Scand J Infect Dis 24: 265-273, 1992
Detection of Enteroviruses in Faeces by Polymerase Chain Reaction ALMAZ ABEBE'.', B O JOHANSSON', JANIS ABENS' and ORJAN
STRANNEGARDI
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
From the Departments of 'Virology, the Central Microbiological Laboratory of Stockholm Coirnty Council and 'Infectious Diseases, Roslugstull Hospital, Karolinska Institute. Stoi kholm, Sweden
A polymerase chain reaction (PCR) technique for the detection of human enteroviruses in stool specimens was developed. The test was based on the synthesis of cDNA, followed by PCR and slot blot hybridization. The primers used were selected from a highly conserved sequence in the 5'non-coding region of the enteroviral genome. By this method 27 different enterovirus serotypes (15 echo, 6 coxsackie A, 4 coxsackie B, poliovirus type 2 and enterovirus 71) from 89 patients could be detected. Using positive virus culture as reference, the sensitivity of PCR was 69% after 30 cycles of amplification, 91% using 30 10 cycles and 100O/0 following 2 rounds of amplification with ensuing hybridization. None of 23 stool samples from healthy individuals or patients with meningitis of proven non-enteroviral etiology were positive by the PCR. By contrast, 13/26 culture-negative, randomly chosen stool samples from patients with suspected enteroviral disease were positive by the test. These findings demonstrate a high sensitivity and an apparently high specificity of PCR for detection of enteroviruses in stool samples. Therefore, the methodology may be useful in the laboratory diagnosis of enterovirus infections.
+
0. Strannegdrd, MD, PhD, Department of Virology, Central Microbiological Laboratory, P.O. Box 70470, S-10726 Stockholm, Sweden
INTRODUCTION Human enteroviruses, which are single-stranded R N A viruses found in the family picornaviridac comprise more than 70 different serotypes. They may cause several clinical syndromes. e.g. meningitis, perimyocarditis or paralysis. and have also been suggested to play a pathogenic role in diabetes mellitus and cardiomyopathy ( 1 4 ) . Commonly used diagnostic tests for enterovirus infections are based on virus isolation in cell culture, followed by identification of serotypes with neutralizing antisera, o r on serological tests. These methods are time-consuming and laborious and frequently have a rather low sensitivity ( 5 ) . Sequencing of several enterovirus serotypes (6-8) and the advent of polymerase chain reaction (PCR) techniques (9) have recently made possible the detection of these pathogens in a rapid and sensitive fashion. Several laboratories have found that PCR. employing broadly reactive primers, can be utilized for the detection of most enterovirus serotypes (10-14). Recently, it has been reported that enteroviral meningitis can be successfully diagnosed using PCR amplification of enteroviral nucleic acid present in cerebrospinal fluid (13. 14). In the present study. we have developed and applied PCR for the detection of enteroviruses in stool specimens. MATERIALS and METHODS Strtiiples A total of 138 stool specimens were selected for the study. All specimens had been analysed by viru.; culture during a .?-year period (1988-91) and had been kept frozen at -70°C for varying periods of time. 89 samples that were positive by virus culture using G M K , RD, and HeLa cells were selected. The virus
266 A . Ahebe et al. A. 5’ P I / - ,
Scand J Infect Dis 24
-, - , -
1Kb
1 -
3Kb
3-
. __
> -
5Kb
AAA3’
7Kb
B. 5’
3’ 445
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
C.
470
510
538
544
564
445 470 5 ‘TCCTCCGGCCCCTGAATGCGGCTAAT3’ 564 544 S’GAAACACGGACACCCAAAGTA3’ 510 538 S’GTGTCGTAACGGGCAACTCTGCAGCGGAA3’
Fig. I . A: Schematic representation of 7.5 Kb single stranded poly A tailed RNA genome of the enteroviruses and thc location of the S e n d of the oligonieric primer pair (region in bracket). Kb = kilobase B: Enlargemcnt of the bracketed area shows the upstream position 445470, downstream position 544-564 of nuclcotide primers and probe position 510-538. C: Specific sequences of primers and probe.
isolates were typcd by a complement fixation procedure (5) and found t o belong t o 27 different identified enterovirus serotypes. Three of the culture-positive samples could not be typed and 49 samplcs were negative by culture. Out of the culture-negative specimens 9 were from patients with aseptic meningitis due to other etiological agents (Borrelia burgdorferi, herpes simplex virus type 2, varicella zoster virus. and tick-borne encephalitis virus), and 14 samples from healthy adults. The remaining 26 samples were randomly chosen among specimens that had been sent to the laboratory for viral culture because of suspicion of enterovirus infection (3 samples from children with encephalitis of unknown origin, 18 from patients, mainly children, with diarrhoea, and 5 from children with newly diagnosed diabetes nicllitus type 1).
Viral R NA extraction Stool specimens were suspended in Parker medium containing 10% fetal calf serum (about 10% wlv). One ml of the suspension was treated with 0.5 ml lysis buffer (50 mM Tris, 0.5% SDS, 10 mM EDTA, SO mM NaCl, p H 7.5). and 30 pl proteinase K (10 mg/ml). The samples were then vortexed for 30 sec and incubated at 56°C for 1 h. To each sample 0.5 rnl phenol-chloroform (1:l) was added and the mixtures were then vortexed for 30 sec, followed by centrifugation for 30 min at 14 000 rpm in an Eppendorf centrifuge. The aqueous phase was collected and 1 ml of 95% ethanol added to precipitate the RNA. Samples were centrifuged for 10 min and the supernatant was discarded. The pellets were washed with 70% ethanol and centrifuged again for 10 min. The supernatant was discarded, the pellets dried under vacuum, and finally dissolved in 10 pl sterile distilled water. Primers and probes Although the complete nucleotide sequences of all enteroviruses have not yet been determined, certain sequences in the S’non-coding region have been found to be highly conserved in all enteroviruses sequenced to date. To obtain group-specific reactivity. the primers used in this study were derived from the S’non-coding region of the enterovirus genome by use of computer assisted analysis. Two regions of 21 and 26 bases showing complete sequence conservation were identified. The upstream primer BJent I (S’TCCTCCGGCCCCTGAATGCGGCTAAT3‘)and the downstream primer BJent 2 (S’GAAACACGGACACCCAAAGTA 3’) were chosen from these regions (Fig. 1 ) . Amplification of enteroviral cDNA with these primers resulted in the synthesis of a 120-bp fragment. The probe specific for the amplified product (BJcoxpro) was positioned at nucleotide number 511r538 in thc genome of coxsackie B3 (5‘GTGTCGTAACGGGCAACTCTGCAGCAGCGGAA3’)and
Scand J Infect Di\ 2 1
Detection of eiiteroviriises bv PCR 267
also had specific homology with the coxsackie B I , H-l and coxsackie A9 genome (data obtained from Gcnc Bank).
