCR parameters consisted of 40 cycles of denaturation at 95C for 10 s followed by annealing at 55C for 20 s and extension at 72C for 20 s. The expression of apoptosis-related genes was normalized to the expression of b-actin gene.

ZEBRAFISH RPE CELL LINE FOR TOXICITY OF UV-B Data analysis

Statistical analysis was executed using Excel software. All data obtained from the experiments were analyzed using oneway analysis of variance ( p < 0.05 as significant level). Statistical calculations were performed using SPSS (version 16) software. Results are expressed as mean – standard error. A significance level of p < 0.05 was used for statistical testing.

5

analysis of the identified sequences demonstrated a 100% match for 12S rRNA region of the known mitochondrial DNA sequences from the D. rerio, which suggested that the DrRPE cell line originated from D. rerio. Antibodies such as RPE 65 and cytokeratin 19 were used to characterize the established RPE cell line of D. rerio immunophenotypically,

Results

Primary cell cultures were initiated from RPE of D. rerio by explant method. The cells grew well, formed a monolayer with mononucleate and binucleate cells with a diverse amount of pigment granules (Fig. 1A, B) within 10 days, and were sub-cultured at intervals of 3–9 days. The primary culture consisted of cells with an epithelial-like morphology. The RPE cell line has been sub-cultured more than 75 times and is designated as DrRPE cell line. Morphologically, the DrRPE cell line is composed of epithelial cells with a diameter of 15–19 lm (Fig. 1A–D). DrRPE cells exhibited different growths at temperatures between 25C and 32C. Maximum growth was observed at 28C. No significant growth was observed at 37C and 40C in the cells. The growth rate of DrRPE cells increased as the FBS concentration increased from 2% to 20% at 28C. The retinal pigmented cells exhibited good growth at 15% of FBS concentration (data not shown). Plating efficiency of the DrRPE cell line was determined by seeding 100, 500, and 1000 cells. DrRPE cells showed a very high plating efficiency, that is, 21.72 ( – 1.17), 39.95 ( – 1.90), and 59.18 ( – 1.21)% with no significant differences between replicates for 100, 500, and 1000 cells, respectively. Cell doubling time for the zebrafish RPE cell line was *40 h at passages 29 and 52. The DrRPE cell line was successfully cryopreserved at different passage levels (16, 21, 33, 46, 55, and 75) in liquid nitrogen, and the cells were recovered at different periods of storage (1, 3, 5, 8, and 12 months). The retinal pigmented cells recovered from the storage of different periods grew well and formed a confluence within 2–4 days. The average viability of the cells was estimated to be 75%–80%. Analysis of mitochondrial 12S rRNA was performed to verify the origin of this cell line. Amplification of the extracted DNA of 12s rRNA of D. rerio revealed the expected PCR product of 237 bp (Fig. 2). Subsequent comparative

FIG. 2. Agarose gel electrophoresis of polymerase chain reaction products (12S rRNA gene 237 bp) from Danio rerio retinal pigmented epithelial (DrRPE) cells and zebrafish RPE tissue. Lane M 100 bp marker; lane N negative control; lane 1 RPE tissue of zebrafish; lane 2 DrRPE cell line.

FIG. 3. Immunoflurosence labeling of DrRPE cell line (A) RPE65, (B) Cytokeratin 19 and (C) Fluorescent images of RPE65 and Cytokeratin 19 overlapped and the nucleus stained with Hoechst (at 200· magnification).

6

NATHIGA NAMBI ET AL.

FIG. 4. Chromosome number distribution at (A) passages 35 and (B) metaphase. In total, 100 metaphases were counted. (C) Expression of GFP gene in DrRPE cell line at passage 45 transfected with pEGFP-N1 at 100 · magnification. (D) All-transretinol-treated DrRPE cell line shows lipid droplets in the cytoplasm (at 200 · magnification).

and the results are shown in Figure 3A–C. DrRPE cells of zebrafish were positive for RPE 65 and cytokeratin 19. The results of chromosome counts of 100 metaphase plates from D. rerio RPE cells at passage 36 showed a diploid number ranging from 38 to 53 with a modal peak at 50 chromosomes (Fig. 4A, B). The DrRPE cell line was successfully transfected using pEGFP-N1 plasmid with lipo-

