Journal of Virological Methods, 39 (1992) 231-235 0 1992 Elsevier Science Publishers B.V. / All rights reserved / 0166-0934/92/$05.00
231
VIRMET 01370
Short Communication
Detection of Junin virus by the polymerase chain reaction Larry Molecular
E. Bockstahler, Paula G. Carney, and Jose-Luis Sagripanti
Biology Branch, Division of Life Sciences, Food and Drug Administration,
(Accepted
Grace
Bushar
Center for Devices and Radiological Health, Rockville, MD (USA)
19 March 1992)
Summary Argentine hemorrhagic fever is an often fatal human disease caused by Junin virus, an RNA-containing virus and member of the Arenavirus family. This virus was detected in vitro by the polymerase chain reaction (PCR) procedure. A pair of Junin virus-specific PCR DNA oligonucleotide primers and an oligonucleotide probe were designed from a known portion of the viral RNA sequence. RNA was isolated from Junin virus-infected monkey kidney cells and used to produce complementary DNA (cDNA) by reverse transcription. A DNA segment, 151 + 24 bp long, was amplified from this cDNA and characterized by agarose gel electrophoresis and Southern blot hybridization with the Junin virus-specific DNA probe. Sensitivity experiments showed that Junin virus could be detected with nanogram quantities of RNA isolated from virus-infected cells. The rapid and sensitive assay described here may contribute towards the development of a procedure for the early diagnosis of Argentine hemorrhagic fever. Junin
virus; Arenavirus; Polymerase chain reaction; Argentine hemorrhagic fever
Junin virus, an RNA-containing virus and member of the Arenavirus family, is the causative agent of Argentine hemorrhagic fever (Parodi et al., 1958). Junin virus is highly pathogenic in humans, and some of the symptoms it causes include hemorrhage of internal organs, acute neurological damage, and Correspondence
Administration
10: L.E. Bockstahler or J.-L. Sagripanti, Molecular Biology Branch, Food and Drag (HFZ-113), Rockville, MD 20857, USA.
232
irreversible shock leading to death (McCormick, 1990). Laboratory methods of Junin virus diagnosis include virus isolation in animals and cell culture, immunofluorescent antibody test, radioimmunoassay and enzyme-linked immunosorbent assay (McCormick, 1990). Some of these tests are timeconsuming and too insensitive to permit diagnosis at a time when treatment would be most effective. Therefore, there is a need for the development of rapid and sensitive virus detection procedures that will help establish early diagnosis. The genetic material of Junin virus consists of two negative-stranded species of RNA (McCormick, 1990). The small species of Junin viral RNA codes for three polypeptides including the nucleocapsid protein (N). The cDNA sequence of the Junin virus N gene has been reported (Ghiringhelli et al., 1989). On the basis of that sequence, we designed a pair of DNA oligonucleotide primers, each 20 bases long for PCR, and a 30-mer oligonucleotide probe for Southern blot analysis. Their names, sequences (5’-3’) and location in the Junin N gene are: J 1 (primer), CGCACAGTGGATCCTAGGCA, l-20; 52 (primer), CATCTCTCCTTAAGGACTGC, 165-184; and 53 (probe), TGGCATGGCACACTCCAAAGAGGTTCCAAG, 78-107, respectively. Primer Jl and probe 53 are complementary to Junin viral RNA. Primer 52 is homologous with the viral RNA. The primers and probe were purchased from Lofstrand Labs (Gaithersburg, MD). We detected Junin virus in virus-infected monkey kidney cells by isolation of RNA from these cells, reverse transcription of the RNA to cDNA, PCR amplification of a segment of this cDNA with primers Jl/J2 and Southern blot analysis with probe 53. Vero monkey kidney cells (ATCC, Rockville, MD) were infected (0.01 MOI) with an attenuated clone 3 strain of Junin virus, generously provided by Col. Dr. C.J. Peters (USAMRIID, Fort Detrick, MD). Virus was grown and titered in Vero cells, according to Bushar and Sagripanti (1990). RNA was isolated from infected cells and control, uninfected cells 48 h after virus infection by the acid guanidinium thiocyanate-phenol-chloroform single extraction procedure of Chomczynski and Sacchi (1987). Typical yields of cellular RNA were 0.1-0.3 mg per lo6 cells. Complementary DNA was transcribed from isolated cellular RNA with 1.0 PM Junin virus primer Jl, 0.5 mM each of dATP, dGTP, and dTTP, 0.25 mM dCTP, 100 mM Tris-HCl (pH 8.3) 10 mM MgC12, 10 mM DTT, 40 units of RNAsin ribonuclease inhibitor (Promega, Madison, WI), and 5 units of avian myeloblastosis virus reverse transcriptase (RT) (GIBCO BRL, Gaithersburg, MD) according to manufacturer’s instructions. PCR reaction mixtures in a total volume of 100 ~1 contained 5-8 ~1 of cDNA, 1.0 PM each of Junin virus primers Jl and 52, 200 PM each of four deoxynucleotide triphosphates, 10 mM Tris-HCl (pH 8.3) 50 mM KCl, 1.5 mM MgC12, 0.01% gelatin and 2.5 units of thermostable Amplitaq DNA polymerase from Thermus aquaticus (Perkin-Elmer Cetus, Norwalk, CT). Amplification was performed with a Perkin-Elmer Cetus DNA thermal cycler at 94°C for 1.0 min (2.0 min in the first cycle only) (denaturation), 55°C for 2.0 min (annealing), and 72°C for 1.5 min (extension) for 35 cycles, followed by incubation at 72°C for 8.5 min.
