138
Journal of Hepatology, 1992; 16:138-144 ©1992 ElsevierScientificPublishers Ireland Ltd. All rights reserved. 0168-8278/92/$05.00
HEPAT01132
Detection of hepatitis C virus RNA by nested polymerase chain reaction in sera of patients with chronic non-A, non-B hepatitis treated with interferon Yoshinao Kobayashi, Shozo Watanabe, Masayoshi Konishi, Masato Yokoi, Jiro Ikoma, Ryuichi Kakehashi, Yuji Kojima and Shiro Suzuki Third Department of Internal Medicine, Mie University School of Medicine, Mie, Japan
(Received31 May 1991)
To evaluate the effect of interferon-~ treatment on the levels of serum aminotransferase (sALT) and of hepatitis C virus (HCV)-RNA, we studied 19 patients with chronic non-A, non-B (NANB) hepatitis. Before therapy, 14 patients were positive by nested polymerase chain reaction (PCR) with primers deduced from the 5'-non-coding region of the HCV genome. Serum HCV-RNA had disappeared in 12 (85.7%) of them by the end of therapy, but then reappeared 6 months later in 4 of these 12 patients. A marked improvement in sALT was seen in 5 of the 8 patients with sustained HCV-RNA disappearance, but not in the 4 patients with only transient HCV-RNA negativity. Pre-treatment levels of hepatitis C viremia, analyzed by single PCR and dot blot hybridization, ranged from 2.103 to 2"108 copies/ml, and were below 2.105 copies/ml in patients with a complete response to interferon therapy. These results suggest that this HCV-RNA assay, combined with sALT testing, may be useful for estimation of the long-term efficacy of interferon therapy in hepatitis C. K e y words: Non-A, non-B hepatitis; Hepatitis C; HCV-RNA; Interferon; Polymerase chain reaction
Approximately 95% of post-transfusion hepatitis is of the non-A, non-B type throughout the world, as is also more than 50% of the sporadic cases. In 1989, Choo and colleagues cloned cDNA from the plasma of a chimpanzee with chronic NANB hepatitis, and identified an agent which was termed 'hepatitis C virus' (HCV) (1). The identified HCV genome is approximately 10 kb in size and nearly three-quarters of it towards the 3'terminal has been sequenced (European Patent Application No. 88310922.5). HCV isolated from Japanese patients with chronic hepatitis has a significantly different nucleotide sequence (up to 33%) from the prototype HCV genome (2-4). In 1990, Okamoto and colleagues determined that the 5'-terminal sequence of the HCV genome contained a long open reading frame that coded for the viral polyprotein, and was preceded by an untranslated region of at least 324 nucleotides (5).
The nucleotide sequence of this 5'-non-coding region is highly conserved among different HCV strains. Since sequence mismatching between primers and viral template-nucleic acid is a major cause of the failure to amplify the HCV genome by polymerase chain reaction (PCR1 (6), primers deducted from the 5'-non-coding region are more suitable for the detection of HCV-RNA by PCR. Interferon has been used as an antiviral drug for the treatment of chronic NANB hepatitis (14,15), and shown to produce beneficial effects on serum aminotransferase (sALT) levels. In this paper, we report detection of the HCV-RNA-amplified 5'-non-coding region by PCR in sera of patients with chronic NANB hepatitis in ordei to confirm the high prevalence of HCV-RNA in chronic NANB hepatitis and to assess the usefulness of this serum marker for monitoring the long-term efficacy oJ interferon therapy.
Correspondence to: Y. Kobayashi,Third Department of Internal Medicine,Mie UniversitySchool of Medicine,2-174 Edobashi, Tsu, Mie 514
Japan.