FIG. 5. Morphological alterations of DrRPE cell line exposed to ultraviolet-B (UVB) at different time periods (A) control; (B) 10 min of exposure (arrows) indicates bleb formation; (C) 20 min of exposure (arrows) indicates cells with multiple vacuolation; and (D) 40 min of exposure (arrows) indicates cell shrinkage and rounding of cells along with dryness (at 200· magnification).

fectamine 2000. The localization of the GFP signal in DrRPE cells appears uniformly and is distributed throughout the cytoplasm and nucleus (Fig. 4C). The expression of strong green fluorescence in the DrRPE cell line could be detected as early as 20 h after transfection. Retinosome formation was observed in DrRPE cell line after 24 h of incubation with 10 lM all-trans-retinol. Retinosomes appeared as green

ZEBRAFISH RPE CELL LINE FOR TOXICITY OF UV-B

FIG. 6. Viability of DrRPE cells after 10, 20, and 40 min of exposure to UV-B light by neutral red assay. Values are relative to the control group and expressed as mean – standard error (SE). The asterisk represents a statistically significant difference when compared with controls; at *p < 0.05 levels.

7

changes in the morphology of mitochondria and nucleus. DrRPE cells exposed to UV-B for 10 min showed shorter mitochondria and condensed nuclei (Fig. 8B); whereas in the control cells, mitochondria appeared as rope-like structures (Fig. 8A). Twenty minutes of UV-B exposure showed an increasing degradation of mitochondria distributed throughout the cytoplasm and fragmented nuclei (Fig. 8C). Overall, increasing time periods of UV-B radiation on DrRPE cells showed time-dependent degradation of mitochondria and nucleus, suggesting that DNA in RPE cells is possibly the most vulnerable to UV radiation. RPE cells showed a significant elevation of ROS generation immediately after UV-B exposure at time periods of 10, 20, and 40 min. In addition, UV-B causes ROS generation in a time-dependent manner in DrRPE cell line (Fig. 9A–D).

punctate signals in the cytoplasm after incubation with alltrans-retinol (Fig. 4D), whereas no signal was seen in cells without all-trans retinol with ‘‘data not shown.’’ Cytotoxicity of UV-B on DrRPE was evaluated by studying cellular morphology under control and exposed conditions. In DrRPE cells, 18% developed blebs (Fig. 5A) after 10 min of UV exposure (Fig. 5B). About 25% of cells showed membrane rupture, and 15% showed apoptotic features such as large vacuoles after 20 min of UV exposure (Fig. 5C). With 40 min of exposure, around 75%–80% of the cells showed cell shrinkage and cell rounding along with dryness (Fig. 5D). DrRPE cells showed a time-dependent reduction in lysosomal membrane integrity after 10, 20, and 40 min of UV-B exposure in comparison to control (Fig. 6). In this study, fluorescent microbeads were used to observe the effects of UV-B radiation on DrRPE cell phagocytotic activity. Phagocytic activity is presented as mean fluorescence of the ingested microspheres. The control cells have significantly greater capacities of uptake than UV-B-exposed cells (Fig. 7). UV-B radiation exposure for 10 min decreased phagocytotic activity of DrRPE cells. After irradiation, both control and UV-exposed cells were stained with Hoechst 33258 (double-strand DNA-blue) and Rhodamine 123 (mitochondria green), in order to study the

FIG. 7. Effect of UV-B exposure on the phagocytotic activity of DrRPE cell line. Values are relative to the control group and expressed as mean – SE. The asterisk represents a statistically significant difference when compared with controls; at *p < 0.05 levels.

FIG. 8. Fluorescence microscopy images showing the effect of UV-B radiation on distributions of the mitochondria (Rhodamine 123) and nucleus (Hoechst 33258) in DrRPE cell line. (A) Control, (B) 10 min (arrows) indicates shorter mitochondria and condensed nuclei and (C) 20 min (arrows) indicate mitochondria distribution throughout the cytoplasm and fragmented nuclei (at 200· magnification).

8

NATHIGA NAMBI ET AL.

FIG. 9. Reactive oxygen species assessed by 2¢,7¢-dichlorofluorescein diacetate after exposure to different time points of UV-B exposure. (A) Control, (B) 10 min, (C) 20 min, and (D) 40 min (at 100· magnification).

