Current Eye Research
Volume 10 supplement 1991
Detection of herpes simplex virus DNA sequences in corneal transplant recipients by polymerase chain reaction assays Edouard M.Cantin, Jian Chen, James McNeill', Dru E.Willey and Harry Openshaw
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Department of Neurology, City of Hope National Medical Center, Duarte, CA and ]Department of Ophthalmology, Lorna Linda University, Loma Linda, CA, USA
ABSTRACT Polymerase chain reaction (PCR) assays were used to amplify herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) sequences in DNA extracted from formalin-fixed, paraffin embedded corneas of patients undergoing corneal transplantation. PCR reamplification with an internal (nested) set of primers was required for detection in 10 of the 12 positive corneas indicating very low abundance of viral sequences. Three of the positive corneal samples were from failed corneal grafts. Overall, TK sequences were detected in 8 of 11 corneas from subjects with a past history of herpes keratitis and in 4 of 11 corneas from subjects with no past history of herpetic eye disease. INTRODUCTION In ganglionic neurons, herpes simplex virus type 1 (HSV-1) establishes a latent infection characterized by the presence of viral DNA but restricted viral transcripts (1). Latency can be functionally defined by the lack of infectious HSV-1 in cell free ganglionic homogenates but recovery of virus in explant cultures (in vitro reactivation). Occasionally in experimental animals (2-6) and rarely in man ( 7 , 8 ) , ocular explants or culture of disassociated corneal cells are positive in the absence of ocular shedding or infectious HSV-1 in homogenates of ocular tissue. These observations have lead to the speculation of ocular HSV-1 latency. We have used polymerase chain reaction (PCR) assays to amplify HSV-1 DNA se-
quences in the anterior eye of mice at the latent stage of the infection (9). The PCR method, originally described to amplify a beta globin genomic sequence (lo), utilizes a pair of convergent oligonucleotide primers and repeated cycles of thermal denaturation, primer annealing and primer extension, with heat stable Thermus asuaticus DNA polymerase. There is exponential accumulation of the DNA product, the length of which is defined by the 5' end of the primers. We report here PCR detection of HSV-1 sequences in DNA extracted from formalin-fixed, paraffinembedded corneas removed at the time of corneal transplantation in patients with and without a past history of herpetic eye disease. MATERIALS AND METHODS DNA extracted from 23 paraffin blocks of 21 patients undergoing corneal transplantation were assayed by PCR in this study. One of the subjects had 2 corneal transplant 7 months apart, and both corneal buttons were assayed in this study. Ten subjects had herpetic eye disease (7 women, 3 men; age range 59 75, median 6 7 ) and 11 had non-herpetic eye disease (9 women, 2 men; age range 4 4 - 85, median 72). The non-herpetic group consisted of subjects with pseudophakic corneal edema. One-half or
Received o n August 20, 1990; acccptcd on October 25, 1990
0 Oxford University Press
15
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research the corneal button was deparaffinized with xylene and ethanol and DNA extracted by proteinase K digestion (200 ug/ml) at 68" for 2 hours in the presence of 0.5% SDS followed by phenolchloroform and chloroform - isoamyl alcohol extraction. DNA was concentrated by ethanol precipitation and resuspended in 25 ul 10 mM Tris-HC1 (pH 8,0), 0.1 mM EDTA. The standard PCR reaction contained 10 mM Tris-HC1 (PH 8.3), 50 mM KCL, 1.5 mM MgCl,, 0.01% (W/V) gelatin, each dNTP at 200 uM, 25 pmoles of each oligonucleotide primer, and 1.5 units Thermus aquaticus DNA polymerase in a 50 ul reaction containing one-fifth (0.25 - 1.0 ug) of the extracted DNA. Magnesium and primer concentrations, annealing temperature, substrate concentration, and PCR cycle parameters were optimized for each set of primers. After 40 PCR cycles, onefifth of each reaction was electrophoresed in a 1.8% agarose gel which was then transferred to a nylon membrane using the alkaline blotting technique and the membrane hybridized with a 32P-5' end labelled synthetic oligo-
nucleotide probe corresponding to a sequence in the amplified fragment. Hybridization was in 6 x SSPE (0.9 M NaC1, 6 mM NaH,PO,, 6 mM sodium EDTA pH 7.4, 7% SDS, and 0.5% Blotto (non fat dried milk powder) at 50°C overnight. The filter was washed once at room temperature for 30 minutes and three times at 55°C for 10 minutes each. In assays of the HSV-1 TK sequences, reamplification with nested primers was done (11). In brief a 1 ul aliquot of an empirically determined dilution of the first PCR reaction (usually in the range to lo-*) was used as a DNA substrate for an additional 40 PCR cycles with a new set of primers internal or lo-'
16
nested to the primers used in the first PCR. The primers in the first PCR (designated as TK 1 and 2) amplified a 499 bp fragment, and the nested primers in the second PCR (designated as TK 3 and 4) amplified a 273 bp sequence. The oligonucleotide sequences of the 2 sets of HSV-1 TK primers and the TK probe were as follows: (TK 1) 5' - AATCGCGAACATCTACACCAC - 3 ' , (TK 2) 5' - AAAGCTGTCCCCTTACCTCCC - 3 ' , (TK 3) 5' - CTGCAGATACCGCTCCGTATT - 3', (TK 4) 5' - CATCTTCGACCGCCATCCCAT - 3', and (probe) 5'-GTCAAGCTGCCCATAAGGTAT-3'. The sequence of the HSV TK gene has been published (12). Primers and probe specific for a sequence in the single copy human phosphoglycerate kinase (PGK) gene were kindly provided by Dr. Judy Singer-Sam at the City of Hope. The sequence of the PGK primers and probe correspond to the following co-ordinates of PGK sequence (13): primer (1) 471492, primer (2) 595-616, and (probe) 544-564.
