G Model ACA 233734 No. of Pages 7
Analytica Chimica Acta xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor Young Seop Kwon 1, Van-Thuan Nguyen 1, Je Gun Park, Man Bock Gu * College of Life Sciences and Biotechnology, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-713, South Korea
H I G H L I G H T S
G R A P H I C A L A B S T R A C T
A new colorimetric multi-aptasensor was successfully developed for two pesticides. The LOD of this multi-aptasensor were 10 nM and 5 nM for EDI and IBF, respectively. This new multi-aptasensor was successfully applied to the real rice samples. The accuracies were around 80 and 90% in spiked paddy and polished rice samples.
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 December 2014 Received in revised form 30 January 2015 Accepted 10 February 2015 Available online xxx
The sensitive detection of iprobenfos (IBF) and edifenphos (EDI) was successfully conducted by using a new aptamer-based colorimetric multi-aptasensor. The dissociation constants of this multi-target aptamer to both iprobenfos and edifenphos were found to be 1.67 mM and 38 nM, respectively, according to the isothermal calorimetry assay. The aptamer EIA2 was selective to only IBF and EDI, confirmed by AuNP assays. By using this multi-aptasensor, both pesticides IBF and EDI can be eventually detected in a range from 10 nM to 5 nM, respectively. This multi-aptasensor was successfully implemented in spiked rice samples and the accuracies of this AuNP-based multi-aptasensor were around 80 and 90% in spiked paddy and polished rice samples, respectively. This aptamer EIA2 could be applied not only for the detection of pesticides from real samples in agriculture field as POC, but also can be used as a bioreceptor for other types of aptasensors. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Iprobenfos Edifenphos Atpamer Multi-aptasensor Colorimetric
1. Introduction Iprobenfos (IBF) and edifenphos (EDI) are most harmful organophosphate pesticides, which have been accumulated in
* Corresponding author. Tel.: +82 2 3290 3417. E-mail address: [email protected] (M.B. Gu). Equally contributed.
1
many of different agricultural products, such as vegetables, fruits, and especially rice for managing the diseases of agricultural food products [1]. The extensive usages of this pesticides in agriculture have led to their accumulation in many of different agricultural products, such as vegetables, fruits, and especially rice. These pesticides can cause neurotoxicity to occur serious symptoms, such as nausea, dizziness, vomiting, difficulty breathing, tremor, muscle weakness, or seizure to human if ingested at the high concentration [2].
http://dx.doi.org/10.1016/j.aca.2015.02.020 0003-2670/ ã 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
2
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
A fast and accurate detection method for these pesticides is crucially needed. In order to ensure that these harmful pesticides does not exist in a dangerous level in agricultural products, water, soil or dairy products, there have been tremendous efforts to detect these pesticides in fields, for example, by using HPLC, GC, or bacterial sensors [3–5]. These traditional analysis methods, however, are known to be complicate, uncomfortable, and expensive. Therefore, a simple, rapid and accurate detection of these pesticides is indeed required for the environment and food control. Aptamers, single-stranded DNAs or RNAs, can bind to their targets with high specificity and affinity. Since aptamers were known to have advantageous features including no limitation to targets, easy modification and labeling, cost effectiveness, and so on, aptamer has been considered to be a new promising bioreceptor molecule [6,7]. Aptamers have been developed against many different targets, such as proteins [8,9], metal ions [10], viruses [11,12], or especially small molecules [13–18], through a process so called systematic evolution of ligands by exponential enrichment (SELEX) in vitro [19–21]. In this study, we have used the modified immobilization free GO-SELEX which has been previously developed by our group [22,23] for obtaining aptamers to targets, and an unique aptamer binding to two small molecule pesticide targets, IBF and EDI, was successfully developed. By using this aptamer, the detection of both pesticides, IBF and EDI, was successful by using this AuNPbased colorimetric multi-aptasensor in a simple and easy detection protocol, in addition to use the isothermal titration calorimetry (ITC) assay for estimating the dissociation constants of this aptamer to both pesticides. This multi-aptasensor was found to be successful to detect both pesticides from real rice samples with an appropriate protocol. 2. Materials and methods 2.1. Materials The ssDNA library consists of random region and primer region. There is the random region composed of thirty randomly synthesized nucleotides in the middle of ssDNA library ordered by two primer region for PCR amplification (primer sequences FP 50 CGTACGGAATTCGCTAGC-30 and RP 50 -CACGTGGAGCTCGGATCC-30 in a total bases with 50 -CGTACGGAATTCGCTAGC-N30-GGATCCGAGCTCCACGTG-30 . For PCR amplification, FP 50 -fluoresceinCGTACGGAATTCGCTAGC-30 and RP 50 -CACGTGGAGCTCGGATCC-30 were used. Edifenphos and iprobenfos binding DNA aptamer (EIA2) with the complete sequence 50 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAGCTCCACGTG-30 was synthesized from GenotechInc, Korea. 2.2. Reagents All the chemicals, such as iprobenfos (45814, PESTANAL, analytical standard-Fluka), edifenphos (45467, PESTANAL, analytical standard-Fluka), carpropamid (31682, PESTANAL, analytical standard-Fluka), and pencycuron (31118, PESTANAL, analytical standard-Fluka) were purchased from Sigma–Aldrich unless specified, and used without further purification. Graphene Oxide (GO) was purchased from Graphene Supermarket (http://www. graphene-supermarket.com). 2.3. Procedures 2.3.1. Screening of aptamers for pesticides The every round of SELEX process (Fig. S1) was performed by initially heating 200 pmol (Tris–HCl 20 mM, pH 7.4) of random
ssDNA library for 15 min and then cooling for 5 min on ice for obtaining best conformational structure of oligonucleotides. For the first round of SELEX, 200 pmol of denatured ssDNA library was incubated with a mixture of the counter-targets for 30 min. This counter-screening step is intended for removing of ssDNAs that are bound to the counter targets, which are very similar to the target in terms of molecular structure or are unwanted to be bound. After incubation, the 4 mg of GO was added and incubated for 2 h (final volume 1 mL) in order to separate the oligonucleotides that would not bind to the counter targets including edifenphos, carpropamid and pencycuron. Subsequently, the solution was centrifuged for 15 min at 10,000 rcf to precipitate the GO on which some of oligonucleotides were adsorbed. After discarding the supernatant containing the counter targets with ssDNAs bound in the separation process, the centrifuged GO is re-suspended and washed out with the same buffer for 3 times in order to imposea harsher condition. Then, the ssDNAs were recovered from the GO by the addition of the target, iprobenfos, and incubated further for 30 min. The mixture solution, then, was centrifuged and ssDNA library pool was recovered by ethanol precipitation. The amount of recovered ssDNAs was measured by Nanodrop (ND-1000 spectrophotometer) and the obtained library pool was amplified by PCR and ssDNAs were again generated by PAGE separation and purification. 