HCV-RNAASSAYFOR INTERFERONTHERAPYIN PATIENTSWITHNON-A,NON-B HEPATITIS Materials and Methods
Materials Among 25 chronic NANB hepatitis patients referred to our Liver Unit for interferon-~ therapy between 1985 and 1990, 19 were available for this study (Table 1). There were 14 men and 4 women, with a mean age of 42.9-+ 8.9 years. All had elevated sALT levels (> 35 IU) for at least 6 months and histological findings compatible with chronic hepatitis: chronic persistent hepatitis in 4, chronic active hepatitis 2A(16) in 9, and chronic active hepatitis 2B (16) in 4. Infections with other hepatotropic viruses (hepatitis A, hepatitis B, Epstein-Barr virus, and cytomegalovirus) were excluded by serological testing, and there was no evidence of drug addiction, alcohol abuse or autoimmune processes. The 19 patients received interferon-or therapy for 4-16 (9.9 + 4.5) weeks. The total dose of interferon-or ranged from 168.106 to 396"106 (212.2_+73.4.106) IU. The interferon dose and duration of therapy was decided randomly according to the protocol of a multi-institutional study group for the treatment of chronic NANB hepatitis in Japan. Serum was obtained at least 3 times during the clinical course, just before therapy, immediately after therapy withdrawal and 6 months later. The serum was separated and stored at - 2 0 ° C until the assay was performed. Patients were followed up by serial sALT determinations for at least 12 months after the end of the therapy (mean 21.9_+I0.1 months). Fifteen patients underwent liver biopsy 6-12 months after therapy for comparison with specimens obtained prior to therapy. Methods Anti-HCV assay. Antibody to C100-3 was examined by an enzyme-linked immunosorbent assay (ELISA) using a commercially available kit (Ortho-HCV ELISA Kit, Ortho Diagnostic System, Tokyo, Japan) (7). A HCV second-generation test (Ortho Diagnostic System, Tokyo, Japan) (18) was carried out in patients who were negative for anti-C100-3. Detection of HCV-RNA by nested PCR. RNA was extracted from 100 pl of sera by the acid-guanidiumphenol method (8). After ethanol precipitation, the product was dried and dissolved in 10/~1 of buffer solution containing 100 ng anti-sense primer deduced from the 5'-non-coding region of the HCV genome, 50 mM TrisHCI (pH 8.3), 75 mM KC1, 3 mM MgC12, 10 mM dithiothreitol and 10 mM each of dATP, dCTP, dGTP and dTTP. The reaction mixture was heated to 70 °C for 5 min, and after immediate cooling 10 units of Moloney Murine Leukemia Virus reverse, transcriptase (Bethesda
139
Research Laboratories, Bethesda, MD, U.S.A.) and 2.5 units of human placental ribonuclease inhibitor (Sigma, St. Louis, MO, U.S.A.) were added. The mixture was incubated at 37 °C for 60 min, and then the transcripted cDNA was heated at 95 °C for 5 min. The amplification of the cDNA was carried out in 25 #1 of reaction solution containing 10mM Tris-HC1 (pH8.3), 50mM KCI, 1.5 mM MgCla, 0.01% gelatine hydrolysate, 10 mM each of dATP, dCTP, dGTP and dTTP, 125 ng of primers (sense and anti-sense) and 1.25 units of Thermus aquaticus DNA polymerase (Ampli Taq polymerase, Perkin-Elmer Cetus, Connecticut, U.S.A.). The sequences of the primers for the first PCR were 5'-ACTCCACCATAGATCACTCC-3' (sense) and 5'-AACACTACTCGGCTAGCAGT-3' (anti-sense). Amplification cycles, consisting of heating at 92 °C for 1 min, annealing at 45 °C for 2 min and DNA synthesis at 74°C for 3 min, were performed 35 times using a DNA Thermal Cycler (Perkin-Elmer Cetus). One-tenth of the volume of the first PCR product was provided for the second PCR. The sequences of the primers for the second PCR were 5'-TTCACGCAGAAAGCGTCTAG-3' (sense) and 5'-GTTTATCCAAGAAAGGACCC-3' (anti-sense). The final concentration of the reaction solution and the thermal conditions were the same as described above. After the second PCR, 20/A of sample was electrophoresed through a 3% agarose gel (Nu Sieve GTG agarose, FMC Bio Products, Maine, U.S.A.) and visualized by ethidium bromide staining. Quantitative analysis of HC V-RNA by single PCR and dot blot hybridization. Quantitative analysis was performed on sera