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
( , D N A .syrrfhc,.\is Prioi- to PCR. cDNA synthesis was carried out using 5 p1 o f sample nucleic acid extract. The sample was added t o a reaction mixture containing 20 1.11 2x I-everse transcription buffer (250 m M Tris HCI. pH 8.3. I5 m M MgCI?. 350 mM KCI. 50 mM dithiothrcitol). 1 ~ r RNasin l (Promega. 40 000 Uiml), 6 p1 of 10 mM ATP. CTP GTP. T T P nucleotide mixture. 1 p1 clownstream primer (10 pmolesikl) and 0.5 pI of reverse transcriptase (AMV reverse transcriptase. I X 000 U h l Pharmacia LKB Biotechnology , Uppsala. Swcdcn). The mixture was then incubated for 90 min at 42°C.
PCR To 5 p l of the reverse transcription mixtures. 5 111 of 1Ox PCR buffer (500 mM KCI. 200 mM Tris HCI, pH S.4. 25 mM MgCI,, 1 inginil of nucleasc-free bovine serum albumin). 8 p1 o f diluted mix of deoxynucleotidcs (0.2 mM cach dATP. dGTP, dCTP. dTTP, Pharmacia LKB Biotechnology), 4 ltl of 15 mM MgCI,, 4 pl each of the primers (10 pmolesiyl). 0.2 ~ r of l 5 Uipl of Thermus aquaticus (Tq.) DNA polymerase (Perkin Elmer Cetus, Norwalk, Conn.. USA), and 19.8 pi of distilled H,O to make a total volume of 50 pl was added. Distilled water samples were also included as negative controls. Amplification was initiated hy one cycle of 5 min denaturation, 30 sec annealing, and 1 rnin extension. A further 28 cycles o f 30 sec denaturation (Y5"C). 30 scc annealing ( S 5 T ) and 1 min primer extension (72°C) steps wcre followed by a final cycle of 30 sec denaturation. 30 sec annealing and 5 niin extension. Analysis of the amplified product was performed by electrophoresis (3% agarose, NuSieve. FMC. USA). A second round of 10 PCR cycles was pcrforrned to increasc [he sensitivity by adding 1 11.1of thc first PCR product (diluted 1: 10 in distilled water) to B fresh PCR reagcnt mixture. A gel electrophoresis hand o f 120 base pairs was considered indicative of enteroviral KNA. A prototype strain of coxaackicvirus type €35 equivalent to 2.9 and 6.9 TCID,,, was included as weakly positivc and strongly positive control samples in each run and every second or third sample was a negative control. Whenever signs of contamination in any ncgative control sample wcre observed the rewlts of the whole run were disregarded. Slot-hlot hybridization
30 PIof amplified DNA was denatured at 95°C for 5 min and immediately transferred to ice. An equal volume of ice cold 20x SSC (0.3 M of citrate. 3M of sodium chloride in sterile water. pH7) was added to tht. tube. then the mixture was transferred to a Hybond N membrane (Amersham, Buckinghamshire. England). presoakcd in 1Ox SSC for 15 min using a Milli-Blot microfiltration apparatus (Millipore cooperation. Bedford. M A . USA). The membrane was irradiated with UV light for 5 rnin and prchybridized at 42°C in a solution containing 10% deionized formamide, Sx SSC. 0.05% sodium phosphate. 5x Denhardt's solution (0.02% Ficoll, 0.02% polyvinylpyroiidon, 0.02% bovine serum albumin, 0.02% NaN,), 0.5% sodium dodecyl sulfate (SDS). and 0.25 mgiml of sheared and denatured hei-ring sperm D N A , as described previously ( I S ) . The DNA probe was end labelled using T, polynucleotide kinase and P3' labeled ATP and was purified by the spun-column procedure of Maniatis et al. (15). Labelled probe was added to tubes containing 10% formamide. Sx SSC, 0.02 M sodium phosphate. Sx Denhardt's solution, 1'6 SDS. and 0.1 pg of denatured herring sperm D N A . The membrane was hybridized overnight at 42°C and then washed 3 times for 15 min at 52°C in lx SSC containing 0.1 70SDS. Then it was wrapped in saran wrap and exposed to X-ray film (Hyper film beta MAX, Amersham) at -70°C for 24 h .
RESULTS Sensitivity and specificity of the PCR methodology The PCR method was developed after a series of experiments aimed at evaluating the specificity and sensitivity of the method. These cxperiments were performed on the supernatants of virus-infected cell cultures. A total of 30 different enterovirus serotypes were tested and in all cases found to be positive by PCR (Holmstrom et al.; unpublished data). Parallel titrations of viral infectivity and PCR reactivity using the highly cytopathogenic coxsackievirus B5 and echovirus 11 showed that the PCR was able to detect about 100