RESULTS To assess the amplification-competence of DNA extracted from paraffin-embedded corneal tissue, primers were used to amplify a 145 bp sequence of the single copy cellular PGK gene. Figure 1 shows the detection by Southern blot hybridization of the amplified PGK sequence in all 23 samples as well as the samples of human DNA extracted from peripheral blood leukocytes (lane C) and DNA from peripheral blood leukocytes mixed with HSV-1 DNA (lane B), but not in the sample of PGK primers reacted without a DNA substrate (lane P). HSV-1 thymidine kinase sequences (499 bp) were amplified in 3 of the 23 clinical specimens using TK primers 1 and 2 as shown in Figure 2. Lanes 9 and
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research
Figure 1. PCR amplification of a 145 bp cellular PGK sequence. Lanes: (P) primers reacted without DNA substrate, (1-23) clinical ocular specimens, (A) human DNA from peripheral blood leu-
kocytes, (C) pHSV 106 plasmid mixed with human DNA from periphreal blood leukocytes, (M) $? Xi 174 molecular weight markers.
11 were from the same subject, a 71-year
(nested) to those used in the initial PCR (11). DNA was re-extracted from the original paraffin blocks and amplified with primers TK 1 and TK 2. Lanes 9 and 11 again gave a positive signal; but lane 17 was negative, probably indicating variable abundance of viral sequences in different parts of the paraffin block of sample 17. With PCR reamplification as shown in Figure 3 an additional 12 samples (including sample 17) gave a positive PCR signal as shown by the 273 bp sequence amplified by TK primers 3 and 4. Two of these corneas (lane 2 and 4) were failed corneal grafts. Lane 2 was the replacement graft for the cornea assayed in lane 22. This patient was a 67 year old woman whose initial transplant was for herpetic corneal scaring. Overall, there was PCR detection of TK sequences in 8 of the 1 1 corneas from patients with a past history of herpes keratitis
old man who had an active corneal ulcer (lane 9) at the time of transplantation. Lane 11 is the PCR on a fibrin clot from the anterior chamber of this eye. None of the other subjects had clinically active herptic disease at the time of transplantation. Lane 17 is a failed corneal graft on a 69-year old man referred for penetrating kerotoplasty because of corneal scarring and lattice stromal dystrophy. There was a past history of herpetic keratitis in the corresponding eye going back 15 years but no clinical evidence of herpes keratitis in at least the past 2 years. This graft was rejected 18 months after transplant. We have shown that the sensitivity of PCR detection of low abundance viral sequences in cellular DNA can be enhanced by the use of a second round of 20-40 PCR cycles using primers internal ~
17
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research
ical ocular specimens, (P) Primers
reacted without DNA substrate, (C) pHSV 106 plasmid mixed with human DNA from peripheral blood leukocytes, (M) P, X 174 molecular weight markers.
Figure 3. PCR reamplification of a 273 bp HSV-1 TK sequence from the nested set of TK primers 3 and 4 . Lanes: (P) Primers TK 3 and TK 4 reacted without DNA substrate, (PI) reamplification with primers TK 3 and TK 4 of a sample
previously amplified with primers TK 1 and TK 2 without DNA substrate, (1-23) clinical ocular specimens, (A) human DNA from peripheral blood leukocytes, (C) pHSV 106 plasmid, (M) P, X 174 molecular weight markers.