233
Fig. 1. Quantitative PCR detection of Junin virus in monkey cells. Quantity of RNA isolated from virusinfected cells was varied for RT reaction. PCR conditions for each sample were identical. (A) Agarose gel electrophoresis of amplified Junin virus-specific cDNA (35 cycles). Gel was stained with ethidium bromide, and DNA bands were photographed under ultraviolet illumination. S, standard: I kb ladder DNA marker (size indicated in bp); I, 560 ng RNA; 2,280 ng RNA; 3, 56 ng RNA; 4, 5.6 ng RNA; $0.56 ng RNA; C, control: negative control is amplified cDNA transcribed from 650 ng RNA isolated from uninfected cells. (B) Autoradiogram (IO h exposure) showing Southern blot analysis of the gel with Junin virus-specific oligonucleotide probe 53. (C) Integrated optical density (obtained by densitometry of autoradiograms) as a function of quantity of RNA used in RT reaction.
A single band of PCR DNA product was observed by agarose gel electrophoresis starting with RNA from virus-infected cells, but not with RNA from control, uninfected cells. Size of the amplified DNA band as measured in 2% agarose gels under non-denaturing conditions was 151 f 24 bp (n = 14, P < 0.05). Fig. 1A shows the electrophoretic patterns of amplified Junin virus-specific cDNA’s transcribed from different quantities of input RNA. PCR product DNA bands were visible in the gel only for samples l-3 (56560 ng RNA). The amplified DNA products were vacuum blotted from agarose gels to nylon Zeta-Probe membranes (BioRad, Richmond, CA) with 0.4 N NaOH. Membranes were washed, dried, baked and prehybridized according to manufacturer’s instructions. Oligonucleotide probe 53 was 5’[32P]-end labelled (Maxam and Gilbert, 1980) to a specific activity of about lo6 cpm/pmol with TCpolynucleotide kinase according to manufacturer’s protocol (Boehringer Mannheim, Indianapolis, IN). Membranes were hybridized with this probe (24 h at 56°C 0.5.10 cpm/ml), washed (56°C) according to manufacturer’s protocol (BioRad), and subject to autoradiography at - 70°C with Kodak XOmat AR film in the presence of an Kodak X-Omatic ‘Regular’ intensifying screen. Densitometric quantitation of DNA was performed, as previously described (Sagripanti et al., 1987).
234
Junin virus-specific probe 53 hybridized with all samples (l-5) of cDNA amplified from infected cells, but not with material from control, uninfected cells (Fig. 1B). Junin virus was detected even at the lowest level of RNA examined (sample 5; 0.56 ng). A plot of integrated optical density of DNA product vs. quantity (ng) of RNA used for ‘RNA-PCR’ detection of Junin virus is shown in Fig. IC. These data suggest that under the experimental conditions used in this study, an autoradiogram exposure of 10 h (- 70°C) is sufficient to detect Junin virus using about 1 ng of RNA isolated from virusinfected cells, and a linear response is obtained above 5 ng of RNA. A faster result can be obtained with a 2 h exposure, provided 50 ng or more of RNA are used. We investigated the cross-reactivity of primer pair Jl/J2 to other DNA’s. Supernatant solutions of monkey kidney cells infected with Sindbis virus, herpes simplex virus, Tamiani (another member of the Arenavirus family), or Junin virus (positive control) were examined using amounts greater than lo4 PFU of each virus in each RNA-PCR assay. In addition, PCR with primers Jl/ 52 was performed directly with one ,ug quantities of each of the following purified DNA’s: Escherichiu coli DNA, simian virus 40 DNA, DNA from human immunodeficiency virus (type 1)-infected human T-lymphocytes, and DNA from normal human skin fibroblasts. Probe 53 showed Southern blot hybridization bands only with the Junin virus positive control samples used (data not shown). The protocol presented in this study allows PCR detection of small quantities of Junin viral RNA isolated from infected cells. The amplified DNA product band is approximately the size predicted by sequence data. A DNA probe designed to be complementary to the central region of the expected PCR product hybridizes specifically to that DNA. The data presented here may contribute towards the development of an in vitro PCR procedure for the rapid detection of Junin virus and diagnosis of Argentine hemorrhagic fever.