268 A . Abebe el al.
Scand J Infect Dis 24
Table I. Results of PCR on stool specimens in relation to results obtained by virus culture Virus isolated
No. of
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
specimens
Echo 2 Echo 3 Echo 4 Echo 6 Echo 7 Echo 9 Echo 11 Echo 14 Echo 16 Echo 18 Echo 21 Echo 22 Echo 30 Echo 31 Cox.A2 Cox.A3 Cox.A4
Cox.A6 Cox.A9 C0x.A 16
Cox.B2 Cox.B3 Cox.B4 Cox.BS Polio 2 Ent. 71 NI"
Total no. of samples Enterovirus typcs
Pos. after 1st set of cycles
Additional pos. after 2nd set of cycles
2 2 1 8
2 1
0 1
1 6
0 2
1
1 0 1
1 6
0 1 2 2 1 0 0 0
7
6
1 1 1 3 2 9 3 1
0
6
5 4
2 3 3 1 1
5 11
1 1 3 89 27
1 1 2 2 9 2 1
8 0
1 2
61 21
1
0 1 1 3 1 1 0 0 1 0 0 1 0 0 1 3 0 0 1 20 5
Additional pos. after hybridization 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 0
0 0 0 0 0 1 0 0 1 0 0
8 1
aNot identifiable virus isolated in cell culture
TCID,, of the virus after 30 cycles of amplification. The sensitivity was increased about 10-fold after an additional 10 cycles of amplification and a further 10-100-fold after the hybridization step. Thus, PCR utilizing 30+10 cycles had a sensitivity which was slightly lower than that of virus isolation and with the hybridization step included the sensitivity was equal to or exceeded that obtained by virus culture. In cases where poorly cytopathogenic coxsackie A viruses were tested, the sensitivity of the PCR was much higher than that of virus culture, irrespective of the number of amplification cycles employed. The specificity of the PCR was evaluated using R N A extracts of supernatants from cells infected with either of 19 different human viruses, including rhinovirus type 1B. 7, and 11. The PCR did not give any positive signals with any of these viruses except for the 3 rhinoviruses which all gave rise to positive reactions (Holmstrom et al.; unpublished data).
Detection of enteroviruses by PCR Positive PCR rcsults were defined as occurrence of bands in the agarose gels of 120 bases in length. Out of the 89 tested culture positive stool specimens, 61 were positive after the first round of 30 PCR cycles and a further 20 samples were positive after an additional 10 PCR cycles (Table I). Eight culture-positive samples (1 coxsackie B3, 1 echo 9, 2 echo 16, 3 echo
Detection of enteroviruses by PCR 269
Scand I Infect Dis 24
Table 11. Results of PCR o n culture-negative stool surnples ~~
~
Diagnosis
No. of
N o . neg.
Positive PCR after
samples
Newly diagnoscd type I diabetes mellitus
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
Diarrhoea or encephalitis with unknown etiology Meningoencephalitis
1st set of cycles
2nd set of cycles
Slot blot hybridization
5
1
2
0
2
21
12
3
0
6
9
9
0
0
0
with known
non-enteroviral etiology" Healthy individuals
14
14
0
0
0
Total
49
36
5
0
8
"Of the 9 cases of meningoencephalitis, 1 was associated with Borrelia burgdorferi, 3 with varicellazoster. 2 with herpes simplex type 2, and 3 with tick-borne encephalitis virus
22, and 1 polio type 2) were negative throughout the 2 rounds of amplification (30 or 30 + 10 cycles).The overall sensitivity of PCR. not including a probing step (see below) was thus 69% (61/89 samples) following the first set of cycles and 91% (81/89 samples) using the additional set of amplification cycles. Using the 2 sets of amplification cycles enterovirus RNA could b e successfully demonstrated in stool specimens containing 26 of the 27 different serotypes tested. It was noteworthy that none of the 6 echo 22 virus-containing specimens were positive after the first round of 30 PCR cycles although 3 of them tested positive after the second round of cycles. 5/49 culture-negative samples were positive after the first 30 PCR cycles and no additional positive results were encountered after 10 additional cycles. Of the 5 PCR-positive but culture-negative cases, 3 had a clinical diagnosis of diarrhoea or encephalitis with unknown etiology and 2 had newly diagnosed type 1 diabetes (Table 11). The specimens from all these 5 cases had been collected between August and February. All samples collected from normal individuals were negative.
Identification of enteroviriu serotypes by hy6ridization of PCR products In order to check the specificity of the PCR, and in an attempt to increase the sensitivity of the reaction, a hybridization assay was included following amplification. Results of an 10 experiment utilizing products obtained after the 2 sets of amplification cycles (30 cycles) are shown in Fig. 2. This figure shows that all samples positive by virus culture gave clear signals in the hybridization assay, even those which did not give rise to visible bands after agarose gel electrophoresis. Identical results were obtained in other experiments on remaining specimens (Table I). Thus, the overall sensitivity of the method involving 2 sets of PCR cycles followed by hybridization was 100% (89/89) in relation to virus culture. Also shown in Fig. 2 are the positive results of 5 culture-negative, but PCR-positive specimens. In all, 8/44 culture-negative and agarose gel electrophoresis-negative specimens were positive by hybridization (Table 11). Two of these were obtained from patients with newly diagnosed type 1 diabetes mellitus and 6 were from patients with diarrhoea or
+
.
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
270 A . Abebe et al.
S c a d J Infect D n 23
Fig. 2. Analysis of PCR amplification products by slot blot hybridization. Stool samples positive by virus culture for various serotypes of echovirus (EV), coxsackievirus (CV) or poliovirus (PV) were analysed. Additionally, culture-negative samples (NEG), or samples from patients with serological evidence of herpes simplex type 2 (HSV2), tick-borne encephalitis virus (TBEV), varicella-zoster virus (VZV) and Borrelia burgdorferi (Borr.) infection were analysed. A1-6, EV14, EV22, EV16, EV31, N1*, CVA4 B1-6. EV22, NEG"', EV30. NEG*", EV3, EVl8 C1-6, PV2, CVA16, NEG**. CVB4, EV21, EV22 D1-6, EVl1. EV22, EV16, CVB3, EV7, CVBS El-6, EV9, NEG**, NEG*", EV22, EV22, CVBS F1-6. EV6. HSV2, H 2 0 . VZV, HSV2. NEG** G1-6, NEG**, TBEV, VZV, BORR., HSV2, BORR. HI-6, HSV2, -, HZO, HZO, NI* = isolated virus not typable; NEG** = culture negative samples.