Figure 2. PCR amplification of a 499 bp HSV-1 TK sequence with the outer set of TK primers 1 and 2. Lanes: (1-23) clin-
18
Current Eye Research
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
and in 4 of 11 corneas from patients with no past history of ocular infection. DISCUSSION HSV-1 TK sequences were detected in 3 of 22 samples with the first PCR (TK primers 1 and 2) and in 14 of 22 samples with reamplification using the nested primers (TK 3 and 4). The increased sensitivity is due in part to the virtual elimination of the influence of mispriming of cell DNA sequences in the first PCR by the addition of the new set of primers in the second PCR. In a reconstruction experiment (not shown) HSV-1 genomic DNA was added to 250 ng of cell DNA. The limit of detection was 100 HSV-1 copies with TK primers 1 and 2 and a single HSV-1 copy after reamplification with TK primers 3 and 4 (Cantin, et al. unpublished). Dilution of the first PCR reaction product, as determined empirically, was important to achieve specific amplication of the target sequence in the second PCR. The dilution minimizes secondary mispriming of cell DNA sequences from the first PCR by the nested primer set. It seems unlikely that the high frequency of detection of TK sequences in human corneas represent ongoing HSV-1 shedding in the tear film. Such asymptomatic viral shedding can occur in 10% of latently infected rabbits at any one time (14), but shedding rarely if ever occurs at the latent stage in mice as assayed by viral culture or by changes in the immune response (15); and we have detected HSV-1 DNA but failed to detect HSV-1 RNA in the corneas of latently infected mice using PCR assays (11). Failure to detect RNA transcripts also argues against ganglionic reactivation and subsequent spread to infect a small
number of corneal cells, unless the corneal infection is abortive. For future studies, it will be important to assay tear film by PCR. However, our present results support bona fide HSV latency in the eye and give a rational basis for re-examining the dogma that alpha herpesvirus latency is restricted to neuronal cells. Also at variance with this dogma are the observations of apparent latency of HSV-2 in the mouse footpad (16-18); and although most in hybridization studies show viral sequences restricted to neuronal cells (19-21), there have been contradictory reports of HSV-1 transcripts (22) and varicella zoster virus transcripts (23) in non-neuronal nervous system cells. To date, attempts have been unsuccessful to demonstrate the so-called latency associated transcripts (LATs) in the corneas of latently infected mice and rabbits by in situ hybridization (24); although, a recent report using mutant viruses expressing B-galactosidase under the LAT promoter succeeded in labeling the iris and ciliary body of mice at the latent stage of the infection (25)
-
Whether HSV-1 DNA sequences in the human cornea have the potential to reactivate is a question that has important implications for eye banks. This is particularly so since we detected TK sequences in 4 of ll subjects with no history of herpetic eye disease. Other investigators have similar results in non-herpetic eye disease groups including 6 of 29 surgically removed corneas assayed by slot blot hybridization (26) and 1 of 32 cadaveric corneas assayed by a single round of PCR (without reamplification) (27). In a limited number of animals, HSV-1 infection was not transferred by corneal grafts from
19
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research latently infected donors to uninfected recipient rabbits (28), and there have been no proven instances of acquiring HSV-1 infection from corneal transplantation in humans (29). However, such HSV-1 infections in humans could be delayed and difficult to recognize, and HSV-1 graft infection may possibly mimic graft rejection. The results of the present study encourage investigation of the frequency of HSV-1 DNA sequences in eye bank corneas and the consequences of using these corneas in transplantation.
7.
Shimeld, C., Tullo, A . B . , Easty, D.L. and Thomsitt, J . (1982) Isolation of herpes simplex virus from the cornea in chronic stromal keratitis. Br. J. Ophthalmol. &
8.
Tullo, A.B., Easty, D.L., Schimeld, C., Steriling, P.E. and Darville, J.M. (1985) Isolation of herpes simplex virus from corneal discs of patients with chronic stromal keratitis. Trans. Ophthal. SOC. UK,
643-647.
104, 159. 9.
Willev, D.E.. Cantin. E. and Openshaw, H. ’ (1989) Herpes simplex virus DNA in ocular tissue in latently infected mice. Invest. Ophthalmol. Vis. Sci. 30(Sugpl.),
10
Saiki, R.K. , Scharf , S. , Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of a sickle cell anemia. Science, 230,
215.
ACKNOWLEDGEMENTS This work was supported by EY 08028, EY 05588, and CA 33572 from the National Institutes of Health.
1350-1354.
11. Cantin, E.M., Lange, W. and
CORRESPONDING AUTHOR Edouard M. Cantin, Department of Neurology, City of Hope National Medical Center, Duarte California 91010. REFERENCES 1. Roizman, B. and Sears, A.E. (1987) An inquiry into the mechanisms of herpes simplex virus latency. Ann. Rev. Microbiol. 41, 543-571. 2. Openshaw, H. (1982) Latency of herpes simplex virus in ocular tissue of mice. Infect. Immun. 3 9 ,
12.
13.
960-962. 3.
Abghari, S.G. and Stulting, R.D. (1988) Recovery of herpes simplex virus from ocular tissues of latently infected inbred mice. Invest. Ophthalmol. Vis. Sci. a ,
14.
239-243. 4.
5.
6.