The mRNA level of p53 increased significantly in the DrRPE cell line exposed to UV-B for 20 min, with an increase of *4.90-fold compared with the control cells (Fig. 10A). To assess whether UV-B induces apoptosis via the caspase pathway, the transcription of the key gene Cas3 was examined. The mRNA level of Cas3 was significantly upre-

FIG. 10. Expression of (A) p53 and (B) Cas3 in DrRPE cells exposed to UV-B for 20 min. Values were normalized against b-actin and represent the mean mRNA expression value – SE relative to those of the controls. The asterisk represents a statistically significant difference when compared with controls; at *p < 0.05 levels.

gulated by *5.04-fold in UV-B exposed cells (Fig. 10B). The increase was found to be significant (*p < 0.05) when compared with control cells. Discussion

Primary cell cultures initiated by explant method from RPE tissue of D. rerio formed a monolayer with mononucleate and binucleated cells with a diverse amount of pigment granules within 10 days. Although a few binucleated pigment cells were observed, the majority of them were mononucleate. The observation agrees with the previous findings on cultured zebrafish primary retinal pigmented cells derived from blastoderm explants43 and human retinal pigment cells.58 The explant method has many advantages over trypsinization technique in terms of rapidity, maintenance of cell interactions, and the evasion of enzymatic digestion, which may damage the cell surface.59 During cell passages, the DrRPE cells gradually lost their melanin granules, as has been previously observed with other RPE cell cultures43,60–62; the loss of pigmentation in retinal cells may not involve permanent alteration of melanotic capability.63 The DrRPE cell line has been passaged more than 75 times over a period of 2 years. Optimum growth of DrRPE cells was observed at 28C. Collodi et al.36 reported optimum temperature of 26C for zebrafish cell cultures derived from embryo and adult tissues. FBS concentration at 15% was found to be the optimum for the growth of DrRPE cells. Recently Xing et al.41 reported that 15% FBS was well suited to culture spleen (ZSSJ) and blastula-stage embryo (ZEB2J) cell lines of zebrafish. The plating efficiency was determined for zebrafish RPE cell line, and the results revealed a very high plating efficiency (59.18%) when the cells were seeded at the rate of 1000 cells per flask. Taju et al.14 recorded a plating efficiency of 41% in ICG cell line of Catla catla. Doubling time of the DrRPE cell line was *40 h in L-15 medium supplemented

ZEBRAFISH RPE CELL LINE FOR TOXICITY OF UV-B

with 10% FBS. Ghosh et al.39 reported that ZF-L cell line derived from adult zebrafish liver cultured in LDF (50% Leibovitz L-15/35% Dulbecco’s modified Eagle’s/15% Ham’s F12 media) basal nutrient medium supplemented with insulin, epidermal growth factor, trout embryo extract, trout serum, and FBS had a doubling time of *72 h. A recovery of approximately 75%–80% of the DrRPE cells after thawing after cryopreservation was observed, with no changes in their normal growth, doubling time, and attachment ability and morphology. Paw and Zon64 reported earlier that the recovery rate of D. rerio primary fibroblasts cells was *60%–70%. Immunostaining revealed that the DrRPE cell line was positive to RPE65 and cytokeratin-19, suggesting that the established RPE cell line has a RPE origin. Akrami et al.65 reported an identical result of immunostaining in human RPE cell line. It was essential to check RPE cells for existence of cytokeratine filaments, as these are intermediate keratin filaments present in the cytoskeleton of epithelial cells.65 DrRPE cell line could convert all-trans-retinol to retinyl esters and form lipid droplets. Previous studies with human RPE cell line (ARPE19) also found that treatment with 100 lM oleate or 10–20 all-trans-retinol resulted in formation of lipid droplets.66 Exposure to UV-B light resulted in morphological alteration such as bleb formation, membrane rupture, apoptotic features with vacuoles, cell shrinkage, and rounding of cells along with dryness. A similar result was reported by Balaiya et al.67 in ARPE-19 cells at various time points of UVB exposure. UV-B light exposure is cytotoxic to DrRPE cells in a dose-dependent manner and decreases cell viability. A previous study reported that UV-B was highly cytotoxic to RGC-5 and ARPE-19 cells as shown by a clear reduction of metabolic activity.67 The RPE performs many important functions for the maintenance of outer retina, including transferring nutrients from the choriocapillaris to the neural retina, phagocytosis of the distal tips of outer segments, and visual pigment recycling.68–70 Measurements of intake by RPE cells using fluorescent microbeads have been used in many in vitro photocytotoxicity studies of bovine, human, and rabbit RPE cells.71,72 Findings from previous studies as well as this work indicate that the use of fluorescent microbeads may be a sensitive tool for monitoring UV-induced changes in phagocytitic activity of RPE cells. About 90% of the oxygen consumed in eukaryotes is used for mitochondrial respiration, and, therefore, mitochondrion represents the chief site for the production of oxygen-derived free radicals caused by UV radiation.73 Moreover, there are clear relationships between mitochondrial dysfunction and apoptosis,74 hence evaluating mitochondrial damage after UV exposure is important. Rhodamine 123 is a lipophilic water-soluble cationic dye that stains mitochondria of live cells in a membrane potential dependent fashion.55 Youn et al.75–77 reported that mitochondrion represents a major site of phototoxicity induced by UV radiation in RPE cell culture models. Findings of this study in DrRPE cell line confirm the fact that UV-B radiation induced mitochondrial changes in living DrRPE cells. DNA is one of the key targets for UV-induced damage in a diversity of organisms ranging from bacteria to humans.78,79 DNA damage after UV exposure was analyzed in DrRPE cell line using Hoechst 33258, a cell-permanent nucleic acid stain