2.3.2. The synthesis of AuNP AuNPs were synthesized by citrate reduction of HAuCl4as reported somewhere else [24]. Briefly, 100 mL of 1 mM HAuCl4 was added into a cleaned two-neck flask. Then, the flask was refluxed on hot plate under stirring condition. When solution began boiling, 10 mL of 38.8 mM of sodium citrate was added. The color changed from pale yellow to deep red in 1 min. Then, the solution was allowed to reflux for 15 min and cool down to room temperature under stirring. The mono-dispersed size of AuNPs was confirmed as around 13 nm by performing transmission electron microscopy (TEM, Tecnai 20). 2.4. Colorimetric assay A mixture of 360 mL of 2.2 nM AuNPs with 20 mL of 8 mM ssDNAs was shaken mildly for 30 min at RT, and incubated for 10 min after adding 20 mL of various concentration targets (0, 1, 2.5, 5, 10, 25, 75, 100 mM) in a binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) at RT. After slow addition of 30 mL of 0.75 M NaCl into the incubated sample, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer. The other control chemicals, such as edifenphos, carpropamid, pencycuron and glyphosate, were also examined under the same procedure for the screening and specificity tests. The error-bar is obtained and incorporated into the figures from three independent experiments. Optimization test: briefly, 360 mL of 0.4 nM AuNPs with 20 mL of 8 mM ssDNA was shaken mildly for 30 min at RT, and then added 20 mL of various concentration targets (0, 1, 2.5, 5, 10, 25, 50, 100, 200, 500, 1000 nM) in a binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) for 30 min at RT. After slow addition of 30 ml of 0.075 M NaCl into the incubated sample solution, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer. 2.4.1. Isothermal Titration Calorimetric (ITC) The binding affinities of the selected aptamer (EIA2) relevant to IBF and EDI were measured by ITC (VP-ITC machine by GE). In the ITC experiment, 0.5 mMaptamer was loaded into the cell with 25 mM of the target in the titrating syringe. All chemicals and aptamer were dissolved into the binding buffer (100 mM NaCl,
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
3
20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, and 1 mM CaCl2). The titration experiments were performed at 25 C with twenty nine times injections with 10 mL of each. The stirring speed was maintained at 246 rpm during the titration. Data were analyzed by fitting with a single-site binding model using Origin software (www.originlab.com). 2.4.2. Preparation of spiked rice samples for assay Five milliliters of 3.2, 6.4 and 64 uM of EDI and IBF samples in methanol were mixed 5gram of ordinary rice in Petri dish in order to obtain 0.1, 0.2, and 2 mg kg1 (1, 2, and 20 ppm) spiked paddy and polished rice samples. Then, the spiked samples were treated in two different ways, the one with washing step using tap water twice after dry of spiked samples, and the other one without washing step. The rice samples spiked without washing step were followed by the drying step directly. Then, the drying step was conducted at room temperature during 14 h for both washed and unwashed samples. After drying, the rice samples were incubated in 2 min with 5 mL of pure methanol and extracted at room temperature. The supernatants from both samples extracted were transferred to the other tube. This supernatant solution was diluted by mixing with the binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, and 1 mM CaCl2) to make 10% methanol in extracted samples of spiked rice for for the colorimetric assay. The colorimetric assay is as follow: 360 mL of 0.4 nM AuNPs mixed with 20 mL of 8 mM ssDNAs was shaken mildly for 30 min at RT, and then added to 20 mL of the extracted samples of the spiked rice in a binding buffer (10% methanol in 100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) for 30 min at RT. After slow addition of 30 mL of 0.075 M NaCl into the mixture of AuNP, aptamer and the extracted samples of the spiked rice, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer.
Scheme 1. The A scheme depicts the development of multi-aptasensor.
Fig. 1. The specificity test for pre-screening theaptamer candidates based on the AuNP-based colorimetric assays. Y-axisis the absorbance ratio of AuNPs at 520 and 650 nm wavelengths (A650/A520), which indicates the binding of aptamer to the target if the value is over a certain number.
Scheme 2. The similarity and structure of EIA1 and EIA2 using Mfold. The similarity of EIA1 and EIA2 were highlighted by same color (blue, green, purple and red). (For interpretation of the references to color in this scheme legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
4
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
Fig. 2. The specificity of the aptamer EIA2 based on the AuNPs-based colorimetric assays. The spectral and color changes of the mixture of AuNPs and EIA2 were observed from three independent experiments in the presence of the pesticides (IBF, EDI) along with the additional molecules, including pencycuron, carpropamid, tetracycline, diclofenac, D-alanine, and glyphosate, respectively. (A) Spectral peak shifting was occurred from red to purple. Shifting occurred when only iprobenfos and Edipenphos are added. (B) Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus variety of targets (inset: corresponding photographic images).
3. Result and discussion 3.1. Screening and selection of ssDNA aptamer for two targets The 64-mer aptamer EIA2 specific to iprobenfos and edifenphos was successfully screened out from the random ssDNA library by using immobilized-free GO-SELEX (Scheme 1). Fig. S1 shows that the recovery ratio of bound ssDNAs/total ssDNAs initially
input at every round indicates the saturated state of bounded ssDNAs with the progress of SELEX. To impose the stringency for the specificity of ssDNA aptamer candidates, the counter targets, which have similar structures with the target molecule or from the same category of pesticides but unwanted, were added in each round of selection. After six rounds, the recovery percentage of bounded ssDNAs reached to approximately 90% of the ssDNA pool added. Therefore, the fifth round, which showed the highest
Fig. 3. Molecular interactions of the iprobenfos 0.5 mM EIA2 aptamer, measured by Isothermal Titration Calorimetry (ITC) analysis with 25 mM targets titrated at RT. (A) Aptamer for IBF with Kd of 1.67 mM, (B) aptamer for EDI with Kd of 38 nM.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
5
Fig. 4. A colorimetric detection of IBF and EDI using EIA2 aptamer based on the AuNPs-based colorimetry. (A and C) Absorption spectra of AuNP solutions shown in the presence of various IBF concentrations. Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus concentration of IBF shown. (B and D) Absorption spectra of AuNP solutions in the presence of various EDI concentrations shown (left). Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus concentration of EDI shown (right) (inset: corresponding photographic images).
recovery (92%), was conducted for the cloning step by using simple Qiagen cloning plus kit, and colonies were then isolated, cultured, purified, and sequenced. 3.2. The specificity and affinity of the aptamer EIA2
Fig. 5. The lowest IBF and EDI detection limitwere obtained at an optimum AuNP concentration. The absorbance ratios is plotted with 0.4 nM of AuNP within same aptamer molar ratio and salt concentration. Insert showed an enlarged spectrum analysis in the range of each pesticide.