20
Cook, S.D. and Brown, S.M. (1986) Herpes simplex virus type 1 persistence and latency in cultured rabbit corneal epithelial cells, keratocytes, and endothelial cells. Br. J . Ophthalmol. 7 0 , 642-650. Cook, S.D., Batra, S.K. and Brown, S.M. (1987) Recovery of herpes simplex virus from the corneas of experimentally infected rabbits. J. Gen. Virol. 6 8.2013-2017. O’Brien, W.J. and Taylor, J.L. (1989) The isolation of herpes simplex virus from rabbit corneas during latency. Invest. Ophthalmol. Vis. Science, 30, 357-364.
15.
16.
Openshaw, H. (1990) Application of polymerase chain reaction assays to studies of herpes simplex virus latency. Intervirology, In press. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L . J . , Scott, J.E., and Taylor, P. (1988) The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69, 1531-1574. Singer-Sam, J., Keith, D.H., Tani, K., Simmer, R.L., Shively, L., Lindsay, S . , Yoshida, A. and Riggs, A.D. (1984) Sequence of the promotor region of the gene for human Xlinked 3 phosphoglycerate kinase. Gene, 3 2 , 409-417. Nesburn, A.B., Elliot, J.H. and Leibowitz, H.M. (1967) Spontaneous reactivations of experimental herpes simplex keratitis in rabbits. Arch. Ophthalmol. 7 8 , 523-529. Sekizawa, T . , Openshaw, H., Wohlenberg, C. and Notkins, A.L. (1980) Latency of herpes simplex virus in absence of neutralizing antibody: model for reactivation. Science, 210, 1026-1028. Al-Saadi, S.A., Clements, G.B. and Subak-Sharpe, J.H. (1982) Viral genes modify herpes simplex virus latency both in mouse footpad and sensory ganglia. J. Gen. Virol. 6 4 ,
1175-1179. 17. Al-Saadi, S.A., Gross, P. and Wildy, P. (1987) Herpes simplex virus type 2 latency in the footpad of mice:
effect of acycloguanosine on the
Current Eye Research recovery of virus.
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
69, 433-438.
J. Gen. Virol.
18. Clements, G.B. and Subak-Sharpe, J.H. (1988) Herpes simplex virus type 2 establishes latency in the mouse footpad. J. Gen. Virol. 6 9 , 375-383. 19. Cook, M.L, Bastone, V.B. and Stevens, J.G. (1974) Evidence that neurons harbor latent herpes simplex virus. Infect. Immun. 2, 946-951. 20. McLennan, J.L. and Darby, G. (1980) Herpes simplex latency - The cellular location of virus in dorsal root ganglia and the fate of the infected cells following virus activation. J. Gen. Virol. 5 l , 233243. 21. Gilden, D.H., Rozenman, Y., Murray, R. , Devlin, M. and Vafai, A. (1987) Detection of varicella-zoster virus nucleic acid in neurons of normal human thoracic ganglia. Ann. Neurol. 2 2 , 377-380. 22. Deatly, A.M., Spivak, J.G., Lavi, E., O'Boyle 11, D.R. and Fraser, N.W. (1988) Latent herpes simplex virus type 1 transcripts in peripheral and central nervous system tissues of mice map to similar regions of the viral genome. J. Virol. 62, 749-756. 23. Croen, K.D., Ostrove, J.M., Dragovic, L.J. and Straus, S.E. (1988) Patterns of gene expression and sites of latency in human nerve ganglia are different for varicellazoster and herpes simplex viruses. Proc. Natl. Acad. Science USA, 85, 9773-9777. 24. Romanowski, E., Araullo-Cruz, T. and Gordon, Y. J. (1990) The controversy over HSV-1 corneal 1atency:hypothesis or proven fact. Invest. Ophthalmol. Vis. Sci. ~ ~ ( S U D D ~ . ) , 219. 25. Tumpey, T.M., Glorioso, J.C. and Hendricks, R.L. (1990) Expression of the HSV-1 latency associated transcript (LAT) promoter in ocular tissues of the mouse. Invest. Ophthalmol. Vis. Sci. ~ ~ ( S U D D ~ . ) , 313. 26. Rong, B. L. , Kenyon, K.R. , Bean, K.M., Langston, D.P. and Dunkel, E.C. (1988) Detection of the HSV genome in human corneal buttons. Invest. Ophthalmol. Vis. Sci. 29 (SupDl), 158. 27. Pflugfelder, S.C., Pereira, I.E., Rabinowitzs, S . , Levine, J.A. and Atherton, S.S. (1990) Diagnosis of herpetic ocular disease using PCR. Invest. Ophthalmol. Vis. Sci. Sl(Supp1.) , 221. 28. Rootman, D.S., Haruta, Y., Hill, J.M. and Kaufman, H.E. (1988) Corneal nerves are necessary for
adrenergic reactivation of ocular herpes. Invest. Ophthalmol. Vis. Sci. 29, 351-356. 29. Pepose, J . S . (1989) Transfer of infection by a corneal transplantation. Transplant. Proc. 2 l , 31303132.