9

that emits blue fluorescence when bound to dsDNA.80 Apoptosis in animal cells is regarded as chromatin condensation and DNA fragmentation.81 A similar observation was made in this study in DrRPE cells exposed to UV-B. This study clearly shows that increasing the time periods of UV-B radiation induced progressive nucleic acid damage, showing reduced fluorescence distribution on DNA. A similar observation was previously made by Youn et al.75 in cultured human RPE cells exposed to UV-B. UV-B light exposure is cytotoxic to DrRPE cells, resulting in a dose-dependent reduction in cell viability and an increase in ROS, indicating that UV-B exposure involves oxidative stress. Similar results have been reported by Balaiya et al.67 in ARPE-19 cells exposed to different time periods of UV-B light. De La Paz and Anderson82 reported that light exposure enhances lipid peroxidation of cellular membranes by triggering photo-oxidation reactions, resulting in the formation of ROS. Masaki et al.56 reported time-dependent profile of intracellular ROS levels in HaCaT keratinocytes immediately after UV-B-R as seen in this work in DrRPE cell line. The production of ROS and the resulting oxidative stress was shown to be a major apoptotic signal.83 ROS are known to trigger the apoptotic cascade, via caspases, which are considered the executioners of apoptosis.84 The p53 is a key regulator of apoptosis induction, and its activation is an effective indicator that the cell has entered an apoptotic state.85 Caspase-3 is a well-known key executor of apoptosis, and is one of the most important caspases to be activated downstream in apoptosis pathways.86 The expression of p53 and cas3 gene after 20 min of exposure supports the role of UV-B in the induction of apoptosis in DrRPE cell line. Similar observations have been recorded in murine lenses in vivo after 1 week of exposure to UVR at 300 nm.87 It is well known that there are close relationships between oxidative stress and DNA damage. ROS is known to induce oxidative damage of DNA, strand breaks, and base and nucleotide modifications, predominantly in sequences with high guanosine content.88 In conclusion, the zebrafish RPE cell line DrRPE was developed and characterized. In addition, its application to evaluate the toxic effect of UV-B on DrRPE cell line was also studied. To our knowledge, this is the first permanent RPE cell line from zebrafish. Results of this study demonstrate that DrRPE has functional properties of RPE cells in vivo and that it also has all potential characteristics of mammalian RPE cells. This cell line will be a valuable tool for in vitro studies of RPE physiology. DrRPE cell line is easy and cost effective to maintain in the laboratory. Acknowledgments

The first author is a recipient of Senior Research Fellowship award from the Indian Council of Medical Research (ICMR), government of India, New Delhi, India. The authors are grateful to the Management of C. Abdul Hakeem College, Melvisharam, India, for providing the facilities to carry out this work. This work was funded by the Department of Biotechnology, government of India, New Delhi, India. Disclosure Statement

No competing financial interests exist.

10

NATHIGA NAMBI ET AL.