Acknowledgments The authors thank Col. Dr. C.J. Peters (USAMRIID, Fort Detrick, MD) for a supply of Junin virus. We are grateful to Dr. Edward I. Ginns, Dr. Ellen Sidranski and Barbara Stubblefield (NIH, Bethesda, MD) for helpful technical comments. We thank Dr. Mays L. Swicord (FDA, Rockville, MD) for support and encouragement. References Bushar, G. and Sagripanti, J.-L. (1990) Method for improving accuracy of virus titration: standardization of plaque assay for Junin virus. J. Virol. Methods 30, 99-107. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159.
235 Ghiringhelli, P.D., Rivera Pomar, R.V., Baro, NJ., Rosas, M.F., Grau, 0. and Romanowski, V. (1989) Nucleocapsid protein gene of Junin arenavirus (cDNA sequence). Nucleic Acids Res. 17, 8001. Maxam, A.M. and Gilbert, W. (1980) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65, 499-560. McCormick, J.B. (1990) Arenaviruses. In: B.N. Fields, and D.M. Knipe (Eds), Fields Virology, 2nd Edn, Raven Press, New York, pp. 1245-1267. Parodi, A.J., Greenway, D.J., Rugiero, H.R., Rivers, S., Figerio, M., De la Barrera, J.M., Mattler, N., Garzon, F., Boxaca, M., de Guerrero, L. and Nota, N. (1958) Sobre la etiologia de1 brote epidermic0 de Junin. Dis. Med. 30, 2300. Sagripanti, J.-L., Swicord, M.L. and Davis, C.C. (1987) Microwave effects on plasmid DNA. Radiation Res. 110, 219-231.
231
VIRMET 01370
Short Communication
Detection of Junin virus by the polymerase chain reaction Larry Molecular
E. Bockstahler, Paula G. Carney, and Jose-Luis Sagripanti
Biology Branch, Division of Life Sciences, Food and Drug Administration,
(Accepted
Grace
Bushar
Center for Devices and Radiological Health, Rockville, MD (USA)
19 March 1992)
Summary Argentine hemorrhagic fever is an often fatal human disease caused by Junin virus, an RNA-containing virus and member of the Arenavirus family. This virus was detected in vitro by the polymerase chain reaction (PCR) procedure. A pair of Junin virus-specific PCR DNA oligonucleotide primers and an oligonucleotide probe were designed from a known portion of the viral RNA sequence. RNA was isolated from Junin virus-infected monkey kidney cells and used to produce complementary DNA (cDNA) by reverse transcription. A DNA segment, 151 + 24 bp long, was amplified from this cDNA and characterized by agarose gel electrophoresis and Southern blot hybridization with the Junin virus-specific DNA probe. Sensitivity experiments showed that Junin virus could be detected with nanogram quantities of RNA isolated from virus-infected cells. The rapid and sensitive assay described here may contribute towards the development of a procedure for the early diagnosis of Argentine hemorrhagic fever. Junin
virus; Arenavirus; Polymerase chain reaction; Argentine hemorrhagic fever
Junin virus, an RNA-containing virus and member of the Arenavirus family, is the causative agent of Argentine hemorrhagic fever (Parodi et al., 1958). Junin virus is highly pathogenic in humans, and some of the symptoms it causes include hemorrhage of internal organs, acute neurological damage, and Correspondence
Administration
10: L.E. Bockstahler or J.-L. Sagripanti, Molecular Biology Branch, Food and Drag (HFZ-113), Rockville, MD 20857, USA.