21
Volume 10 supplement 1991
Detection of herpes simplex virus DNA sequences in corneal transplant recipients by polymerase chain reaction assays Edouard M.Cantin, Jian Chen, James McNeill', Dru E.Willey and Harry Openshaw
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Department of Neurology, City of Hope National Medical Center, Duarte, CA and ]Department of Ophthalmology, Lorna Linda University, Loma Linda, CA, USA
ABSTRACT Polymerase chain reaction (PCR) assays were used to amplify herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) sequences in DNA extracted from formalin-fixed, paraffin embedded corneas of patients undergoing corneal transplantation. PCR reamplification with an internal (nested) set of primers was required for detection in 10 of the 12 positive corneas indicating very low abundance of viral sequences. Three of the positive corneal samples were from failed corneal grafts. Overall, TK sequences were detected in 8 of 11 corneas from subjects with a past history of herpes keratitis and in 4 of 11 corneas from subjects with no past history of herpetic eye disease. INTRODUCTION In ganglionic neurons, herpes simplex virus type 1 (HSV-1) establishes a latent infection characterized by the presence of viral DNA but restricted viral transcripts (1). Latency can be functionally defined by the lack of infectious HSV-1 in cell free ganglionic homogenates but recovery of virus in explant cultures (in vitro reactivation). Occasionally in experimental animals (2-6) and rarely in man ( 7 , 8 ) , ocular explants or culture of disassociated corneal cells are positive in the absence of ocular shedding or infectious HSV-1 in homogenates of ocular tissue. These observations have lead to the speculation of ocular HSV-1 latency. We have used polymerase chain reaction (PCR) assays to amplify HSV-1 DNA se-
quences in the anterior eye of mice at the latent stage of the infection (9). The PCR method, originally described to amplify a beta globin genomic sequence (lo), utilizes a pair of convergent oligonucleotide primers and repeated cycles of thermal denaturation, primer annealing and primer extension, with heat stable Thermus asuaticus DNA polymerase. There is exponential accumulation of the DNA product, the length of which is defined by the 5' end of the primers. We report here PCR detection of HSV-1 sequences in DNA extracted from formalin-fixed, paraffinembedded corneas removed at the time of corneal transplantation in patients with and without a past history of herpetic eye disease. MATERIALS AND METHODS DNA extracted from 23 paraffin blocks of 21 patients undergoing corneal transplantation were assayed by PCR in this study. One of the subjects had 2 corneal transplant 7 months apart, and both corneal buttons were assayed in this study. Ten subjects had herpetic eye disease (7 women, 3 men; age range 59 75, median 6 7 ) and 11 had non-herpetic eye disease (9 women, 2 men; age range 4 4 - 85, median 72). The non-herpetic group consisted of subjects with pseudophakic corneal edema. One-half or
Received o n August 20, 1990; acccptcd on October 25, 1990
0 Oxford University Press
15
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research the corneal button was deparaffinized with xylene and ethanol and DNA extracted by proteinase K digestion (200 ug/ml) at 68" for 2 hours in the presence of 0.5% SDS followed by phenolchloroform and chloroform - isoamyl alcohol extraction. DNA was concentrated by ethanol precipitation and resuspended in 25 ul 10 mM Tris-HC1 (pH 8,0), 0.1 mM EDTA. The standard PCR reaction contained 10 mM Tris-HC1 (PH 8.3), 50 mM KCL, 1.5 mM MgCl,, 0.01% (W/V) gelatin, each dNTP at 200 uM, 25 pmoles of each oligonucleotide primer, and 1.5 units Thermus aquaticus DNA polymerase in a 50 ul reaction containing one-fifth (0.25 - 1.0 ug) of the extracted DNA. Magnesium and primer concentrations, annealing temperature, substrate concentration, and PCR cycle parameters were optimized for each set of primers. After 40 PCR cycles, onefifth of each reaction was electrophoresed in a 1.8% agarose gel which was then transferred to a nylon membrane using the alkaline blotting technique and the membrane hybridized with a 32P-5' end labelled synthetic oligo-
nucleotide probe corresponding to a sequence in the amplified fragment. Hybridization was in 6 x SSPE (0.9 M NaC1, 6 mM NaH,PO,, 6 mM sodium EDTA pH 7.4, 7% SDS, and 0.5% Blotto (non fat dried milk powder) at 50°C overnight. The filter was washed once at room temperature for 30 minutes and three times at 55°C for 10 minutes each. In assays of the HSV-1 TK sequences, reamplification with nested primers was done (11). In brief a 1 ul aliquot of an empirically determined dilution of the first PCR reaction (usually in the range to lo-*) was used as a DNA substrate for an additional 40 PCR cycles with a new set of primers internal or lo-'
16
nested to the primers used in the first PCR. The primers in the first PCR (designated as TK 1 and 2) amplified a 499 bp fragment, and the nested primers in the second PCR (designated as TK 3 and 4) amplified a 273 bp sequence. The oligonucleotide sequences of the 2 sets of HSV-1 TK primers and the TK probe were as follows: (TK 1) 5' - AATCGCGAACATCTACACCAC - 3 ' , (TK 2) 5' - AAAGCTGTCCCCTTACCTCCC - 3 ' , (TK 3) 5' - CTGCAGATACCGCTCCGTATT - 3', (TK 4) 5' - CATCTTCGACCGCCATCCCAT - 3', and (probe) 5'-GTCAAGCTGCCCATAAGGTAT-3'. The sequence of the HSV TK gene has been published (12). Primers and probe specific for a sequence in the single copy human phosphoglycerate kinase (PGK) gene were kindly provided by Dr. Judy Singer-Sam at the City of Hope. The sequence of the PGK primers and probe correspond to the following co-ordinates of PGK sequence (13): primer (1) 471492, primer (2) 595-616, and (probe) 544-564.