References

1. Wolf K, Quimby MC. Established eurythermic line of fish cells in vitro. Science 1962;135:1065–1066. 2. Lakra WS, Raja Swaminathan T, Joy KP. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol Biochem 2011;37:1–20. 3. Wolf K: Viral hemorrhagic septicemia. In: Fish Viruses and Fish Viral Diseases. Wolf K (ed), pp. 217–248, Cornell University Press, Ithaca, NY, 1988. 4. Parameswaran V, Ishaq Ahmed VP, Ravi S, Bhonde RR, Sahul Hameed AS. Development and characterization of two new cell lines from milkfish (Chanos chanos) and grouper (Epinephelus coioides) for virus isolation. Mar Biotechnol 2007;9:281–291. 5. Sarath Babu V, Chandra V, Nambi KSN, Majeed SA, Taju G, Patole MS, et al. Development and characterization of novel cell lines from Etroplus suratensis and their applications in virology, toxicology and gene expression. J Fish Biol 2012;80:312–334. 6. Bols NC, Brubacher JL, Ganassin RC, Lee LEJ. Ecotoxicology and innate immunity in fish. Dev Comp Immunol 2001;25:853–873. 7. Clem LW, Bly JE, Wilson M, Chinchar VG, Stuge T, Barker K, et al. Fish immunology: the utility of immortalized lymphoid cells a mini reviews. Vet Immunol Immunopathol 1996;54:137–144. 8. Castano A, Bols N, Braunbeck T, Dierickx P, Halder M, Isomaa B, et al. The use of fish cells in ecotoxicology. Altern Lab Anim 2003;31:317–351. 9. Fent K. Fish cell lines as versatile tools in ecotoxicology: assessment of cytotoxicity, cytochrome P4501A induction potential and estrogenic activity of chemicals and environmental samples. Toxicol In Vitro 2001;15:477–488. 10. Schirmer K. Proposal to improve vertebrate cell cultures to establish them as substitutes for the regulatory testing of chemicals and effluents using fish. Toxicol 2006;224:163–183. 11. Babich H, Borenfreund E. Cytotoxicity and genotoxicity assays with cultured fish cells: a review. Toxicol In Vitro 1991;5:91–100. 12. Segner H. Fish cell lines as a tool in aquatic toxicology. EXS 1998;86:1–38. 13. Taju G, Abdul Majeed S, Nambi KSN, Sarath Babu V, Vimal S, Kamatchiammal S, et al. Comparison of in vitro and in vivo acute toxicity assays in Etroplus suratensis (Bloch, 1790) and its three cell lines in relation to tannery effluent. Chemosphere 2012;87:55–61. 14. Taju G, Abdul Majeed S, Nambi KSN, Sahul Hameed AS. Development and characterization of cell line from the gill tissue of Catla catla (Hamilton, 1822) for toxicological studies. Chemosphere 2013;90:2172–2180. 15. Taju G, Abdul Majeed S, Nambi KSN, Sahul Hameed AS. In vitro assay for the toxicity of silver nanoparticles using heart and gill cell lines of Catla catla and gill cell line of Labeo rohita. Comp Biochem Physiol Part C 2014;161: 41–52. 16. Abdul Majeed S, Nambi KSN, Taju G, Sundar Raj N, Madan N, Sahul Hameed A.S. Establishment and characterization of permanent cell line from gill tissue of Labeo rohita (Hamilton) and its application in gene expression and toxicology. Cell Biol Toxicol 2013;29:59–73. 17. Abdul Majeed S, Nambi KSN, Taju G, Sarath Babu V, Farook MA, Sahul Hameed AS. Development and characterization of a new gill cell line from air breathing fish

18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.

30. 31. 32. 33. 34. 35.

36. 37. 38.