The specificities of seven aptamer candidates were characterized by using unmodified AuNP colorimetric assay, which has been a well-known aptasensor platform based on LSPR blue-shift phenomenon occurred due to the aggregation of gold nanoparticles for the small molecule detection [24,25]. Briefly, the AuNPs are stable with a high amount of salts in present of ssDNA due to protection of the adsorbed poly-negative charge of ssDNAs on gold surface. However, when target is added in, the aptamers physically adsorbed on the gold nanoparticles are desorbed after binding with their targets. Then, gold nanoparticles are aggregated in a high salt concentration, and the color of solution is changed. In these specificity screening tests, a few more small molecules, such as antibiotics (tetracycline), drug (diclofenac), amino acid (D-alanine), and pesticide (glyphosate), which were not even used as counter targets in SELEX protocols, were also used as negative control targets. The effect of salts concentration and the ratios of aptamer: AuNP in colorimetric assay were optimized (Figs. S4–S7). As shown in Fig. 1, all the aptamer candidates showed the affinity binding to IBF and also with EDI. The EIA2 aptamer candidate showed the best specificity to both pesticides (IBF and EDI), while other aptamer candidates also showed some degree of specificity to other counter molecules. Interestingly, EIA1 and EIA2 showed quite similar specificity, compared with
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
6
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
other candidates. So, we analyzed the sequences and structure of both aptamers, EIA1 and EIA2. We found out that EIA1 and EIA2 have two same sized stem-loops and four partial consecutive DNAs which are exactly same in both aptamers (Scheme 2, Table S1, and Fig. S3). However, EIA1 seems to have slight interaction with pencycuron, one of a negative control chemical used for selectivity test, to which EIA2 has no affinity. Therefore, only EIA2 has been selected for further characterization studies in detail. To further study on the specificity of EIA2, the AuNP-based colorimetric assays were conducted along with the analysis of the molecular structures of IBF and EDI (Fig. 2 and Fig S8). It is clear from these results that the colors were changed and peaks were shifted from 520 nm to 650 nm only in the presence of IBF or EDI and the ratios of 650/520 were measured to be around 1, which are higher than the negative control which is about 0.2. These indicate that the interaction between the IBF or EDI target and the EIA2 aptamer has been occurred due to the detachment of the aptamer from the surface of AuNPs. In fact, when EDI is used as a counter target, all the ssDNAs binding to this counter targets are supposed to be removed during the counter SELEX steps. By analyzing the structure of IBF and EDI, we found that both IBF and EDI have the same phenylthionyl aromatic ring and phosphoryl group in molecular structure (Fig. S8). Therefore, the binding of EIA2 with EDI may be understood as follows: during the screening process the screened ssDNAs obtained for IBF might also have affinity to EDI. Even though the EIA2 has been screened for the target IBF, it may still have a function to bind to EDI, because both molecules share some part of molecular structure and chemical formula. Therefore, the aptamer EIA2 is now clearly confirmed to have affinity to only both pesticides, IBF and EDI. The dissociation constant, Kd of EIA2 aptamer to each pesticide, IBF or EDI, was measured using the isothermal titration calorimetric (ITC) assay. The plotted graphs by adopting single-site binding model were shown in Fig. 3. The dissociation constants of EIA2 aptamer for IBF and EDI value were found to be 1.67 mM and 38 nM, respectively, in which the affinity of EIA2 to EDI was almost 30-fold higher than IBF. 3.3. The detection sensitivity for both pesticides using AuNPs-based colorimetric EIA2 multi-aptasensor To determine the sensitivity of this multi-aptasensor using EIA2 aptamer, the AuNP-based colorimetric assays were conducted with the various concentrations of both pesticide molecules (0, 1, 2.5, 5, 10, 25, 75, and 100 mM). Fig. 4A and B shows that the color changes of AuNPs with EIA2 and the peak shifting occurred when only the different concentrations of IBF or EDI were added in
the solution followed by the addition of 0.75 M of NaCl. The spectral and color changes of AuNPs solution were measured up to as low as 1 or 10 mM of EDI and IBF, respectively, as shown in Fig. 4C and D. The absorbance ratios at 650–520 nm (A650/A520), representing the spectral and color changes, were plotted (right graph) in Fig. 4C and D, and found to be well matched with the dose dependent trends. However, this limit of detection should be lower than 314 nM to apply real samples [26]. To improve the LOD of this multi-aptasensor, the optimization of this colorimetric assay [27] was carried out in order to increase the sensitivity and lower LOD than the marginal concentration. In this optimization steps, both concentrations of AuNPs was decreased up to 0.4 nM, and various concentrations of IBF and EDI target (0, 1, 2.5, 5, 10, 25, 50, 100, 200, 500, 1000 nM) were added in the mixture of AuNP and aptamers at 0.075 M initial salt concentrations. Fig. 5 shows that IBF and EDI could be detected as low as 10 nM and 5 nM, respectively, by lowering the concentration of AuNPs to improve the limit of detection (by 3s rule). It is much lower than 314 nM, which is the marginal concentration for safe drinking water. Moreover, the dynamic range of this multi-aptasensor was obtained from 10 to 100 nM for IBF and 5 to 25 nM for EDI. Therefore, this colorimetric multi-aptasensor can be used as a POC (Point Of Care) tool for detecting polluted drinking water. It could be worth to note that it should be very efficient for this GO-SELEX to generate aptamers that can bind to multiple chemicals which have some similarity in their functional groups. Therefore, this interesting outcome on generating EIA2 aptamer in this study could be a beneficial feature in developing aptasensors for pesticides or other small molecules target. The Maximum Residue Limits (MRLs) of EDI and IBF are 0.2 mg kg1. Therefore, we selected 0.2 mg kg1 as a threshold for contamination level of pesticide in rice samples. The successful detection of both pesticides spiked in rice samples was shown in Tables 1 and 2 for all eight different samples (paddy and polished rice with washed and unwashed for both pesticides). To determine the reproducibility of this colorimetric multi-aptasensor, the extracted samples of spiked paddy and polished rice, which initially contaminated with both pesticides of 0.1, 0.2, and 2 mg kg1, were carried out. The spiked sample was tested in triplicate and the accuracy of the assay was presented by the recovery percentages and the RSD (%). Especially, the recoveries of this assay were from 113.7% to 80% and the RSDs of assay were 8.19% (the highest number of RSD) for polished rice. In addition, for all of both paddy and polished washed rice samples, the recoveries of this assay were from 64.34 to 35.4%, probably due to some pesticides still unwashed even in washing steps and the low efficiency of the extraction in wetted rice.