RESULTS To assess the amplification-competence of DNA extracted from paraffin-embedded corneal tissue, primers were used to amplify a 145 bp sequence of the single copy cellular PGK gene. Figure 1 shows the detection by Southern blot hybridization of the amplified PGK sequence in all 23 samples as well as the samples of human DNA extracted from peripheral blood leukocytes (lane C) and DNA from peripheral blood leukocytes mixed with HSV-1 DNA (lane B), but not in the sample of PGK primers reacted without a DNA substrate (lane P). HSV-1 thymidine kinase sequences (499 bp) were amplified in 3 of the 23 clinical specimens using TK primers 1 and 2 as shown in Figure 2. Lanes 9 and
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research
Figure 1. PCR amplification of a 145 bp cellular PGK sequence. Lanes: (P) primers reacted without DNA substrate, (1-23) clinical ocular specimens, (A) human DNA from peripheral blood leu-
kocytes, (C) pHSV 106 plasmid mixed with human DNA from periphreal blood leukocytes, (M) $? Xi 174 molecular weight markers.
11 were from the same subject, a 71-year
(nested) to those used in the initial PCR (11). DNA was re-extracted from the original paraffin blocks and amplified with primers TK 1 and TK 2. Lanes 9 and 11 again gave a positive signal; but lane 17 was negative, probably indicating variable abundance of viral sequences in different parts of the paraffin block of sample 17. With PCR reamplification as shown in Figure 3 an additional 12 samples (including sample 17) gave a positive PCR signal as shown by the 273 bp sequence amplified by TK primers 3 and 4. Two of these corneas (lane 2 and 4) were failed corneal grafts. Lane 2 was the replacement graft for the cornea assayed in lane 22. This patient was a 67 year old woman whose initial transplant was for herpetic corneal scaring. Overall, there was PCR detection of TK sequences in 8 of the 1 1 corneas from patients with a past history of herpes keratitis
old man who had an active corneal ulcer (lane 9) at the time of transplantation. Lane 11 is the PCR on a fibrin clot from the anterior chamber of this eye. None of the other subjects had clinically active herptic disease at the time of transplantation. Lane 17 is a failed corneal graft on a 69-year old man referred for penetrating kerotoplasty because of corneal scarring and lattice stromal dystrophy. There was a past history of herpetic keratitis in the corresponding eye going back 15 years but no clinical evidence of herpes keratitis in at least the past 2 years. This graft was rejected 18 months after transplant. We have shown that the sensitivity of PCR detection of low abundance viral sequences in cellular DNA can be enhanced by the use of a second round of 20-40 PCR cycles using primers internal ~
17
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research
ical ocular specimens, (P) Primers
reacted without DNA substrate, (C) pHSV 106 plasmid mixed with human DNA from peripheral blood leukocytes, (M) P, X 174 molecular weight markers.
Figure 3. PCR reamplification of a 273 bp HSV-1 TK sequence from the nested set of TK primers 3 and 4 . Lanes: (P) Primers TK 3 and TK 4 reacted without DNA substrate, (PI) reamplification with primers TK 3 and TK 4 of a sample
previously amplified with primers TK 1 and TK 2 without DNA substrate, (1-23) clinical ocular specimens, (A) human DNA from peripheral blood leukocytes, (C) pHSV 106 plasmid, (M) P, X 174 molecular weight markers.