Channa striatus (Bloch 1793) and its application in toxicology: Direct comparison to the acute fish toxicity. Chemosphere 2014;96:89–98. Bols NC, Lee LEJ. Technology and uses of cell culture from tissues and organs of bony fish. Cytotechnol 1991;6: 163–187. Hightower LH, Renfro JL. Recent applications of fish cell culture to biomedical research. J Exp Zool 1988;248:290– 302. Villena AJ. Applications and needs of fish and shellfish cell culture for disease control in aquaculture. Rev Fish Bio Fisher 2003;13:111–140. Bols NC. Biotechnology and aquaculture: the role of cell cultures. Biotechnol Adv 1991;9:31–49. Ryan LA, Seymour CB, O’Neill-Mehlenbacher A, Mothersill CE. Radiation-induced adaptive response in fish cell lines. J Environ Radioact 2008;99:739–747. Blaxhall PC. Chromosome karyotyping of fish using conventional and G-banding methods. J Fish Biol 1983;22: 417–424. Strauss O. The retinal pigment epithelium in visual function. Physiol Rev 2005;85:845–881. Bok D. The retinal pigment epithelium: a versatile partner in vision. J Cell Sci 1993;17:189–195. Marks MS, Seabra MC. The melanosome: membrane dynamics in black and white. Nat Rev Mol Cell 2001;2:738– 748. Phelan JK, Bok D. A brief review of retinitis pigmentosa and the identified retinitis pigmentosa genes. Mol Vis 2000;6:116–124. Green WR. Histopathology of age-related macular degeneration. Mol Vis 1999;5:27. Blanks JC, Pickford MS, Organisciak DT. Ascorbate treatment prevents accumulation of phagosomes in RPE in light damage. Invest Ophthalmol Vis Sci 1992;33:2814– 2821. Latonen L, Laiho M. Cellular UV damage responses— functions of tumor suppressor p53. Biochim Biophys Acta 2005;1755:71–89. Reme C, Reinboth J, Clausen M, Hafezi F. Light damage revisited: converging evidence, diverging views? Graefes Arch Clin Exp Ophthalmol 1996;234:2–11. Kerr JB, McElroy CT. Evidence for large upward trends of UV-B radiation linked to ozone depletion. Science 1993;262:1032–1034. Leung YF, Dowling JE. Gene expression profiling of zebrafish embryonic retina. Zebrafish 2005;2:269–283. Leung YF, Ma P, Dowling JE. Gene expression profiling of zebrafish embryonic retinal pigment epithelium in vivo. Invest Ophthalmol Vis Sci 2007;48:881–890. Higdon CW, Mitra RD, Johnson SL. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin. PLoS One 2013;8:1–16. Collodi P, Kamei Y, Sharps A, Ernst T, Barnes DW. Culture of cells from zebrafish (Brachydanio rerio) embryo and adult tissues. Cell Biol Toxicol 1992;8:43–61. Driever W, Rangini Z. Characterization of a cell line derived from zebrafish (Brachydanio rerio) embryos. In Vitro Cell Dev Biol Anim 1993;29A:749–754. Miranda CL, Collodi P, Zhao X, Barnes DW, Buhler DR. Regulation of cytochrome P450 expression in a novel liver cell line from zebrafish (Brachydanio rerio). Arch Biochem Biophys 1993;305:320–327.