Table 1 The reproducibility muti-aptasensor assay of IBF spiked in rice samples. Spiked IBF
Unwashed rice
(mg kg1)
Results (mg kg1)
Recovery (%)
RSD (%)
Results (mg kg1)
Recovery (%)
RSD (%)
Polished rice 0.1 0.20 (MRLs) 2
0.084 0.007 0.209 0.009 1.719 0.018
84.07 7.24 104.28 4.60 85.97 0.93
7.24 4.60 0.93
0.035 0.003 0.097 0.003 0.509 0.01
35.44 2.79 48.35 1.62 25.44 0.52
2.79 1.62 0.52
Paddy rice 0.1 0.20 (MRLs) 2
0.083 0.001 0.165 0.010 1.622 0.164
82.85 1.18 82.36 5.11 81.12 8.19
1.18 5.11 8.19
0.022 0.003 0.053 0.007 0.48 0.007
22.32 3.14 26.61 3.55 24 0.38
3.14 3.55 0.38
Washed rice
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
7
Table 2 The reproducibility muti-aptasensor assay of EDI spiked in rice samples. Spiked EDI
Unwashed rice
(mg kg1)
Results (mg kg1)
Recovery (%)
RSD (%)
Results (mg kg1)
Recovery (%)
RSD (%)
Polished rice 0.1 0.20 (MRLs) 2
0.081 0.005 0.234 0.002 1.674 0.019
80.50 4.92 116.76 0.95 83.72 0.93
4.92 0.95 0.93
0.053 0.001 0.103 0.003 0.487 0.060
52.47 1.37 51.61 1.34 24.34 2.99
1.37 1.34 2.99
Paddy rice 0.1 0.20 (MRLs) 2
0.085 0.003 0.162 0.003 1.7 0.014
84.50 2.59 80.85 1.34 85.07 0.69
2.59 1.34 0.69
0.055 0.002 0.087 0.004 0.541 0.048
54.84 1.88 43.80 1.94 27.06 2.40
1.88 1.94 2.40
Washed rice
4. Conclusion We have successfully developed and improved a new AuNP-based colorimetric multi-aptasensor for the detection of two pesticides. The binding affinity of the aptamer EIA2 was found to be 1.67 mM and 38 nM for IBF and EDI, respectively, confirmed by ITC method. The aptamer EIA2 was selective to only IBF and EDI, confirmed by AuNP assays. By using this multi-aptasensor, both pesticides IBF and EDI can be eventually detected in a range from 10 nM to 5 nM, respectively. This multi-aptasensor was successfully implemented in spiked rice samples and the accuracies of this AuNP-based multi-aptasensor were around 80 and 90% in spiked paddy and polished rice samples, respectively. This aptamer EIA2 could be applied not only for the detection of pesticides from real samples in agriculture field as POC, but also can be used as a bioreceptor for other types of aptasensors. Acknowledgments This research was supported by Advanced Production Technology Development Program,Ministry of Agriculture, Food and Rural Affairs and the National Research Foundation of Korea (NRF) grant funded by the Korean Government (No. 2013R1A1A2021531). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aca.2015.02.020. References [1] Y.S. Kim, J.Y. Oh, B.K. Hwang, K.D. Kim, Variation in sensitivity of Magnaporthe oryzae isolates from Korea to edifenphos and iprobenfos, Crop Prot. 27 (2008) 1464–1470. [2] T.C. Marrs, Organophosphate poisoning, Pharmacol. Ther. 58 (1993) 51–66. [3] K. Banerjee, Novel GC/MS, HPLC/MS, and HPLC-diode array detector-based methods for determination of pesticide residues in food, feed, water, and soil samples, J. AOAC Int. 93 (2010) 353–354. [4] J. Wang, W. Cheung, W. Chow, Ultra-high performance liquid chromatography/ electrospray ionization-tandem mass spectrometry determination of 151 pesticides in soybeans and pulses, J. AOAC. Int. 96 (2013) 1114–1133. [5] E.I. Rainina, E.N. Efremenco, S.D. Varfolomeyev, A.L. Simonian, J.R. Wild, The development of a new biosensor based on recombinant E. coli for the direct detection of organophosphorus neurotoxins, Biosens. Bioelectron. 11 (1996) 991–1000. [6] S. Tombelli, M. Minunni, M. Mascini, Analytical applications of aptamers, Biosens. Bioelectron. 20 (2005) 2424–2434.
[7] Y. Kim, M.B. Gu, H.S. Kim, Advances in aptamer screening and small molecule aptasensors, Biosensors Based on Aptamers and Enzymes, 140, Springer, Berlin Heidelberg, 2014, pp. 29–67. [8] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Selection of single-stranded DNA molecules that bind and inhibit human thrombin, Nature 355 (1992) 564–566. [9] J.W. Park, S.S. Kallempudi, J.H. Niazi, Y. Gurbuz, B.S. Youn, M.B. Gu, Rapid and sensitive detection of Nampt (PBEF/visfatin) in human serum using an ssDNA aptamer-based capacitive biosensor, Biosens. Bioelectron. 38 (2012) 233–238. [10] Y. Wu, S. Zhan, L. Wang, P. Zhou, Selection of a DNA aptamer for cadmium detection based on cationic polymer mediated aggregation of gold nanoparticles, Analyst 139 (2014) 1550–1561. [11] S.J. Lee, Y.S. Kwon, J.E. Lee, E.J. Choi, C.H. Lee, J.Y. Song, M.B. Gu, Detection of VR-2332 strain of porcine reproductive and respiratory syndrome virus type II using an aptamer-based sandwich-type assay, Anal. Chem. 85 (2013) 66–74. [12] J.W. Park, S.J. Lee, E.J. Choi, J. Kim, J.Y. Song, M.B. Gu, An ultra-sensitive detection of a whole virus using dual aptamers developed by immobilizationfree screening, Biosens. Bioelectron. 51 (2014) 324–329. [13] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, M.B. Gu, The affinity ratio-its pivotal role in gold nanoparticle-based competitive colorimetric aptasensor, Biosens. Bioelectron. 26 (2011) 4058–4063. [14] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, J. Jung, M.B. Gu, A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosens. Bioelectron. 26 (2010) 1644–1649. [15] Y.S. Kim, C.J. Hyun, I.A. Kim, M.B. Gu, Isolation and characterization of enantioselective DNA aptamers for ibuprofen, Bioorg. Med. Chem. 18 (2010) 3467–3473. [16] J.H. Niazi, S.J. Lee, Y.S. Kim, M.B. Gu, ssDNA aptamers that selectively bind oxytetracycline, Bioorg. Med. Chem. 16 (2008) 1254–1261. [17] Y.S. Kim, H.S. Jung, T. Matsuura, H.Y. Lee, T. Kawai, M.B. Gu, Electrochemical detection of 17beta-estradiol using DNA aptamer immobilized gold electrode chip, Biosens. Bioelectron. 22 (2007) 2525–2531. [18] M.N. Stojanovic, P. de Prada, D.W. Landry, Aptamer-based folding fluorescent sensor for cocaine, J. Am. Chem. Soc. 123 (2001) 4928–4931. [19] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510. [20] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818–822. [21] R. Stoltenburg, C. Reinemann, B. Strehlitz, SELEX a revolutionary method to generate high-affinity nucleic acid ligands, Biomol. Eng. 24 (2007) 381–403. [22] J.W. Park, R. Tatavarty, D.W. Kim, H.T. Jung, M.B. Gu, Immobilization-free screening of aptamers assisted by graphene oxide, Chem. Commun. 48 (2012) 2071–2083. [23] V.T. Nguyen, Y.S. Kwon, J.H. Kim, M.B. Gu, Multiple GO-SELEX for efficient screening of flexible aptamer, Chem. Commun. 50 (2014) 10513–10516. [24] J. Liu, Y. Lu, Preparation of aptamer-linked gold nanoparticle purple aggregates for colorimetric sensing of analytes, Nat. Protoc. 1 (2006) 246–252. [25] H. Li, L. Rothberg, Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 14036–14039. [26] J.J. Yu, Removal of organophosphate pesticides from wastewater by supercritical carbon dioxide extraction, Water Res. 36 (2002) 1095–1101. [27] R. Stoltenburg, C. Reinemann, B. Strehlitz, FluMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383 (2005) 83–91.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
Analytica Chimica Acta xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor Young Seop Kwon 1, Van-Thuan Nguyen 1, Je Gun Park, Man Bock Gu * College of Life Sciences and Biotechnology, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-713, South Korea
H I G H L I G H T S
G R A P H I C A L A B S T R A C T
A new colorimetric multi-aptasensor was successfully developed for two pesticides. The LOD of this multi-aptasensor were 10 nM and 5 nM for EDI and IBF, respectively. This new multi-aptasensor was successfully applied to the real rice samples. The accuracies were around 80 and 90% in spiked paddy and polished rice samples.