232
irreversible shock leading to death (McCormick, 1990). Laboratory methods of Junin virus diagnosis include virus isolation in animals and cell culture, immunofluorescent antibody test, radioimmunoassay and enzyme-linked immunosorbent assay (McCormick, 1990). Some of these tests are timeconsuming and too insensitive to permit diagnosis at a time when treatment would be most effective. Therefore, there is a need for the development of rapid and sensitive virus detection procedures that will help establish early diagnosis. The genetic material of Junin virus consists of two negative-stranded species of RNA (McCormick, 1990). The small species of Junin viral RNA codes for three polypeptides including the nucleocapsid protein (N). The cDNA sequence of the Junin virus N gene has been reported (Ghiringhelli et al., 1989). On the basis of that sequence, we designed a pair of DNA oligonucleotide primers, each 20 bases long for PCR, and a 30-mer oligonucleotide probe for Southern blot analysis. Their names, sequences (5’-3’) and location in the Junin N gene are: J 1 (primer), CGCACAGTGGATCCTAGGCA, l-20; 52 (primer), CATCTCTCCTTAAGGACTGC, 165-184; and 53 (probe), TGGCATGGCACACTCCAAAGAGGTTCCAAG, 78-107, respectively. Primer Jl and probe 53 are complementary to Junin viral RNA. Primer 52 is homologous with the viral RNA. The primers and probe were purchased from Lofstrand Labs (Gaithersburg, MD). We detected Junin virus in virus-infected monkey kidney cells by isolation of RNA from these cells, reverse transcription of the RNA to cDNA, PCR amplification of a segment of this cDNA with primers Jl/J2 and Southern blot analysis with probe 53. Vero monkey kidney cells (ATCC, Rockville, MD) were infected (0.01 MOI) with an attenuated clone 3 strain of Junin virus, generously provided by Col. Dr. C.J. Peters (USAMRIID, Fort Detrick, MD). Virus was grown and titered in Vero cells, according to Bushar and Sagripanti (1990). RNA was isolated from infected cells and control, uninfected cells 48 h after virus infection by the acid guanidinium thiocyanate-phenol-chloroform single extraction procedure of Chomczynski and Sacchi (1987). Typical yields of cellular RNA were 0.1-0.3 mg per lo6 cells. Complementary DNA was transcribed from isolated cellular RNA with 1.0 PM Junin virus primer Jl, 0.5 mM each of dATP, dGTP, and dTTP, 0.25 mM dCTP, 100 mM Tris-HCl (pH 8.3) 10 mM MgC12, 10 mM DTT, 40 units of RNAsin ribonuclease inhibitor (Promega, Madison, WI), and 5 units of avian myeloblastosis virus reverse transcriptase (RT) (GIBCO BRL, Gaithersburg, MD) according to manufacturer’s instructions. PCR reaction mixtures in a total volume of 100 ~1 contained 5-8 ~1 of cDNA, 1.0 PM each of Junin virus primers Jl and 52, 200 PM each of four deoxynucleotide triphosphates, 10 mM Tris-HCl (pH 8.3) 50 mM KCl, 1.5 mM MgC12, 0.01% gelatin and 2.5 units of thermostable Amplitaq DNA polymerase from Thermus aquaticus (Perkin-Elmer Cetus, Norwalk, CT). Amplification was performed with a Perkin-Elmer Cetus DNA thermal cycler at 94°C for 1.0 min (2.0 min in the first cycle only) (denaturation), 55°C for 2.0 min (annealing), and 72°C for 1.5 min (extension) for 35 cycles, followed by incubation at 72°C for 8.5 min.
233
Fig. 1. Quantitative PCR detection of Junin virus in monkey cells. Quantity of RNA isolated from virusinfected cells was varied for RT reaction. PCR conditions for each sample were identical. (A) Agarose gel electrophoresis of amplified Junin virus-specific cDNA (35 cycles). Gel was stained with ethidium bromide, and DNA bands were photographed under ultraviolet illumination. S, standard: I kb ladder DNA marker (size indicated in bp); I, 560 ng RNA; 2,280 ng RNA; 3, 56 ng RNA; 4, 5.6 ng RNA; $0.56 ng RNA; C, control: negative control is amplified cDNA transcribed from 650 ng RNA isolated from uninfected cells. (B) Autoradiogram (IO h exposure) showing Southern blot analysis of the gel with Junin virus-specific oligonucleotide probe 53. (C) Integrated optical density (obtained by densitometry of autoradiograms) as a function of quantity of RNA used in RT reaction.