ZEBRAFISH RPE CELL LINE FOR TOXICITY OF UV-B

39. Ghosh C, Zhou Y, Collodi P. Derivation and characterization of a zebrafish liver cell line. Cell Biol Toxicol 1994; 10:167–176. 40. Peppelenbosch MP, Tertoolen LG, de Laat SW, Zivkovic D. Ionic responses to epidermal growth factor in zebrafish cells. Exp Cell Res 1995;218:183–188. 41. Xing JG, El-Sweisi W, Lee LE, Collodi P, Seymour C, Mothersill C. Development of a zebrafish spleen cell line, ZSSJ, and its growth arrest by gamma irradiation and capacity to act as feeder cells. In Vitro Cell Dev Biol Anim 2009;45:63–174. 42. Senghaas N, Koster RW. Culturing and transfecting zebrafish PAC2 fibroblast cells. Cold Spring Harb Protoc 2009; 6:5235. 43. Laale HW. Fish embryo culture: migration and spreading of zebrafish (Brachydanio rerio) pigmented retinal epithelium. In Vitro 1981;17:701–705. 44. Westerfield M: The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). pp. 1.1–1.27. University of Oregon Press, Eugene, OR, 1995. 45. Esaki M, Hoshijima K, Kobayashi S, Fukuda H, Kawakami K, Hirose S. Visualization in zebrafish larvae of Na + uptake in mitochondria-rich cells whose differentiation is dependent on foxi3a. Am J Physiol Regul Integr Comp Physiol 2007;292:R470–R480. 46. Tong SL, Lee H, Miao HZ. The establishment and partial characterization of a continuous fish cell line FG-9307 from the gill of flounder Paralichthys olivaceus. Aquaculture 1997;156:327–333. 47. Freshney RI: Culture of Animal Cells: A Manual of Basic Technique. Wiley-Liss, New York, 1994. 48. Chen SL, Sha ZX, Ye HQ. Establishment of a pluripotent embryonic cell line from sea perch (Lateolabrax japonicus) embryos. Aquaculture 2003;218:141–151. 49. Lo CF, Leu JH, Ho CH, Chen CH, Peng SE, Chen YT, et al. Detection of baculovirus associated with white spot syndrome (WSSV) in penaeid shrimps using polymerase chain reaction. Dis Aquat Organ 1996;25:133–141. 50. Shiras A, Bhosale A, Shepal V, Ravi S, Baburao VS, Prabhakara K, et al. A unique model system for tumor progression in GBM comprising two developed human neuro-epithelial cell lines with differential transforming potential and coexpressing neuronal and glial markers. Neoplasia 2003;5:520–532. 51. Sahul Hameed AS, Parameswaran V, Ravi S, Singh B, Ramesh B. Establishment and characterization of India’s first marine fish cell line (SISK) from kidney of sea bass (Lates calcarifer). Aquaculture 2006;257:92–103. 52. Borenfreund E, Puerner JA. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicol Lett 1985;24:119–124. 53. Wan CP, Park CS, Lau BH. A rapid and simple microfluorometric phagocytosis assay. J Immunol Methods 1993; 162:1–7. 54. Oriowo OM, Cullen AP, Sivak JG. Impairment of eye lens cell physiology and optics by broadband ultraviolet A–ultraviolet B radiation. J Photochem Photobiol B Biol 2002;76:361–367. 55. Darzynkiewicz Z, Traganos F, Staiano-Coico L, Kapuscinski J, Melamed MR. Interaction of rhodamine 123 with living cells studied by flow cytometry. Cancer Res 1982;42:799–806. 56. Masaki H, Izutsu Y, Yahagi S, Okano Y. Reactive oxygen species in HaCaT keratinocytes after UVB irradiation are

11

57. 58. 59. 60. 61.

62. 63. 64. 65.

66.

67.

68. 69. 70. 71.

72.

73. 74. 75.

triggered by intracellular Ca2 + levels. J Investig Dermatol Symp Proc 2009;14:50–52. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDC (T) method. Methods 2001;25:402–408. Albert DM, Tso MO, Rabson AS. In vitro growth of pure cultures of retinal pigment epithelium. Arch Ophthalmol 1972;88:63–69. Avella M, Berhaut J, Payan P. Primary culture of gill epithelial cells from the sea bass Dicentrarchus labrux. In Vitro Cell Dev Biol 1994;30A:41–49. Nabi IR, Mathews AP, Cohen-Gould L, Gundersen D, Rodriguez-Boulan E. Immortalization of polarized rat retinal pigment epithelium. J Cell Sci 1993;104(Pt 1): 37–49. Davis AA, Bernstein PS, Bok D, Turner J, Nachtigal M, Hunt RC. A human retinal pigment epithelial cell line that retains epithelial characteristics after prolonged culture. Invest Ophthalmol Vis Sci 1995;36:955–964. Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland LM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res 1996;62:155–169. Whittaker JR. Loss of melanotic phenotype in vitro by differentiated retinal pigment cells: demonstration of mechanisms involved. Dev Biol 1967;15:553–574. Paw BH, Zon LI. Primary fibroblast cell culture. Method Cell Biol 1999;59:39–43. Akrami H, Soheili ZS, Khalooghi K, Ahmadieh H, RezaieKanavi M, Samiei S, et al. Retinal pigment epithelium culture; a potential source of retinal stem cells. J. Ophthalmic. Vis Res 2009;4:134–141. Orban T, Palczewska G, Palczewski K. Retinyl ester storage particles (retinosomes) from the retinal pigmented epithelium resemble lipid droplets in other tissues. J Biol Chem 2011;286:17248–17258. Balaiya S, Murthy RK, Brar VS, Chalam KV. Evaluation of ultraviolet light toxicity on cultured retinal pigment epithelial and retinal ganglion cells. Clin Ophthalmol 2010;4: 33–39. Young RW. The renewal of photoreceptor cell outer segments. J Cell Biol 1967;33:61–72. Young RW, Bok D. Participation of the retinal pigment epithelium in the rod outer segment renewal process. J Cell Biol 1969;42:392–403. La Vail MM. Rod outer segment disk shedding in rat retina: relationship to cyclic lighting. Science 1976;194:1071– 1074. Nilsson SE, Sundelin SP, Wihlmark U, Brunk UT. Aging of cultured retinal pigment epithelial cells: oxidative reactions, lipofuscin formation and blue light damage. Doc Ophthalmol 2003;106:13–16. Seagle BL, Gasyna EM, Mieler WF, Norris, JRJ, Jr. Photoprotection of human retinal pigment epithelium cells against blue light induced apoptosis by melanin free radicals from Sepia officinalis. Proc Natl Acad Sci U S A 2006;103:16644–16648. Raha S, Robinson BH. Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem Sci 2000;25:502–508. Vermeulen K, Van Bockstaele DR, Berneman ZN. Apoptosis: mechanisms and relevance in cancer. Ann Hematol 2005;84:627–639. Youn HY, Bantseev V, Bols NC, Cullen AP, Sivak JG. In vitro assays for evaluating the ultraviolet B-induced damage in cultured human retinal pigment epithelial cells. J Photochem Photobiol 2007;88:21–28.