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 December 2014 Received in revised form 30 January 2015 Accepted 10 February 2015 Available online xxx
The sensitive detection of iprobenfos (IBF) and edifenphos (EDI) was successfully conducted by using a new aptamer-based colorimetric multi-aptasensor. The dissociation constants of this multi-target aptamer to both iprobenfos and edifenphos were found to be 1.67 mM and 38 nM, respectively, according to the isothermal calorimetry assay. The aptamer EIA2 was selective to only IBF and EDI, confirmed by AuNP assays. By using this multi-aptasensor, both pesticides IBF and EDI can be eventually detected in a range from 10 nM to 5 nM, respectively. This multi-aptasensor was successfully implemented in spiked rice samples and the accuracies of this AuNP-based multi-aptasensor were around 80 and 90% in spiked paddy and polished rice samples, respectively. This aptamer EIA2 could be applied not only for the detection of pesticides from real samples in agriculture field as POC, but also can be used as a bioreceptor for other types of aptasensors. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Iprobenfos Edifenphos Atpamer Multi-aptasensor Colorimetric
1. Introduction Iprobenfos (IBF) and edifenphos (EDI) are most harmful organophosphate pesticides, which have been accumulated in
* Corresponding author. Tel.: +82 2 3290 3417. E-mail address: [email protected] (M.B. Gu). Equally contributed.
1
many of different agricultural products, such as vegetables, fruits, and especially rice for managing the diseases of agricultural food products [1]. The extensive usages of this pesticides in agriculture have led to their accumulation in many of different agricultural products, such as vegetables, fruits, and especially rice. These pesticides can cause neurotoxicity to occur serious symptoms, such as nausea, dizziness, vomiting, difficulty breathing, tremor, muscle weakness, or seizure to human if ingested at the high concentration [2].
http://dx.doi.org/10.1016/j.aca.2015.02.020 0003-2670/ ã 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
2
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
A fast and accurate detection method for these pesticides is crucially needed. In order to ensure that these harmful pesticides does not exist in a dangerous level in agricultural products, water, soil or dairy products, there have been tremendous efforts to detect these pesticides in fields, for example, by using HPLC, GC, or bacterial sensors [3–5]. These traditional analysis methods, however, are known to be complicate, uncomfortable, and expensive. Therefore, a simple, rapid and accurate detection of these pesticides is indeed required for the environment and food control. Aptamers, single-stranded DNAs or RNAs, can bind to their targets with high specificity and affinity. Since aptamers were known to have advantageous features including no limitation to targets, easy modification and labeling, cost effectiveness, and so on, aptamer has been considered to be a new promising bioreceptor molecule [6,7]. Aptamers have been developed against many different targets, such as proteins [8,9], metal ions [10], viruses [11,12], or especially small molecules [13–18], through a process so called systematic evolution of ligands by exponential enrichment (SELEX) in vitro [19–21]. In this study, we have used the modified immobilization free GO-SELEX which has been previously developed by our group [22,23] for obtaining aptamers to targets, and an unique aptamer binding to two small molecule pesticide targets, IBF and EDI, was successfully developed. By using this aptamer, the detection of both pesticides, IBF and EDI, was successful by using this AuNPbased colorimetric multi-aptasensor in a simple and easy detection protocol, in addition to use the isothermal titration calorimetry (ITC) assay for estimating the dissociation constants of this aptamer to both pesticides. This multi-aptasensor was found to be successful to detect both pesticides from real rice samples with an appropriate protocol. 2. Materials and methods 2.1. Materials The ssDNA library consists of random region and primer region. There is the random region composed of thirty randomly synthesized nucleotides in the middle of ssDNA library ordered by two primer region for PCR amplification (primer sequences FP 50 CGTACGGAATTCGCTAGC-30 and RP 50 -CACGTGGAGCTCGGATCC-30 in a total bases with 50 -CGTACGGAATTCGCTAGC-N30-GGATCCGAGCTCCACGTG-30 . For PCR amplification, FP 50 -fluoresceinCGTACGGAATTCGCTAGC-30 and RP 50 -CACGTGGAGCTCGGATCC-30 were used. Edifenphos and iprobenfos binding DNA aptamer (EIA2) with the complete sequence 50 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAGCTCCACGTG-30 was synthesized from GenotechInc, Korea. 2.2. Reagents All the chemicals, such as iprobenfos (45814, PESTANAL, analytical standard-Fluka), edifenphos (45467, PESTANAL, analytical standard-Fluka), carpropamid (31682, PESTANAL, analytical standard-Fluka), and pencycuron (31118, PESTANAL, analytical standard-Fluka) were purchased from Sigma–Aldrich unless specified, and used without further purification. Graphene Oxide (GO) was purchased from Graphene Supermarket (http://www. graphene-supermarket.com). 2.3. Procedures 2.3.1. Screening of aptamers for pesticides The every round of SELEX process (Fig. S1) was performed by initially heating 200 pmol (Tris–HCl 20 mM, pH 7.4) of random
ssDNA library for 15 min and then cooling for 5 min on ice for obtaining best conformational structure of oligonucleotides. For the first round of SELEX, 200 pmol of denatured ssDNA library was incubated with a mixture of the counter-targets for 30 min. This counter-screening step is intended for removing of ssDNAs that are bound to the counter targets, which are very similar to the target in terms of molecular structure or are unwanted to be bound. After incubation, the 4 mg of GO was added and incubated for 2 h (final volume 1 mL) in order to separate the oligonucleotides that would not bind to the counter targets including edifenphos, carpropamid and pencycuron. Subsequently, the solution was centrifuged for 15 min at 10,000 rcf to precipitate the GO on which some of oligonucleotides were adsorbed. After discarding the supernatant containing the counter targets with ssDNAs bound in the separation process, the centrifuged GO is re-suspended and washed out with the same buffer for 3 times in order to imposea harsher condition. Then, the ssDNAs were recovered from the GO by the addition of the target, iprobenfos, and incubated further for 30 min. The mixture solution, then, was centrifuged and ssDNA library pool was recovered by ethanol precipitation. The amount of recovered ssDNAs was measured by Nanodrop (ND-1000 spectrophotometer) and the obtained library pool was amplified by PCR and ssDNAs were again generated by PAGE separation and purification. 2.3.2. The synthesis of AuNP AuNPs were synthesized by citrate reduction of HAuCl4as reported somewhere else [24]. Briefly, 100 mL of 1 mM HAuCl4 was added into a cleaned two-neck flask. Then, the flask was refluxed on hot plate under stirring condition. When solution began boiling, 10 mL of 38.8 mM of sodium citrate was added. The color changed from pale yellow to deep red in 1 min. Then, the solution was allowed to reflux for 15 min and cool down to room temperature under stirring. The mono-dispersed size of AuNPs was confirmed as around 13 nm by performing transmission electron microscopy (TEM, Tecnai 20). 