Figure 2. PCR amplification of a 499 bp HSV-1 TK sequence with the outer set of TK primers 1 and 2. Lanes: (1-23) clin-
18
Current Eye Research
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
and in 4 of 11 corneas from patients with no past history of ocular infection. DISCUSSION HSV-1 TK sequences were detected in 3 of 22 samples with the first PCR (TK primers 1 and 2) and in 14 of 22 samples with reamplification using the nested primers (TK 3 and 4). The increased sensitivity is due in part to the virtual elimination of the influence of mispriming of cell DNA sequences in the first PCR by the addition of the new set of primers in the second PCR. In a reconstruction experiment (not shown) HSV-1 genomic DNA was added to 250 ng of cell DNA. The limit of detection was 100 HSV-1 copies with TK primers 1 and 2 and a single HSV-1 copy after reamplification with TK primers 3 and 4 (Cantin, et al. unpublished). Dilution of the first PCR reaction product, as determined empirically, was important to achieve specific amplication of the target sequence in the second PCR. The dilution minimizes secondary mispriming of cell DNA sequences from the first PCR by the nested primer set. It seems unlikely that the high frequency of detection of TK sequences in human corneas represent ongoing HSV-1 shedding in the tear film. Such asymptomatic viral shedding can occur in 10% of latently infected rabbits at any one time (14), but shedding rarely if ever occurs at the latent stage in mice as assayed by viral culture or by changes in the immune response (15); and we have detected HSV-1 DNA but failed to detect HSV-1 RNA in the corneas of latently infected mice using PCR assays (11). Failure to detect RNA transcripts also argues against ganglionic reactivation and subsequent spread to infect a small
number of corneal cells, unless the corneal infection is abortive. For future studies, it will be important to assay tear film by PCR. However, our present results support bona fide HSV latency in the eye and give a rational basis for re-examining the dogma that alpha herpesvirus latency is restricted to neuronal cells. Also at variance with this dogma are the observations of apparent latency of HSV-2 in the mouse footpad (16-18); and although most in hybridization studies show viral sequences restricted to neuronal cells (19-21), there have been contradictory reports of HSV-1 transcripts (22) and varicella zoster virus transcripts (23) in non-neuronal nervous system cells. To date, attempts have been unsuccessful to demonstrate the so-called latency associated transcripts (LATs) in the corneas of latently infected mice and rabbits by in situ hybridization (24); although, a recent report using mutant viruses expressing B-galactosidase under the LAT promoter succeeded in labeling the iris and ciliary body of mice at the latent stage of the infection (25)
-
Whether HSV-1 DNA sequences in the human cornea have the potential to reactivate is a question that has important implications for eye banks. This is particularly so since we detected TK sequences in 4 of ll subjects with no history of herpetic eye disease. Other investigators have similar results in non-herpetic eye disease groups including 6 of 29 surgically removed corneas assayed by slot blot hybridization (26) and 1 of 32 cadaveric corneas assayed by a single round of PCR (without reamplification) (27). In a limited number of animals, HSV-1 infection was not transferred by corneal grafts from
19
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
Current Eye Research latently infected donors to uninfected recipient rabbits (28), and there have been no proven instances of acquiring HSV-1 infection from corneal transplantation in humans (29). However, such HSV-1 infections in humans could be delayed and difficult to recognize, and HSV-1 graft infection may possibly mimic graft rejection. The results of the present study encourage investigation of the frequency of HSV-1 DNA sequences in eye bank corneas and the consequences of using these corneas in transplantation.
7.
Shimeld, C., Tullo, A . B . , Easty, D.L. and Thomsitt, J . (1982) Isolation of herpes simplex virus from the cornea in chronic stromal keratitis. Br. J. Ophthalmol. &
8.
Tullo, A.B., Easty, D.L., Schimeld, C., Steriling, P.E. and Darville, J.M. (1985) Isolation of herpes simplex virus from corneal discs of patients with chronic stromal keratitis. Trans. Ophthal. SOC. UK,
643-647.
104, 159. 9.
Willev, D.E.. Cantin. E. and Openshaw, H. ’ (1989) Herpes simplex virus DNA in ocular tissue in latently infected mice. Invest. Ophthalmol. Vis. Sci. 30(Sugpl.),
10
Saiki, R.K. , Scharf , S. , Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of a sickle cell anemia. Science, 230,
215.
ACKNOWLEDGEMENTS This work was supported by EY 08028, EY 05588, and CA 33572 from the National Institutes of Health.
1350-1354.
11. Cantin, E.M., Lange, W. and
CORRESPONDING AUTHOR Edouard M. Cantin, Department of Neurology, City of Hope National Medical Center, Duarte California 91010. REFERENCES 1. Roizman, B. and Sears, A.E. (1987) An inquiry into the mechanisms of herpes simplex virus latency. Ann. Rev. Microbiol. 41, 543-571. 2. Openshaw, H. (1982) Latency of herpes simplex virus in ocular tissue of mice. Infect. Immun. 3 9 ,
12.
13.
960-962. 3.
Abghari, S.G. and Stulting, R.D. (1988) Recovery of herpes simplex virus from ocular tissues of latently infected inbred mice. Invest. Ophthalmol. Vis. Sci. a ,
14.
239-243. 4.
5.
6.