positive by the nested PCR. RNA was extracted from 500/al of serum and it was amplified by 30 cycles of single PCR. This PCR was carried out in 100/~1 of the above reaction solution, but it contained 1/~g of primers (sense and anti-sense primers which were the same as the primers for the second PCR described above), and 5 units of Ampli Taq polymerase. The PCR product .was denatured with 0.1 M NaOH, and then hybridized with a radiolabelled, synthesized oligonucleotide probe internal to the amplified sequence. Blot hybridization and washing were performed according to the method described by Maniatis et al. (17) as follows: Blots were prehybridized at 42°C for 6 h in 5 x SSC (1 x SSC=0.15 M NaC1, 0.015 M sodium citrate), 20% formamide, 100 #g/ml denatured salmon sperm DNA and 0.1% (w/v) each of Ficoll, polyvinylpyrrolidone, bovine serum albumin and sodium dodecyl sulfate, and then hybridization was performed overnight at 42 °C in the above solution containing 32p-labelled HCV cDNA (1.10v cpm per ml). The sequence of the probe was 5'-
140
Y. KOBAYASHIet al.
TGGAGGCTGCACGACACTCATACTAACGCCAT3'.
The blots were washed at room temperature twice in 2 x SSC, 0.5% (w/v) sodium dodecyl sulfate for 15 min and then 2 x SSC, 0.1% (w/v) sodium dodecyl sulfate at 55°C for 2 h. Autoradiography was carried out at - 8 0 °C using Kodak X-OMAT-AR film. A part of the HCV-cDNA (5'-non-coding region; nt 46-190(5)) was subcloned and purified. This HCV-cDNA was quantitated by measuring OD26o with a spectrophotometer (Hitachi, Tokyo, Japan) and a 10
Journal of Hepatology, 1992; 16:138-144 ©1992 ElsevierScientificPublishers Ireland Ltd. All rights reserved. 0168-8278/92/$05.00
HEPAT01132
Detection of hepatitis C virus RNA by nested polymerase chain reaction in sera of patients with chronic non-A, non-B hepatitis treated with interferon Yoshinao Kobayashi, Shozo Watanabe, Masayoshi Konishi, Masato Yokoi, Jiro Ikoma, Ryuichi Kakehashi, Yuji Kojima and Shiro Suzuki Third Department of Internal Medicine, Mie University School of Medicine, Mie, Japan
(Received31 May 1991)
To evaluate the effect of interferon-~ treatment on the levels of serum aminotransferase (sALT) and of hepatitis C virus (HCV)-RNA, we studied 19 patients with chronic non-A, non-B (NANB) hepatitis. Before therapy, 14 patients were positive by nested polymerase chain reaction (PCR) with primers deduced from the 5'-non-coding region of the HCV genome. Serum HCV-RNA had disappeared in 12 (85.7%) of them by the end of therapy, but then reappeared 6 months later in 4 of these 12 patients. A marked improvement in sALT was seen in 5 of the 8 patients with sustained HCV-RNA disappearance, but not in the 4 patients with only transient HCV-RNA negativity. Pre-treatment levels of hepatitis C viremia, analyzed by single PCR and dot blot hybridization, ranged from 2.103 to 2"108 copies/ml, and were below 2.105 copies/ml in patients with a complete response to interferon therapy. These results suggest that this HCV-RNA assay, combined with sALT testing, may be useful for estimation of the long-term efficacy of interferon therapy in hepatitis C. K e y words: Non-A, non-B hepatitis; Hepatitis C; HCV-RNA; Interferon; Polymerase chain reaction
Approximately 95% of post-transfusion hepatitis is of the non-A, non-B type throughout the world, as is also more than 50% of the sporadic cases. In 1989, Choo and colleagues cloned cDNA from the plasma of a chimpanzee with chronic NANB hepatitis, and identified an agent which was termed 'hepatitis C virus' (HCV) (1). The identified HCV genome is approximately 10 kb in size and nearly three-quarters of it towards the 3'terminal has been sequenced (European Patent Application No. 88310922.5). HCV isolated from Japanese patients with chronic hepatitis has a significantly different nucleotide sequence (up to 33%) from the prototype HCV genome (2-4). In 1990, Okamoto and colleagues determined that the 5'-terminal sequence of the HCV genome contained a long open reading frame that coded for the viral polyprotein, and was preceded by an untranslated region of at least 324 nucleotides (5).