2.4. Colorimetric assay A mixture of 360 mL of 2.2 nM AuNPs with 20 mL of 8 mM ssDNAs was shaken mildly for 30 min at RT, and incubated for 10 min after adding 20 mL of various concentration targets (0, 1, 2.5, 5, 10, 25, 75, 100 mM) in a binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) at RT. After slow addition of 30 mL of 0.75 M NaCl into the incubated sample, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer. The other control chemicals, such as edifenphos, carpropamid, pencycuron and glyphosate, were also examined under the same procedure for the screening and specificity tests. The error-bar is obtained and incorporated into the figures from three independent experiments. Optimization test: briefly, 360 mL of 0.4 nM AuNPs with 20 mL of 8 mM ssDNA was shaken mildly for 30 min at RT, and then added 20 mL of various concentration targets (0, 1, 2.5, 5, 10, 25, 50, 100, 200, 500, 1000 nM) in a binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) for 30 min at RT. After slow addition of 30 ml of 0.075 M NaCl into the incubated sample solution, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer. 2.4.1. Isothermal Titration Calorimetric (ITC) The binding affinities of the selected aptamer (EIA2) relevant to IBF and EDI were measured by ITC (VP-ITC machine by GE). In the ITC experiment, 0.5 mMaptamer was loaded into the cell with 25 mM of the target in the titrating syringe. All chemicals and aptamer were dissolved into the binding buffer (100 mM NaCl,
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
3
20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, and 1 mM CaCl2). The titration experiments were performed at 25 C with twenty nine times injections with 10 mL of each. The stirring speed was maintained at 246 rpm during the titration. Data were analyzed by fitting with a single-site binding model using Origin software (www.originlab.com). 2.4.2. Preparation of spiked rice samples for assay Five milliliters of 3.2, 6.4 and 64 uM of EDI and IBF samples in methanol were mixed 5gram of ordinary rice in Petri dish in order to obtain 0.1, 0.2, and 2 mg kg1 (1, 2, and 20 ppm) spiked paddy and polished rice samples. Then, the spiked samples were treated in two different ways, the one with washing step using tap water twice after dry of spiked samples, and the other one without washing step. The rice samples spiked without washing step were followed by the drying step directly. Then, the drying step was conducted at room temperature during 14 h for both washed and unwashed samples. After drying, the rice samples were incubated in 2 min with 5 mL of pure methanol and extracted at room temperature. The supernatants from both samples extracted were transferred to the other tube. This supernatant solution was diluted by mixing with the binding buffer (100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, and 1 mM CaCl2) to make 10% methanol in extracted samples of spiked rice for for the colorimetric assay. The colorimetric assay is as follow: 360 mL of 0.4 nM AuNPs mixed with 20 mL of 8 mM ssDNAs was shaken mildly for 30 min at RT, and then added to 20 mL of the extracted samples of the spiked rice in a binding buffer (10% methanol in 100 mM NaCl, 20 mM Tris–HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6) for 30 min at RT. After slow addition of 30 mL of 0.075 M NaCl into the mixture of AuNP, aptamer and the extracted samples of the spiked rice, the color and spectra changes were observed by the naked eye and/or an UV/vis spectrophotometer.
Scheme 1. The A scheme depicts the development of multi-aptasensor.
Fig. 1. The specificity test for pre-screening theaptamer candidates based on the AuNP-based colorimetric assays. Y-axisis the absorbance ratio of AuNPs at 520 and 650 nm wavelengths (A650/A520), which indicates the binding of aptamer to the target if the value is over a certain number.
Scheme 2. The similarity and structure of EIA1 and EIA2 using Mfold. The similarity of EIA1 and EIA2 were highlighted by same color (blue, green, purple and red). (For interpretation of the references to color in this scheme legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
4
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
Fig. 2. The specificity of the aptamer EIA2 based on the AuNPs-based colorimetric assays. The spectral and color changes of the mixture of AuNPs and EIA2 were observed from three independent experiments in the presence of the pesticides (IBF, EDI) along with the additional molecules, including pencycuron, carpropamid, tetracycline, diclofenac, D-alanine, and glyphosate, respectively. (A) Spectral peak shifting was occurred from red to purple. Shifting occurred when only iprobenfos and Edipenphos are added. (B) Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus variety of targets (inset: corresponding photographic images).
3. Result and discussion 3.1. Screening and selection of ssDNA aptamer for two targets The 64-mer aptamer EIA2 specific to iprobenfos and edifenphos was successfully screened out from the random ssDNA library by using immobilized-free GO-SELEX (Scheme 1). Fig. S1 shows that the recovery ratio of bound ssDNAs/total ssDNAs initially
input at every round indicates the saturated state of bounded ssDNAs with the progress of SELEX. To impose the stringency for the specificity of ssDNA aptamer candidates, the counter targets, which have similar structures with the target molecule or from the same category of pesticides but unwanted, were added in each round of selection. After six rounds, the recovery percentage of bounded ssDNAs reached to approximately 90% of the ssDNA pool added. Therefore, the fifth round, which showed the highest
Fig. 3. Molecular interactions of the iprobenfos 0.5 mM EIA2 aptamer, measured by Isothermal Titration Calorimetry (ITC) analysis with 25 mM targets titrated at RT. (A) Aptamer for IBF with Kd of 1.67 mM, (B) aptamer for EDI with Kd of 38 nM.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
5
Fig. 4. A colorimetric detection of IBF and EDI using EIA2 aptamer based on the AuNPs-based colorimetry. (A and C) Absorption spectra of AuNP solutions shown in the presence of various IBF concentrations. Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus concentration of IBF shown. (B and D) Absorption spectra of AuNP solutions in the presence of various EDI concentrations shown (left). Absorbance ratio of AuNPs at 520 and 650 nm wavelength (A650/A520) versus concentration of EDI shown (right) (inset: corresponding photographic images).
recovery (92%), was conducted for the cloning step by using simple Qiagen cloning plus kit, and colonies were then isolated, cultured, purified, and sequenced. 3.2. The specificity and affinity of the aptamer EIA2
Fig. 5. The lowest IBF and EDI detection limitwere obtained at an optimum AuNP concentration. The absorbance ratios is plotted with 0.4 nM of AuNP within same aptamer molar ratio and salt concentration. Insert showed an enlarged spectrum analysis in the range of each pesticide.