-.
encephalitis with unknown etiology. All culture-negative specimens that were positive by hybridization had been collected during the autumn. DISCUSSION
The laboratory diagnosis of enterovirus infection presents several problems, in particular since this group of viruses comprises more than 70 different serotypes. Conventional techniques used include virus isolation, which is time-consuming and laborious, and serological methods using group- or type-specific antigens. Although the latter techniques recently have been considerably improved, and may be designed to detect IgM antibodies, they are often too insensitive to allow an accurate diagnosis (1, 16, 17). Because enteroviruses have been shown to share a great deal of R N A sequence homology, particularly in the S'non-coding region of the genome, molecular hybridization techniques have been devised which allow the detection of several different enteroviruses (18-21). Generally, however, hybridization tests have been found to suffer from a certain
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
Scand J lnfect Dis 24
Detection of enteroviriises by PCR 271
lack of sensitivity. Thus, for instance, Petitjean et al. (22) found a sensitivity of only 33% when clinical stool samples were tested by dot blot hybridization using radiolabelled riboprobes, The advent of the PCR technique (9) has made it possible to design much more sensitive assays for enteroviruses. A recent report has described that PCR can detect enteroviruses in about 100-fold lower concentrations than conventional hybridization tests (10). With the methodology used by us we found that the PCR generally was able to detect about 100 TCID,,, of the virus after 30 cycles of amplification. The sensitivity was increased about 10-fold after an additional 10 cycles of amplification and a further 10-100-fold after addition of a hybridization step. This high sensitivity obtained on cultured viruses suggested that the PCR could be applied for the detection of enteroviruses in clinical specimens. I n accordance with the above suggestion the application of PCR for the detection of enteroviral R N A in stool samples resulted in a very high detection rate. Positive PCR signals were obtained with all 89 stool specimens obtained from patients with culture-proven enterovirus infections, giving a sensitivity of 100%. This sensitivity was only obtained, however, using the 3-step PCR methodology. In comparison, using a single set of 30 cycles, followed by agarose gel electrophoresis, a sensitivity of 69% was obtained. Even the latter figure compares very favourably, however. with the sensitivity obtained with conventional hybridization techniques (22). In the present study, none of 23 culture-negative stool specimens from healthy individuals or patients with meningoencephalitis of non-enteroviral origin tested positive by PCR, giving a specificity of 100°/o. By contrast, 13/26 culture-negative specimens from patients with suspected enteroviral disease were positive by PCR. This finding would presumably reflcct a superior sensitivity of PCR for the detection of, in particular, poorly cytopathogenic enteroviruses. Particularly interesting was the finding of PCR positivity in 4 of 5 patients with newly diagnosed insulin-dependent diabetes mellitus. A probable role of enteroviruses in this disease has been suggested (4). It should be noted, however, that these specimens had all been obtained during the enterovirus season, and there might therefore merely be a chance association between the finding of enteroviral R N A and the diabetic disease. Nevertheless, PCR would be assumed to be an ideal tool for determination of a possible association between e.g. diabetes mellitus or cardiomyopathy and chronic enteroviral infection. The reason for this would be its high sensitivity and also its independence of interference by antibodies which may confound results obtained by virus culture. In the present study we were able to successfully amplify 27 different enterovirus serotypes. With PCR methodology utilizing primers in the noncoding region of the enteroviral genome we and others have demonstrated common PCR reactivity of the majority of the cntcrovirus serotypes (lCL12). This would indicate that the S'non-coding region in which the primers were located is highly conserved. In fact, all enteroviruses sequenced to date possess the particular sequence we have studied. The sequence, however, does not seem to be unique to the enteroviruses, but is apparently shared by rhinoviruses as shown in this and in other studies (12; data obtained from Gene Bank). From the diagnostic point of view, a PCR cross-reactivity with rhinoviruses should present little problems since the occurrence of these viruses is usually restricted to the upper respiratory tract. We have, however, devised a simple test based on restriction enzyme (Ava 11) digestion of the amplified product to discriminate rhinoviruses from enteroviruses (unpublished results). Echovirus 22 was found to be poorly reactive by PCR, but could nervetheless be identified in all 6 cases studied using the 3 step procedure. The poor reactivity of this serotype probably reflccts the fact that echovirus 22 is an atypical enterovirus which in previous studies could not be detected by PCR (11, 12,23). However, our results and those of Rotbart (10) suggest that the genomic RNA of echovirus 22 has at least partial homology with other enteroviruses IX
bcand J Infect DIS
272 A . Abebe et al.
Scand J Infect Dis 24
in the S'non-coding region and therefore may be detected by highly sensitive PCR procedures using general primers. In summary, the present results show that PCR can be used as a very efficient tool for the demonstration of enteroviral RNA in stool samples. Our further work aims at evaluating the usefulness of PCR for the detection of enteroviruses in other types of clinical specimens and at using PCR for the determination of possible associations between enteroviruses and a variety of chronic diseases.
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
ACKNOWLEDGEMENTS The first author was supported by a WHO fellowship grant during this study. Additional grants were obtained from the Karolinska Institue, Stockholm, and from the Swedish Medical Research Council. We thank Dr Martin Glimgker for kindly providing us with samples from patients with meningitis of non-enteroviral etiology. The expert technical assistance of Ms Mina Kalantari, Ms h a Staland, Ms Anna Karin Bergman. Ms Kicki Englund and Ms Irene Hjalmardotter is gratefully acknowledged.