The nucleotide sequence of this 5'-non-coding region is highly conserved among different HCV strains. Since sequence mismatching between primers and viral template-nucleic acid is a major cause of the failure to amplify the HCV genome by polymerase chain reaction (PCR1 (6), primers deducted from the 5'-non-coding region are more suitable for the detection of HCV-RNA by PCR. Interferon has been used as an antiviral drug for the treatment of chronic NANB hepatitis (14,15), and shown to produce beneficial effects on serum aminotransferase (sALT) levels. In this paper, we report detection of the HCV-RNA-amplified 5'-non-coding region by PCR in sera of patients with chronic NANB hepatitis in ordei to confirm the high prevalence of HCV-RNA in chronic NANB hepatitis and to assess the usefulness of this serum marker for monitoring the long-term efficacy oJ interferon therapy.
Correspondence to: Y. Kobayashi,Third Department of Internal Medicine,Mie UniversitySchool of Medicine,2-174 Edobashi, Tsu, Mie 514
Japan.
HCV-RNAASSAYFOR INTERFERONTHERAPYIN PATIENTSWITHNON-A,NON-B HEPATITIS Materials and Methods
Materials Among 25 chronic NANB hepatitis patients referred to our Liver Unit for interferon-~ therapy between 1985 and 1990, 19 were available for this study (Table 1). There were 14 men and 4 women, with a mean age of 42.9-+ 8.9 years. All had elevated sALT levels (> 35 IU) for at least 6 months and histological findings compatible with chronic hepatitis: chronic persistent hepatitis in 4, chronic active hepatitis 2A(16) in 9, and chronic active hepatitis 2B (16) in 4. Infections with other hepatotropic viruses (hepatitis A, hepatitis B, Epstein-Barr virus, and cytomegalovirus) were excluded by serological testing, and there was no evidence of drug addiction, alcohol abuse or autoimmune processes. The 19 patients received interferon-or therapy for 4-16 (9.9 + 4.5) weeks. The total dose of interferon-or ranged from 168.106 to 396"106 (212.2_+73.4.106) IU. The interferon dose and duration of therapy was decided randomly according to the protocol of a multi-institutional study group for the treatment of chronic NANB hepatitis in Japan. Serum was obtained at least 3 times during the clinical course, just before therapy, immediately after therapy withdrawal and 6 months later. The serum was separated and stored at - 2 0 ° C until the assay was performed. Patients were followed up by serial sALT determinations for at least 12 months after the end of the therapy (mean 21.9_+I0.1 months). Fifteen patients underwent liver biopsy 6-12 months after therapy for comparison with specimens obtained prior to therapy. Methods Anti-HCV assay. Antibody to C100-3 was examined by an enzyme-linked immunosorbent assay (ELISA) using a commercially available kit (Ortho-HCV ELISA Kit, Ortho Diagnostic System, Tokyo, Japan) (7). A HCV second-generation test (Ortho Diagnostic System, Tokyo, Japan) (18) was carried out in patients who were negative for anti-C100-3. Detection of HCV-RNA by nested PCR. RNA was extracted from 100 pl of sera by the acid-guanidiumphenol method (8). After ethanol precipitation, the product was dried and dissolved in 10/~1 of buffer solution containing 100 ng anti-sense primer deduced from the 5'-non-coding region of the HCV genome, 50 mM TrisHCI (pH 8.3), 75 mM KC1, 3 mM MgC12, 10 mM dithiothreitol and 10 mM each of dATP, dCTP, dGTP and dTTP. The reaction mixture was heated to 70 °C for 5 min, and after immediate cooling 10 units of Moloney Murine Leukemia Virus reverse, transcriptase (Bethesda