The specificities of seven aptamer candidates were characterized by using unmodified AuNP colorimetric assay, which has been a well-known aptasensor platform based on LSPR blue-shift phenomenon occurred due to the aggregation of gold nanoparticles for the small molecule detection [24,25]. Briefly, the AuNPs are stable with a high amount of salts in present of ssDNA due to protection of the adsorbed poly-negative charge of ssDNAs on gold surface. However, when target is added in, the aptamers physically adsorbed on the gold nanoparticles are desorbed after binding with their targets. Then, gold nanoparticles are aggregated in a high salt concentration, and the color of solution is changed. In these specificity screening tests, a few more small molecules, such as antibiotics (tetracycline), drug (diclofenac), amino acid (D-alanine), and pesticide (glyphosate), which were not even used as counter targets in SELEX protocols, were also used as negative control targets. The effect of salts concentration and the ratios of aptamer: AuNP in colorimetric assay were optimized (Figs. S4–S7). As shown in Fig. 1, all the aptamer candidates showed the affinity binding to IBF and also with EDI. The EIA2 aptamer candidate showed the best specificity to both pesticides (IBF and EDI), while other aptamer candidates also showed some degree of specificity to other counter molecules. Interestingly, EIA1 and EIA2 showed quite similar specificity, compared with
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
6
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
other candidates. So, we analyzed the sequences and structure of both aptamers, EIA1 and EIA2. We found out that EIA1 and EIA2 have two same sized stem-loops and four partial consecutive DNAs which are exactly same in both aptamers (Scheme 2, Table S1, and Fig. S3). However, EIA1 seems to have slight interaction with pencycuron, one of a negative control chemical used for selectivity test, to which EIA2 has no affinity. Therefore, only EIA2 has been selected for further characterization studies in detail. To further study on the specificity of EIA2, the AuNP-based colorimetric assays were conducted along with the analysis of the molecular structures of IBF and EDI (Fig. 2 and Fig S8). It is clear from these results that the colors were changed and peaks were shifted from 520 nm to 650 nm only in the presence of IBF or EDI and the ratios of 650/520 were measured to be around 1, which are higher than the negative control which is about 0.2. These indicate that the interaction between the IBF or EDI target and the EIA2 aptamer has been occurred due to the detachment of the aptamer from the surface of AuNPs. In fact, when EDI is used as a counter target, all the ssDNAs binding to this counter targets are supposed to be removed during the counter SELEX steps. By analyzing the structure of IBF and EDI, we found that both IBF and EDI have the same phenylthionyl aromatic ring and phosphoryl group in molecular structure (Fig. S8). Therefore, the binding of EIA2 with EDI may be understood as follows: during the screening process the screened ssDNAs obtained for IBF might also have affinity to EDI. Even though the EIA2 has been screened for the target IBF, it may still have a function to bind to EDI, because both molecules share some part of molecular structure and chemical formula. Therefore, the aptamer EIA2 is now clearly confirmed to have affinity to only both pesticides, IBF and EDI. The dissociation constant, Kd of EIA2 aptamer to each pesticide, IBF or EDI, was measured using the isothermal titration calorimetric (ITC) assay. The plotted graphs by adopting single-site binding model were shown in Fig. 3. The dissociation constants of EIA2 aptamer for IBF and EDI value were found to be 1.67 mM and 38 nM, respectively, in which the affinity of EIA2 to EDI was almost 30-fold higher than IBF. 3.3. The detection sensitivity for both pesticides using AuNPs-based colorimetric EIA2 multi-aptasensor To determine the sensitivity of this multi-aptasensor using EIA2 aptamer, the AuNP-based colorimetric assays were conducted with the various concentrations of both pesticide molecules (0, 1, 2.5, 5, 10, 25, 75, and 100 mM). Fig. 4A and B shows that the color changes of AuNPs with EIA2 and the peak shifting occurred when only the different concentrations of IBF or EDI were added in
the solution followed by the addition of 0.75 M of NaCl. The spectral and color changes of AuNPs solution were measured up to as low as 1 or 10 mM of EDI and IBF, respectively, as shown in Fig. 4C and D. The absorbance ratios at 650–520 nm (A650/A520), representing the spectral and color changes, were plotted (right graph) in Fig. 4C and D, and found to be well matched with the dose dependent trends. However, this limit of detection should be lower than 314 nM to apply real samples [26]. To improve the LOD of this multi-aptasensor, the optimization of this colorimetric assay [27] was carried out in order to increase the sensitivity and lower LOD than the marginal concentration. In this optimization steps, both concentrations of AuNPs was decreased up to 0.4 nM, and various concentrations of IBF and EDI target (0, 1, 2.5, 5, 10, 25, 50, 100, 200, 500, 1000 nM) were added in the mixture of AuNP and aptamers at 0.075 M initial salt concentrations. Fig. 5 shows that IBF and EDI could be detected as low as 10 nM and 5 nM, respectively, by lowering the concentration of AuNPs to improve the limit of detection (by 3s rule). It is much lower than 314 nM, which is the marginal concentration for safe drinking water. Moreover, the dynamic range of this multi-aptasensor was obtained from 10 to 100 nM for IBF and 5 to 25 nM for EDI. Therefore, this colorimetric multi-aptasensor can be used as a POC (Point Of Care) tool for detecting polluted drinking water. It could be worth to note that it should be very efficient for this GO-SELEX to generate aptamers that can bind to multiple chemicals which have some similarity in their functional groups. Therefore, this interesting outcome on generating EIA2 aptamer in this study could be a beneficial feature in developing aptasensors for pesticides or other small molecules target. The Maximum Residue Limits (MRLs) of EDI and IBF are 0.2 mg kg1. Therefore, we selected 0.2 mg kg1 as a threshold for contamination level of pesticide in rice samples. The successful detection of both pesticides spiked in rice samples was shown in Tables 1 and 2 for all eight different samples (paddy and polished rice with washed and unwashed for both pesticides). To determine the reproducibility of this colorimetric multi-aptasensor, the extracted samples of spiked paddy and polished rice, which initially contaminated with both pesticides of 0.1, 0.2, and 2 mg kg1, were carried out. The spiked sample was tested in triplicate and the accuracy of the assay was presented by the recovery percentages and the RSD (%). Especially, the recoveries of this assay were from 113.7% to 80% and the RSDs of assay were 8.19% (the highest number of RSD) for polished rice. In addition, for all of both paddy and polished washed rice samples, the recoveries of this assay were from 64.34 to 35.4%, probably due to some pesticides still unwashed even in washing steps and the low efficiency of the extraction in wetted rice.