REFERENCES 1. Melnick JL. Enteroviruses: Poliovirus, coxsackie-viruses, echoviruses and newer enteroviruses. In: Fields BN, Knipe DM, eds. Fields virology, 2"d ed. New York: Raven Press, 549-605, 1990. 2. Jarvis WR, Tucker G , Echovirus type 7 meningitis in young children. Am J Dis Child 135: 1009-1012, 1981. 3. Woodruff JF. Viral myocarditis. A review. Am J Pathol 101: 427483, 1980. 4. Jenson AB, Rosenberg H. Multiple viruses in diabetes mellitus. Prog Med Virol29: 197-217,1984. 5 . Grandien M, Forsgren M, Ehrnst A. Enteroviruses and reoviruses. In: Schmidt NJ, Emmons RW, eds. Diagnostic procedures for viral, rickettsia1 and chlamydia1 infection. Washington DC: American Public Health Association, 513-578. 1989. 6. Lizuka N, Kuge S, Nomoto A. Complete nucleotide sequence of the genome of coxsackievirus B1. Virology 156: 6473, 1987. 7. Lindberg AM, Stilhandske POK, Pettersson U . Genome of coxsackievirus B3. Virology 156: 50-63, 1987. 8. Jenkins 0. Booth JD, Minor PD, Almond JW. The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the picornaviridae. J Gen Virol 68: 1835-1848, 1987. 9. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 135CL1354, 1985. 10. Rotbart HA. Enzymatic RNA amplification of the enteroviruses. J Clin Microbiol 28: 438-442, 1990. 11. Chapman NM, Tracy S, Gauntt CJ, Fortmuller U. Molecular detection of enteroviruses using enzymatic amplification and nucleic acid hybridization. J Clin Microbiol 28: 843-850, 1990. 12. Hyypia T, Auvinen P, Maaronen M. Polymerase chain reaction for human picornaviruses. J Gen Virol 70: 3261-3268, 1989. 13. Rotbart HA, Kinsella PJ, Wasserman RL. Persistent enterovirus infection in culture-negative meningoencephalitis: demonstration by enzymatic RNA amplification. J Infect Dis 161: 787-791, 1990. 14. Rotbart HA. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J Pediatr 117: 85-89, 1990. 15. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory. New York: 122-133, 46W67, 1982. 16. Samuelson A, Skoog E, Forsgren M. Aspects on the serodiagnosis of enterovirus infections by ELISA. Serodiagn Immunother Infect Dis 4: 395-406, 1990. 17. Glimlker M, Ehrnst A , Magnius L, Berglund P, Forsgren M, Vikerfors T, Olcen P. Early diagnosis of enteroviral meningitis by a solid phase reverse immunosorbent test and virus isolation. Scand J Infect Dis 22: 519-526, 1990. 18. Cova L, Kopecka H, Aymard H, Girard M. Use of cRNA probes for the detection of enteroviruses by molecular hybridization. J Med Virol 24: 11-18, 1988. I Y . Hyypia T, Stdlhandske P, Vainionpaa R, Pettersson U. Detection of enteroviruses by spot hybridization. J Clin Microbiol 19: 436438, 1984.
Scand J Infect Dir 24
Detection of enteroviruses bv PCR 273
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
20. Rotbart HA, Levin MJ, Villarreal LP. Use of subgenomic poliovirus DNA hybridization probey to detect the major subgroups of enteroviruses. J Clin Microbiol 20: 1105-1108, 1984. 21. Rotbart HA, Eastman PS, Ruth JL, Hirata KK, Levin JM. Nonisotopic oligomeric probes for the human enteroviruses. J Clin Microbiol26: 2669-2671, 1988. 22. Petitjean J, Quibriac M, Freymuth F, Fuchs F. Laconche N, Aymard M, Kopecka H. Specific detection of enteroviruses in clinical samples by molecular hybridization using poliovirus subgenomic riboprobes. J Clin Microbiol 28: 307-31 1 , 1990. 23. Coller BA, Chapman NM. Beck MA, Pallansch MA, Gauntt CJ, Tracy SM. Echovirus 22 is an atypical enterovirus. J Virol 64: 2692-2701. 1990.
18’
Detection of Enteroviruses in Faeces by Polymerase Chain Reaction ALMAZ ABEBE'.', B O JOHANSSON', JANIS ABENS' and ORJAN
STRANNEGARDI
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
From the Departments of 'Virology, the Central Microbiological Laboratory of Stockholm Coirnty Council and 'Infectious Diseases, Roslugstull Hospital, Karolinska Institute. Stoi kholm, Sweden
A polymerase chain reaction (PCR) technique for the detection of human enteroviruses in stool specimens was developed. The test was based on the synthesis of cDNA, followed by PCR and slot blot hybridization. The primers used were selected from a highly conserved sequence in the 5'non-coding region of the enteroviral genome. By this method 27 different enterovirus serotypes (15 echo, 6 coxsackie A, 4 coxsackie B, poliovirus type 2 and enterovirus 71) from 89 patients could be detected. Using positive virus culture as reference, the sensitivity of PCR was 69% after 30 cycles of amplification, 91% using 30 10 cycles and 100O/0 following 2 rounds of amplification with ensuing hybridization. None of 23 stool samples from healthy individuals or patients with meningitis of proven non-enteroviral etiology were positive by the PCR. By contrast, 13/26 culture-negative, randomly chosen stool samples from patients with suspected enteroviral disease were positive by the test. These findings demonstrate a high sensitivity and an apparently high specificity of PCR for detection of enteroviruses in stool samples. Therefore, the methodology may be useful in the laboratory diagnosis of enterovirus infections.
+
0. Strannegdrd, MD, PhD, Department of Virology, Central Microbiological Laboratory, P.O. Box 70470, S-10726 Stockholm, Sweden
INTRODUCTION Human enteroviruses, which are single-stranded R N A viruses found in the family picornaviridac comprise more than 70 different serotypes. They may cause several clinical syndromes. e.g. meningitis, perimyocarditis or paralysis. and have also been suggested to play a pathogenic role in diabetes mellitus and cardiomyopathy ( 1 4 ) . Commonly used diagnostic tests for enterovirus infections are based on virus isolation in cell culture, followed by identification of serotypes with neutralizing antisera, o r on serological tests. These methods are time-consuming and laborious and frequently have a rather low sensitivity ( 5 ) . Sequencing of several enterovirus serotypes (6-8) and the advent of polymerase chain reaction (PCR) techniques (9) have recently made possible the detection of these pathogens in a rapid and sensitive fashion. Several laboratories have found that PCR. employing broadly reactive primers, can be utilized for the detection of most enterovirus serotypes (10-14). Recently, it has been reported that enteroviral meningitis can be successfully diagnosed using PCR amplification of enteroviral nucleic acid present in cerebrospinal fluid (13. 14). In the present study. we have developed and applied PCR for the detection of enteroviruses in stool specimens. MATERIALS and METHODS Strtiiples A total of 138 stool specimens were selected for the study. All specimens had been analysed by viru.; culture during a .?-year period (1988-91) and had been kept frozen at -70°C for varying periods of time. 89 samples that were positive by virus culture using G M K , RD, and HeLa cells were selected. The virus
266 A . Ahebe et al. A. 5’ P I / - ,
Scand J Infect Dis 24
-, - , -
1Kb
1 -
3Kb
3-
. __
> -
5Kb
AAA3’
7Kb
B. 5’
3’ 445
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
C.