139
Research Laboratories, Bethesda, MD, U.S.A.) and 2.5 units of human placental ribonuclease inhibitor (Sigma, St. Louis, MO, U.S.A.) were added. The mixture was incubated at 37 °C for 60 min, and then the transcripted cDNA was heated at 95 °C for 5 min. The amplification of the cDNA was carried out in 25 #1 of reaction solution containing 10mM Tris-HC1 (pH8.3), 50mM KCI, 1.5 mM MgCla, 0.01% gelatine hydrolysate, 10 mM each of dATP, dCTP, dGTP and dTTP, 125 ng of primers (sense and anti-sense) and 1.25 units of Thermus aquaticus DNA polymerase (Ampli Taq polymerase, Perkin-Elmer Cetus, Connecticut, U.S.A.). The sequences of the primers for the first PCR were 5'-ACTCCACCATAGATCACTCC-3' (sense) and 5'-AACACTACTCGGCTAGCAGT-3' (anti-sense). Amplification cycles, consisting of heating at 92 °C for 1 min, annealing at 45 °C for 2 min and DNA synthesis at 74°C for 3 min, were performed 35 times using a DNA Thermal Cycler (Perkin-Elmer Cetus). One-tenth of the volume of the first PCR product was provided for the second PCR. The sequences of the primers for the second PCR were 5'-TTCACGCAGAAAGCGTCTAG-3' (sense) and 5'-GTTTATCCAAGAAAGGACCC-3' (anti-sense). The final concentration of the reaction solution and the thermal conditions were the same as described above. After the second PCR, 20/A of sample was electrophoresed through a 3% agarose gel (Nu Sieve GTG agarose, FMC Bio Products, Maine, U.S.A.) and visualized by ethidium bromide staining. Quantitative analysis of HC V-RNA by single PCR and dot blot hybridization. Quantitative analysis was performed on sera positive by the nested PCR. RNA was extracted from 500/al of serum and it was amplified by 30 cycles of single PCR. This PCR was carried out in 100/~1 of the above reaction solution, but it contained 1/~g of primers (sense and anti-sense primers which were the same as the primers for the second PCR described above), and 5 units of Ampli Taq polymerase. The PCR product .was denatured with 0.1 M NaOH, and then hybridized with a radiolabelled, synthesized oligonucleotide probe internal to the amplified sequence. Blot hybridization and washing were performed according to the method described by Maniatis et al. (17) as follows: Blots were prehybridized at 42°C for 6 h in 5 x SSC (1 x SSC=0.15 M NaC1, 0.015 M sodium citrate), 20% formamide, 100 #g/ml denatured salmon sperm DNA and 0.1% (w/v) each of Ficoll, polyvinylpyrrolidone, bovine serum albumin and sodium dodecyl sulfate, and then hybridization was performed overnight at 42 °C in the above solution containing 32p-labelled HCV cDNA (1.10v cpm per ml). The sequence of the probe was 5'-
140
Y. KOBAYASHIet al.
TGGAGGCTGCACGACACTCATACTAACGCCAT3'.
The blots were washed at room temperature twice in 2 x SSC, 0.5% (w/v) sodium dodecyl sulfate for 15 min and then 2 x SSC, 0.1% (w/v) sodium dodecyl sulfate at 55°C for 2 h. Autoradiography was carried out at - 8 0 °C using Kodak X-OMAT-AR film. A part of the HCV-cDNA (5'-non-coding region; nt 46-190(5)) was subcloned and purified. This HCV-cDNA was quantitated by measuring OD26o with a spectrophotometer (Hitachi, Tokyo, Japan) and a 10