20
Cook, S.D. and Brown, S.M. (1986) Herpes simplex virus type 1 persistence and latency in cultured rabbit corneal epithelial cells, keratocytes, and endothelial cells. Br. J . Ophthalmol. 7 0 , 642-650. Cook, S.D., Batra, S.K. and Brown, S.M. (1987) Recovery of herpes simplex virus from the corneas of experimentally infected rabbits. J. Gen. Virol. 6 8.2013-2017. O’Brien, W.J. and Taylor, J.L. (1989) The isolation of herpes simplex virus from rabbit corneas during latency. Invest. Ophthalmol. Vis. Science, 30, 357-364.
15.
16.
Openshaw, H. (1990) Application of polymerase chain reaction assays to studies of herpes simplex virus latency. Intervirology, In press. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L . J . , Scott, J.E., and Taylor, P. (1988) The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69, 1531-1574. Singer-Sam, J., Keith, D.H., Tani, K., Simmer, R.L., Shively, L., Lindsay, S . , Yoshida, A. and Riggs, A.D. (1984) Sequence of the promotor region of the gene for human Xlinked 3 phosphoglycerate kinase. Gene, 3 2 , 409-417. Nesburn, A.B., Elliot, J.H. and Leibowitz, H.M. (1967) Spontaneous reactivations of experimental herpes simplex keratitis in rabbits. Arch. Ophthalmol. 7 8 , 523-529. Sekizawa, T . , Openshaw, H., Wohlenberg, C. and Notkins, A.L. (1980) Latency of herpes simplex virus in absence of neutralizing antibody: model for reactivation. Science, 210, 1026-1028. Al-Saadi, S.A., Clements, G.B. and Subak-Sharpe, J.H. (1982) Viral genes modify herpes simplex virus latency both in mouse footpad and sensory ganglia. J. Gen. Virol. 6 4 ,
1175-1179. 17. Al-Saadi, S.A., Gross, P. and Wildy, P. (1987) Herpes simplex virus type 2 latency in the footpad of mice:
effect of acycloguanosine on the
Current Eye Research recovery of virus.
Curr Eye Res Downloaded from informahealthcare.com by McMaster University on 01/09/15 For personal use only.
69, 433-438.
J. Gen. Virol.
18. Clements, G.B. and Subak-Sharpe, J.H. (1988) Herpes simplex virus type 2 establishes latency in the mouse footpad. J. Gen. Virol. 6 9 , 375-383. 19. Cook, M.L, Bastone, V.B. and Stevens, J.G. (1974) Evidence that neurons harbor latent herpes simplex virus. Infect. Immun. 2, 946-951. 20. McLennan, J.L. and Darby, G. (1980) Herpes simplex latency - The cellular location of virus in dorsal root ganglia and the fate of the infected cells following virus activation. J. Gen. Virol. 5 l , 233243. 21. Gilden, D.H., Rozenman, Y., Murray, R. , Devlin, M. and Vafai, A. (1987) Detection of varicella-zoster virus nucleic acid in neurons of normal human thoracic ganglia. Ann. Neurol. 2 2 , 377-380. 22. Deatly, A.M., Spivak, J.G., Lavi, E., O'Boyle 11, D.R. and Fraser, N.W. (1988) Latent herpes simplex virus type 1 transcripts in peripheral and central nervous system tissues of mice map to similar regions of the viral genome. J. Virol. 62, 749-756. 23. Croen, K.D., Ostrove, J.M., Dragovic, L.J. and Straus, S.E. (1988) Patterns of gene expression and sites of latency in human nerve ganglia are different for varicellazoster and herpes simplex viruses. Proc. Natl. Acad. Science USA, 85, 9773-9777. 24. Romanowski, E., Araullo-Cruz, T. and Gordon, Y. J. (1990) The controversy over HSV-1 corneal 1atency:hypothesis or proven fact. Invest. Ophthalmol. Vis. Sci. ~ ~ ( S U D D ~ . ) , 219. 25. Tumpey, T.M., Glorioso, J.C. and Hendricks, R.L. (1990) Expression of the HSV-1 latency associated transcript (LAT) promoter in ocular tissues of the mouse. Invest. Ophthalmol. Vis. Sci. ~ ~ ( S U D D ~ . ) , 313. 26. Rong, B. L. , Kenyon, K.R. , Bean, K.M., Langston, D.P. and Dunkel, E.C. (1988) Detection of the HSV genome in human corneal buttons. Invest. Ophthalmol. Vis. Sci. 29 (SupDl), 158. 27. Pflugfelder, S.C., Pereira, I.E., Rabinowitzs, S . , Levine, J.A. and Atherton, S.S. (1990) Diagnosis of herpetic ocular disease using PCR. Invest. Ophthalmol. Vis. Sci. Sl(Supp1.) , 221. 28. Rootman, D.S., Haruta, Y., Hill, J.M. and Kaufman, H.E. (1988) Corneal nerves are necessary for
adrenergic reactivation of ocular herpes. Invest. Ophthalmol. Vis. Sci. 29, 351-356. 29. Pepose, J . S . (1989) Transfer of infection by a corneal transplantation. Transplant. Proc. 2 l , 31303132.
21