12

76. Youn HY, Cullen AP, Chou BR, Sivak JG. Phototoxicity of ultraviolet (UV) radiation: evaluation of UV-blocking efficiency of intraocular lens (IOL) materials using retinal cell culture and in vitro bioassays. Open Toxicol J 2010;4:3–20. 77. Youn HY, McCanna DJ, Sivak JGLW. ones In vitro ultraviolet-induced damage in human corneal, lens, and retinal pigment epithelial cells. Mol Vis 2011;7:237–246. 78. Peak MJ, Peak JG, Moehring P, Webb RB. Ultraviolet action spectra for DNA dimer induction, lethality and mutagenesis in Escherichia coli with emphasis on the UVB. Photochem Photobiol 1984;40:613–620. 79. Stein B, Rahmsdorf HJ, Steffen A, Litfin M, Herrlich P. UV induced DNA damage is an intermediate step in UVinduced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein. Mol Cell Biol 1989;9:5169–5181. 80. Mocharla R, Mocharla H, Hodes ME. A novel, sensitive fluorometric staining technique for the detection of DNA in RNA preparations. Nucleic Acids Res 1987;15:10589. 81. Ricci MS, Zong WX. Chemotherapeutic approaches for targeting cell death pathways. Oncologist 2006;11:342– 357. 82. De La Paz M, Anderson RE. Region and age-dependent variation in susceptibility of the human retina to lipid peroxidation. Invest Ophthalmol Vis Sci 1992;33:3497–3499. 83. Livingstone DR. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar Pollut Bull 2001;42:656–666. 84. Fadeel B, Ahlin A, Henter JI, Orrenius S, Hampton MB. Involvement of caspases in neutrophil apoptosis: regulation by reactive oxygen species. Blood 1998;92:4808–4818.

NATHIGA NAMBI ET AL.

85. Wang T, Chen F, Chen Z, Wu YF, Xu XL, Zheng S, et al. Honokiol induces apoptosis through p53-independent pathway in human colorectal cell line RKO. World J Gastroenterol 2004;10:2205–2208. 86. Cohen GM. Caspases: the executioners of apoptosis. Biochem J 1997;326(Pt 1):1–16. 87. Ayala MN, Strid H, Jacobsson U, Soderberg PG. p53 expression and apoptosis in the lens after ultraviolet radiation exposure. Invest Ophthalmol Vis Sci 2007;48:4187–4191. 88. Burney S, Niles JC, Dedon PC, Tannenbaum SR. DNA damage in deoxynucleosides and oligonucleotides treated with peroxynitrite. Chem Res Toxicol 1999;12:513–520. 89. Deng J, Yu L, Liu C, Yu K, Shi X, Yeung LWY, et al. Hexabromocyclododecane-induced developmental toxicity and apoptosis in zebrafish embryos. Aquat Toxicol 2009;93: 29–36. 90. Sandrini JZ, Trindade GS, Nery LEM, Marins LF. Timecourse expression of DNA repair-related genes in hepatocytes of zebrafish (Danio rerio) after UV-B exposure. Photochem Photobiol 2009;85:220–226.

Address correspondence to: A.S. Sahul Hameed, PhD OIE Reference Laboratory for WTD PG and Research Department of Zoology C. Abdul Hakeem College Melvisharam, Vellore 632509 Tamilnadu India E-mail: [email protected]