A single band of PCR DNA product was observed by agarose gel electrophoresis starting with RNA from virus-infected cells, but not with RNA from control, uninfected cells. Size of the amplified DNA band as measured in 2% agarose gels under non-denaturing conditions was 151 f 24 bp (n = 14, P < 0.05). Fig. 1A shows the electrophoretic patterns of amplified Junin virus-specific cDNA’s transcribed from different quantities of input RNA. PCR product DNA bands were visible in the gel only for samples l-3 (56560 ng RNA). The amplified DNA products were vacuum blotted from agarose gels to nylon Zeta-Probe membranes (BioRad, Richmond, CA) with 0.4 N NaOH. Membranes were washed, dried, baked and prehybridized according to manufacturer’s instructions. Oligonucleotide probe 53 was 5’[32P]-end labelled (Maxam and Gilbert, 1980) to a specific activity of about lo6 cpm/pmol with TCpolynucleotide kinase according to manufacturer’s protocol (Boehringer Mannheim, Indianapolis, IN). Membranes were hybridized with this probe (24 h at 56°C 0.5.10 cpm/ml), washed (56°C) according to manufacturer’s protocol (BioRad), and subject to autoradiography at - 70°C with Kodak XOmat AR film in the presence of an Kodak X-Omatic ‘Regular’ intensifying screen. Densitometric quantitation of DNA was performed, as previously described (Sagripanti et al., 1987).
234
Junin virus-specific probe 53 hybridized with all samples (l-5) of cDNA amplified from infected cells, but not with material from control, uninfected cells (Fig. 1B). Junin virus was detected even at the lowest level of RNA examined (sample 5; 0.56 ng). A plot of integrated optical density of DNA product vs. quantity (ng) of RNA used for ‘RNA-PCR’ detection of Junin virus is shown in Fig. IC. These data suggest that under the experimental conditions used in this study, an autoradiogram exposure of 10 h (- 70°C) is sufficient to detect Junin virus using about 1 ng of RNA isolated from virusinfected cells, and a linear response is obtained above 5 ng of RNA. A faster result can be obtained with a 2 h exposure, provided 50 ng or more of RNA are used. We investigated the cross-reactivity of primer pair Jl/J2 to other DNA’s. Supernatant solutions of monkey kidney cells infected with Sindbis virus, herpes simplex virus, Tamiani (another member of the Arenavirus family), or Junin virus (positive control) were examined using amounts greater than lo4 PFU of each virus in each RNA-PCR assay. In addition, PCR with primers Jl/ 52 was performed directly with one ,ug quantities of each of the following purified DNA’s: Escherichiu coli DNA, simian virus 40 DNA, DNA from human immunodeficiency virus (type 1)-infected human T-lymphocytes, and DNA from normal human skin fibroblasts. Probe 53 showed Southern blot hybridization bands only with the Junin virus positive control samples used (data not shown). The protocol presented in this study allows PCR detection of small quantities of Junin viral RNA isolated from infected cells. The amplified DNA product band is approximately the size predicted by sequence data. A DNA probe designed to be complementary to the central region of the expected PCR product hybridizes specifically to that DNA. The data presented here may contribute towards the development of an in vitro PCR procedure for the rapid detection of Junin virus and diagnosis of Argentine hemorrhagic fever.
Acknowledgments The authors thank Col. Dr. C.J. Peters (USAMRIID, Fort Detrick, MD) for a supply of Junin virus. We are grateful to Dr. Edward I. Ginns, Dr. Ellen Sidranski and Barbara Stubblefield (NIH, Bethesda, MD) for helpful technical comments. We thank Dr. Mays L. Swicord (FDA, Rockville, MD) for support and encouragement. References Bushar, G. and Sagripanti, J.-L. (1990) Method for improving accuracy of virus titration: standardization of plaque assay for Junin virus. J. Virol. Methods 30, 99-107. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159.
235 Ghiringhelli, P.D., Rivera Pomar, R.V., Baro, NJ., Rosas, M.F., Grau, 0. and Romanowski, V. (1989) Nucleocapsid protein gene of Junin arenavirus (cDNA sequence). Nucleic Acids Res. 17, 8001. Maxam, A.M. and Gilbert, W. (1980) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65, 499-560. McCormick, J.B. (1990) Arenaviruses. In: B.N. Fields, and D.M. Knipe (Eds), Fields Virology, 2nd Edn, Raven Press, New York, pp. 1245-1267. Parodi, A.J., Greenway, D.J., Rugiero, H.R., Rivers, S., Figerio, M., De la Barrera, J.M., Mattler, N., Garzon, F., Boxaca, M., de Guerrero, L. and Nota, N. (1958) Sobre la etiologia de1 brote epidermic0 de Junin. Dis. Med. 30, 2300. Sagripanti, J.-L., Swicord, M.L. and Davis, C.C. (1987) Microwave effects on plasmid DNA. Radiation Res. 110, 219-231.