470
510
538
544
564
445 470 5 ‘TCCTCCGGCCCCTGAATGCGGCTAAT3’ 564 544 S’GAAACACGGACACCCAAAGTA3’ 510 538 S’GTGTCGTAACGGGCAACTCTGCAGCGGAA3’
Fig. I . A: Schematic representation of 7.5 Kb single stranded poly A tailed RNA genome of the enteroviruses and thc location of the S e n d of the oligonieric primer pair (region in bracket). Kb = kilobase B: Enlargemcnt of the bracketed area shows the upstream position 445470, downstream position 544-564 of nuclcotide primers and probe position 510-538. C: Specific sequences of primers and probe.
isolates were typcd by a complement fixation procedure (5) and found t o belong t o 27 different identified enterovirus serotypes. Three of the culture-positive samples could not be typed and 49 samplcs were negative by culture. Out of the culture-negative specimens 9 were from patients with aseptic meningitis due to other etiological agents (Borrelia burgdorferi, herpes simplex virus type 2, varicella zoster virus. and tick-borne encephalitis virus), and 14 samples from healthy adults. The remaining 26 samples were randomly chosen among specimens that had been sent to the laboratory for viral culture because of suspicion of enterovirus infection (3 samples from children with encephalitis of unknown origin, 18 from patients, mainly children, with diarrhoea, and 5 from children with newly diagnosed diabetes nicllitus type 1).
Viral R NA extraction Stool specimens were suspended in Parker medium containing 10% fetal calf serum (about 10% wlv). One ml of the suspension was treated with 0.5 ml lysis buffer (50 mM Tris, 0.5% SDS, 10 mM EDTA, SO mM NaCl, p H 7.5). and 30 pl proteinase K (10 mg/ml). The samples were then vortexed for 30 sec and incubated at 56°C for 1 h. To each sample 0.5 rnl phenol-chloroform (1:l) was added and the mixtures were then vortexed for 30 sec, followed by centrifugation for 30 min at 14 000 rpm in an Eppendorf centrifuge. The aqueous phase was collected and 1 ml of 95% ethanol added to precipitate the RNA. Samples were centrifuged for 10 min and the supernatant was discarded. The pellets were washed with 70% ethanol and centrifuged again for 10 min. The supernatant was discarded, the pellets dried under vacuum, and finally dissolved in 10 pl sterile distilled water. Primers and probes Although the complete nucleotide sequences of all enteroviruses have not yet been determined, certain sequences in the S’non-coding region have been found to be highly conserved in all enteroviruses sequenced to date. To obtain group-specific reactivity. the primers used in this study were derived from the S’non-coding region of the enterovirus genome by use of computer assisted analysis. Two regions of 21 and 26 bases showing complete sequence conservation were identified. The upstream primer BJent I (S’TCCTCCGGCCCCTGAATGCGGCTAAT3‘)and the downstream primer BJent 2 (S’GAAACACGGACACCCAAAGTA 3’) were chosen from these regions (Fig. 1 ) . Amplification of enteroviral cDNA with these primers resulted in the synthesis of a 120-bp fragment. The probe specific for the amplified product (BJcoxpro) was positioned at nucleotide number 511r538 in thc genome of coxsackie B3 (5‘GTGTCGTAACGGGCAACTCTGCAGCAGCGGAA3’)and
Scand J Infect Di\ 2 1
Detection of eiiteroviriises bv PCR 267
also had specific homology with the coxsackie B I , H-l and coxsackie A9 genome (data obtained from Gcnc Bank).
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
( , D N A .syrrfhc,.\is Prioi- to PCR. cDNA synthesis was carried out using 5 p1 o f sample nucleic acid extract. The sample was added t o a reaction mixture containing 20 1.11 2x I-everse transcription buffer (250 m M Tris HCI. pH 8.3. I5 m M MgCI?. 350 mM KCI. 50 mM dithiothrcitol). 1 ~ r RNasin l (Promega. 40 000 Uiml), 6 p1 of 10 mM ATP. CTP GTP. T T P nucleotide mixture. 1 p1 clownstream primer (10 pmolesikl) and 0.5 pI of reverse transcriptase (AMV reverse transcriptase. I X 000 U h l Pharmacia LKB Biotechnology , Uppsala. Swcdcn). The mixture was then incubated for 90 min at 42°C.
PCR To 5 p l of the reverse transcription mixtures. 5 111 of 1Ox PCR buffer (500 mM KCI. 200 mM Tris HCI, pH S.4. 25 mM MgCI,, 1 inginil of nucleasc-free bovine serum albumin). 8 p1 o f diluted mix of deoxynucleotidcs (0.2 mM cach dATP. dGTP, dCTP. dTTP, Pharmacia LKB Biotechnology), 4 ltl of 15 mM MgCI,, 4 pl each of the primers (10 pmolesiyl). 0.2 ~ r of l 5 Uipl of Thermus aquaticus (Tq.) DNA polymerase (Perkin Elmer Cetus, Norwalk, Conn.. USA), and 19.8 pi of distilled H,O to make a total volume of 50 pl was added. Distilled water samples were also included as negative controls. Amplification was initiated hy one cycle of 5 min denaturation, 30 sec annealing, and 1 rnin extension. A further 28 cycles o f 30 sec denaturation (Y5"C). 30 scc annealing ( S 5 T ) and 1 min primer extension (72°C) steps wcre followed by a final cycle of 30 sec denaturation. 30 sec annealing and 5 niin extension. Analysis of the amplified product was performed by electrophoresis (3% agarose, NuSieve. FMC. USA). A second round of 10 PCR cycles was pcrforrned to increasc [he sensitivity by adding 1 11.1of thc first PCR product (diluted 1: 10 in distilled water) to B fresh PCR reagcnt mixture. A gel electrophoresis hand o f 120 base pairs was considered indicative of enteroviral KNA. A prototype strain of coxaackicvirus type €35 equivalent to 2.9 and 6.9 TCID,,, was included as weakly positivc and strongly positive control samples in each run and every second or third sample was a negative control. Whenever signs of contamination in any ncgative control sample wcre observed the rewlts of the whole run were disregarded. Slot-hlot hybridization
30 PIof amplified DNA was denatured at 95°C for 5 min and immediately transferred to ice. An equal volume of ice cold 20x SSC (0.3 M of citrate. 3M of sodium chloride in sterile water. pH7) was added to tht. tube. then the mixture was transferred to a Hybond N membrane (Amersham, Buckinghamshire. England). presoakcd in 1Ox SSC for 15 min using a Milli-Blot microfiltration apparatus (Millipore cooperation. Bedford. M A . USA). The membrane was irradiated with UV light for 5 rnin and prchybridized at 42°C in a solution containing 10% deionized formamide, Sx SSC. 0.05% sodium phosphate. 5x Denhardt's solution (0.02% Ficoll, 0.02% polyvinylpyroiidon, 0.02% bovine serum albumin, 0.02% NaN,), 0.5% sodium dodecyl sulfate (SDS). and 0.25 mgiml of sheared and denatured hei-ring sperm D N A , as described previously ( I S ) . The DNA probe was end labelled using T, polynucleotide kinase and P3' labeled ATP and was purified by the spun-column procedure of Maniatis et al. (15). Labelled probe was added to tubes containing 10% formamide. Sx SSC, 0.02 M sodium phosphate. Sx Denhardt's solution, 1'6 SDS. and 0.1 pg of denatured herring sperm D N A . The membrane was hybridized overnight at 42°C and then washed 3 times for 15 min at 52°C in lx SSC containing 0.1 70SDS. Then it was wrapped in saran wrap and exposed to X-ray film (Hyper film beta MAX, Amersham) at -70°C for 24 h .