Table 1 The reproducibility muti-aptasensor assay of IBF spiked in rice samples. Spiked IBF
Unwashed rice
(mg kg1)
Results (mg kg1)
Recovery (%)
RSD (%)
Results (mg kg1)
Recovery (%)
RSD (%)
Polished rice 0.1 0.20 (MRLs) 2
0.084 0.007 0.209 0.009 1.719 0.018
84.07 7.24 104.28 4.60 85.97 0.93
7.24 4.60 0.93
0.035 0.003 0.097 0.003 0.509 0.01
35.44 2.79 48.35 1.62 25.44 0.52
2.79 1.62 0.52
Paddy rice 0.1 0.20 (MRLs) 2
0.083 0.001 0.165 0.010 1.622 0.164
82.85 1.18 82.36 5.11 81.12 8.19
1.18 5.11 8.19
0.022 0.003 0.053 0.007 0.48 0.007
22.32 3.14 26.61 3.55 24 0.38
3.14 3.55 0.38
Washed rice
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
G Model ACA 233734 No. of Pages 7
Y.S. Kwon et al. / Analytica Chimica Acta xxx (2015) xxx–xxx
7
Table 2 The reproducibility muti-aptasensor assay of EDI spiked in rice samples. Spiked EDI
Unwashed rice
(mg kg1)
Results (mg kg1)
Recovery (%)
RSD (%)
Results (mg kg1)
Recovery (%)
RSD (%)
Polished rice 0.1 0.20 (MRLs) 2
0.081 0.005 0.234 0.002 1.674 0.019
80.50 4.92 116.76 0.95 83.72 0.93
4.92 0.95 0.93
0.053 0.001 0.103 0.003 0.487 0.060
52.47 1.37 51.61 1.34 24.34 2.99
1.37 1.34 2.99
Paddy rice 0.1 0.20 (MRLs) 2
0.085 0.003 0.162 0.003 1.7 0.014
84.50 2.59 80.85 1.34 85.07 0.69
2.59 1.34 0.69
0.055 0.002 0.087 0.004 0.541 0.048
54.84 1.88 43.80 1.94 27.06 2.40
1.88 1.94 2.40
Washed rice
4. Conclusion We have successfully developed and improved a new AuNP-based colorimetric multi-aptasensor for the detection of two pesticides. The binding affinity of the aptamer EIA2 was found to be 1.67 mM and 38 nM for IBF and EDI, respectively, confirmed by ITC method. The aptamer EIA2 was selective to only IBF and EDI, confirmed by AuNP assays. By using this multi-aptasensor, both pesticides IBF and EDI can be eventually detected in a range from 10 nM to 5 nM, respectively. This multi-aptasensor was successfully implemented in spiked rice samples and the accuracies of this AuNP-based multi-aptasensor were around 80 and 90% in spiked paddy and polished rice samples, respectively. This aptamer EIA2 could be applied not only for the detection of pesticides from real samples in agriculture field as POC, but also can be used as a bioreceptor for other types of aptasensors. Acknowledgments This research was supported by Advanced Production Technology Development Program,Ministry of Agriculture, Food and Rural Affairs and the National Research Foundation of Korea (NRF) grant funded by the Korean Government (No. 2013R1A1A2021531). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aca.2015.02.020. References [1] Y.S. Kim, J.Y. Oh, B.K. Hwang, K.D. Kim, Variation in sensitivity of Magnaporthe oryzae isolates from Korea to edifenphos and iprobenfos, Crop Prot. 27 (2008) 1464–1470. [2] T.C. Marrs, Organophosphate poisoning, Pharmacol. Ther. 58 (1993) 51–66. [3] K. Banerjee, Novel GC/MS, HPLC/MS, and HPLC-diode array detector-based methods for determination of pesticide residues in food, feed, water, and soil samples, J. AOAC Int. 93 (2010) 353–354. [4] J. Wang, W. Cheung, W. Chow, Ultra-high performance liquid chromatography/ electrospray ionization-tandem mass spectrometry determination of 151 pesticides in soybeans and pulses, J. AOAC. Int. 96 (2013) 1114–1133. [5] E.I. Rainina, E.N. Efremenco, S.D. Varfolomeyev, A.L. Simonian, J.R. Wild, The development of a new biosensor based on recombinant E. coli for the direct detection of organophosphorus neurotoxins, Biosens. Bioelectron. 11 (1996) 991–1000. [6] S. Tombelli, M. Minunni, M. Mascini, Analytical applications of aptamers, Biosens. Bioelectron. 20 (2005) 2424–2434.
[7] Y. Kim, M.B. Gu, H.S. Kim, Advances in aptamer screening and small molecule aptasensors, Biosensors Based on Aptamers and Enzymes, 140, Springer, Berlin Heidelberg, 2014, pp. 29–67. [8] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Selection of single-stranded DNA molecules that bind and inhibit human thrombin, Nature 355 (1992) 564–566. [9] J.W. Park, S.S. Kallempudi, J.H. Niazi, Y. Gurbuz, B.S. Youn, M.B. Gu, Rapid and sensitive detection of Nampt (PBEF/visfatin) in human serum using an ssDNA aptamer-based capacitive biosensor, Biosens. Bioelectron. 38 (2012) 233–238. [10] Y. Wu, S. Zhan, L. Wang, P. Zhou, Selection of a DNA aptamer for cadmium detection based on cationic polymer mediated aggregation of gold nanoparticles, Analyst 139 (2014) 1550–1561. [11] S.J. Lee, Y.S. Kwon, J.E. Lee, E.J. Choi, C.H. Lee, J.Y. Song, M.B. Gu, Detection of VR-2332 strain of porcine reproductive and respiratory syndrome virus type II using an aptamer-based sandwich-type assay, Anal. Chem. 85 (2013) 66–74. [12] J.W. Park, S.J. Lee, E.J. Choi, J. Kim, J.Y. Song, M.B. Gu, An ultra-sensitive detection of a whole virus using dual aptamers developed by immobilizationfree screening, Biosens. Bioelectron. 51 (2014) 324–329. [13] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, M.B. Gu, The affinity ratio-its pivotal role in gold nanoparticle-based competitive colorimetric aptasensor, Biosens. Bioelectron. 26 (2011) 4058–4063. [14] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, J. Jung, M.B. Gu, A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosens. Bioelectron. 26 (2010) 1644–1649. [15] Y.S. Kim, C.J. Hyun, I.A. Kim, M.B. Gu, Isolation and characterization of enantioselective DNA aptamers for ibuprofen, Bioorg. Med. Chem. 18 (2010) 3467–3473. [16] J.H. Niazi, S.J. Lee, Y.S. Kim, M.B. Gu, ssDNA aptamers that selectively bind oxytetracycline, Bioorg. Med. Chem. 16 (2008) 1254–1261. [17] Y.S. Kim, H.S. Jung, T. Matsuura, H.Y. Lee, T. Kawai, M.B. Gu, Electrochemical detection of 17beta-estradiol using DNA aptamer immobilized gold electrode chip, Biosens. Bioelectron. 22 (2007) 2525–2531. [18] M.N. Stojanovic, P. de Prada, D.W. Landry, Aptamer-based folding fluorescent sensor for cocaine, J. Am. Chem. Soc. 123 (2001) 4928–4931. [19] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510. [20] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818–822. [21] R. Stoltenburg, C. Reinemann, B. Strehlitz, SELEX a revolutionary method to generate high-affinity nucleic acid ligands, Biomol. Eng. 24 (2007) 381–403. [22] J.W. Park, R. Tatavarty, D.W. Kim, H.T. Jung, M.B. Gu, Immobilization-free screening of aptamers assisted by graphene oxide, Chem. Commun. 48 (2012) 2071–2083. [23] V.T. Nguyen, Y.S. Kwon, J.H. Kim, M.B. Gu, Multiple GO-SELEX for efficient screening of flexible aptamer, Chem. Commun. 50 (2014) 10513–10516. [24] J. Liu, Y. Lu, Preparation of aptamer-linked gold nanoparticle purple aggregates for colorimetric sensing of analytes, Nat. Protoc. 1 (2006) 246–252. [25] H. Li, L. Rothberg, Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 14036–14039. [26] J.J. Yu, Removal of organophosphate pesticides from wastewater by supercritical carbon dioxide extraction, Water Res. 36 (2002) 1095–1101. [27] R. Stoltenburg, C. Reinemann, B. Strehlitz, FluMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383 (2005) 83–91.
Please cite this article in press as: Y.S. Kwon, et al., Detection of Iprobenfos and Edifenphos using a new Multi-aptasensor, Anal. Chim. Acta (2015), http://dx.doi.org/10.1016/j.aca.2015.02.020