RESULTS Sensitivity and specificity of the PCR methodology The PCR method was developed after a series of experiments aimed at evaluating the specificity and sensitivity of the method. These cxperiments were performed on the supernatants of virus-infected cell cultures. A total of 30 different enterovirus serotypes were tested and in all cases found to be positive by PCR (Holmstrom et al.; unpublished data). Parallel titrations of viral infectivity and PCR reactivity using the highly cytopathogenic coxsackievirus B5 and echovirus 11 showed that the PCR was able to detect about 100
268 A . Abebe el al.
Scand J Infect Dis 24
Table I. Results of PCR on stool specimens in relation to results obtained by virus culture Virus isolated
No. of
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
specimens
Echo 2 Echo 3 Echo 4 Echo 6 Echo 7 Echo 9 Echo 11 Echo 14 Echo 16 Echo 18 Echo 21 Echo 22 Echo 30 Echo 31 Cox.A2 Cox.A3 Cox.A4
Cox.A6 Cox.A9 C0x.A 16
Cox.B2 Cox.B3 Cox.B4 Cox.BS Polio 2 Ent. 71 NI"
Total no. of samples Enterovirus typcs
Pos. after 1st set of cycles
Additional pos. after 2nd set of cycles
2 2 1 8
2 1
0 1
1 6
0 2
1
1 0 1
1 6
0 1 2 2 1 0 0 0
7
6
1 1 1 3 2 9 3 1
0
6
5 4
2 3 3 1 1
5 11
1 1 3 89 27
1 1 2 2 9 2 1
8 0
1 2
61 21
1
0 1 1 3 1 1 0 0 1 0 0 1 0 0 1 3 0 0 1 20 5
Additional pos. after hybridization 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 0
0 0 0 0 0 1 0 0 1 0 0
8 1
aNot identifiable virus isolated in cell culture
TCID,, of the virus after 30 cycles of amplification. The sensitivity was increased about 10-fold after an additional 10 cycles of amplification and a further 10-100-fold after the hybridization step. Thus, PCR utilizing 30+10 cycles had a sensitivity which was slightly lower than that of virus isolation and with the hybridization step included the sensitivity was equal to or exceeded that obtained by virus culture. In cases where poorly cytopathogenic coxsackie A viruses were tested, the sensitivity of the PCR was much higher than that of virus culture, irrespective of the number of amplification cycles employed. The specificity of the PCR was evaluated using R N A extracts of supernatants from cells infected with either of 19 different human viruses, including rhinovirus type 1B. 7, and 11. The PCR did not give any positive signals with any of these viruses except for the 3 rhinoviruses which all gave rise to positive reactions (Holmstrom et al.; unpublished data).
Detection of enteroviruses by PCR Positive PCR rcsults were defined as occurrence of bands in the agarose gels of 120 bases in length. Out of the 89 tested culture positive stool specimens, 61 were positive after the first round of 30 PCR cycles and a further 20 samples were positive after an additional 10 PCR cycles (Table I). Eight culture-positive samples (1 coxsackie B3, 1 echo 9, 2 echo 16, 3 echo
Detection of enteroviruses by PCR 269
Scand I Infect Dis 24
Table 11. Results of PCR o n culture-negative stool surnples ~~
~
Diagnosis
No. of
N o . neg.
Positive PCR after
samples
Newly diagnoscd type I diabetes mellitus
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
Diarrhoea or encephalitis with unknown etiology Meningoencephalitis
1st set of cycles
2nd set of cycles
Slot blot hybridization
5
1
2
0
2
21
12
3
0
6
9
9
0
0
0
with known
non-enteroviral etiology" Healthy individuals
14
14
0
0
0
Total
49
36
5
0
8
"Of the 9 cases of meningoencephalitis, 1 was associated with Borrelia burgdorferi, 3 with varicellazoster. 2 with herpes simplex type 2, and 3 with tick-borne encephalitis virus
22, and 1 polio type 2) were negative throughout the 2 rounds of amplification (30 or 30 + 10 cycles).The overall sensitivity of PCR. not including a probing step (see below) was thus 69% (61/89 samples) following the first set of cycles and 91% (81/89 samples) using the additional set of amplification cycles. Using the 2 sets of amplification cycles enterovirus RNA could b e successfully demonstrated in stool specimens containing 26 of the 27 different serotypes tested. It was noteworthy that none of the 6 echo 22 virus-containing specimens were positive after the first round of 30 PCR cycles although 3 of them tested positive after the second round of cycles. 5/49 culture-negative samples were positive after the first 30 PCR cycles and no additional positive results were encountered after 10 additional cycles. Of the 5 PCR-positive but culture-negative cases, 3 had a clinical diagnosis of diarrhoea or encephalitis with unknown etiology and 2 had newly diagnosed type 1 diabetes (Table 11). The specimens from all these 5 cases had been collected between August and February. All samples collected from normal individuals were negative.
Identification of enteroviriu serotypes by hy6ridization of PCR products In order to check the specificity of the PCR, and in an attempt to increase the sensitivity of the reaction, a hybridization assay was included following amplification. Results of an 10 experiment utilizing products obtained after the 2 sets of amplification cycles (30 cycles) are shown in Fig. 2. This figure shows that all samples positive by virus culture gave clear signals in the hybridization assay, even those which did not give rise to visible bands after agarose gel electrophoresis. Identical results were obtained in other experiments on remaining specimens (Table I). Thus, the overall sensitivity of the method involving 2 sets of PCR cycles followed by hybridization was 100% (89/89) in relation to virus culture. Also shown in Fig. 2 are the positive results of 5 culture-negative, but PCR-positive specimens. In all, 8/44 culture-negative and agarose gel electrophoresis-negative specimens were positive by hybridization (Table 11). Two of these were obtained from patients with newly diagnosed type 1 diabetes mellitus and 6 were from patients with diarrhoea or
+
.
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
270 A . Abebe et al.
S c a d J Infect D n 23
Fig. 2. Analysis of PCR amplification products by slot blot hybridization. Stool samples positive by virus culture for various serotypes of echovirus (EV), coxsackievirus (CV) or poliovirus (PV) were analysed. Additionally, culture-negative samples (NEG), or samples from patients with serological evidence of herpes simplex type 2 (HSV2), tick-borne encephalitis virus (TBEV), varicella-zoster virus (VZV) and Borrelia burgdorferi (Borr.) infection were analysed. A1-6, EV14, EV22, EV16, EV31, N1*, CVA4 B1-6. EV22, NEG"', EV30. NEG*", EV3, EVl8 C1-6, PV2, CVA16, NEG**. CVB4, EV21, EV22 D1-6, EVl1. EV22, EV16, CVB3, EV7, CVBS El-6, EV9, NEG**, NEG*", EV22, EV22, CVBS F1-6. EV6. HSV2, H 2 0 . VZV, HSV2. NEG** G1-6, NEG**, TBEV, VZV, BORR., HSV2, BORR. HI-6, HSV2, -, HZO, HZO, NI* = isolated virus not typable; NEG** = culture negative samples.
-.
encephalitis with unknown etiology. All culture-negative specimens that were positive by hybridization had been collected during the autumn. DISCUSSION
The laboratory diagnosis of enterovirus infection presents several problems, in particular since this group of viruses comprises more than 70 different serotypes. Conventional techniques used include virus isolation, which is time-consuming and laborious, and serological methods using group- or type-specific antigens. Although the latter techniques recently have been considerably improved, and may be designed to detect IgM antibodies, they are often too insensitive to allow an accurate diagnosis (1, 16, 17). Because enteroviruses have been shown to share a great deal of R N A sequence homology, particularly in the S'non-coding region of the genome, molecular hybridization techniques have been devised which allow the detection of several different enteroviruses (18-21). Generally, however, hybridization tests have been found to suffer from a certain
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
Scand J lnfect Dis 24
Detection of enteroviriises by PCR 271
lack of sensitivity. Thus, for instance, Petitjean et al. (22) found a sensitivity of only 33% when clinical stool samples were tested by dot blot hybridization using radiolabelled riboprobes, The advent of the PCR technique (9) has made it possible to design much more sensitive assays for enteroviruses. A recent report has described that PCR can detect enteroviruses in about 100-fold lower concentrations than conventional hybridization tests (10). With the methodology used by us we found that the PCR generally was able to detect about 100 TCID,,, of the virus after 30 cycles of amplification. The sensitivity was increased about 10-fold after an additional 10 cycles of amplification and a further 10-100-fold after addition of a hybridization step. This high sensitivity obtained on cultured viruses suggested that the PCR could be applied for the detection of enteroviruses in clinical specimens. I n accordance with the above suggestion the application of PCR for the detection of enteroviral R N A in stool samples resulted in a very high detection rate. Positive PCR signals were obtained with all 89 stool specimens obtained from patients with culture-proven enterovirus infections, giving a sensitivity of 100%. This sensitivity was only obtained, however, using the 3-step PCR methodology. In comparison, using a single set of 30 cycles, followed by agarose gel electrophoresis, a sensitivity of 69% was obtained. Even the latter figure compares very favourably, however. with the sensitivity obtained with conventional hybridization techniques (22). In the present study, none of 23 culture-negative stool specimens from healthy individuals or patients with meningoencephalitis of non-enteroviral origin tested positive by PCR, giving a specificity of 100°/o. By contrast, 13/26 culture-negative specimens from patients with suspected enteroviral disease were positive by PCR. This finding would presumably reflcct a superior sensitivity of PCR for the detection of, in particular, poorly cytopathogenic enteroviruses. Particularly interesting was the finding of PCR positivity in 4 of 5 patients with newly diagnosed insulin-dependent diabetes mellitus. A probable role of enteroviruses in this disease has been suggested (4). It should be noted, however, that these specimens had all been obtained during the enterovirus season, and there might therefore merely be a chance association between the finding of enteroviral R N A and the diabetic disease. Nevertheless, PCR would be assumed to be an ideal tool for determination of a possible association between e.g. diabetes mellitus or cardiomyopathy and chronic enteroviral infection. The reason for this would be its high sensitivity and also its independence of interference by antibodies which may confound results obtained by virus culture. In the present study we were able to successfully amplify 27 different enterovirus serotypes. With PCR methodology utilizing primers in the noncoding region of the enteroviral genome we and others have demonstrated common PCR reactivity of the majority of the cntcrovirus serotypes (lCL12). This would indicate that the S'non-coding region in which the primers were located is highly conserved. In fact, all enteroviruses sequenced to date possess the particular sequence we have studied. The sequence, however, does not seem to be unique to the enteroviruses, but is apparently shared by rhinoviruses as shown in this and in other studies (12; data obtained from Gene Bank). From the diagnostic point of view, a PCR cross-reactivity with rhinoviruses should present little problems since the occurrence of these viruses is usually restricted to the upper respiratory tract. We have, however, devised a simple test based on restriction enzyme (Ava 11) digestion of the amplified product to discriminate rhinoviruses from enteroviruses (unpublished results). Echovirus 22 was found to be poorly reactive by PCR, but could nervetheless be identified in all 6 cases studied using the 3 step procedure. The poor reactivity of this serotype probably reflccts the fact that echovirus 22 is an atypical enterovirus which in previous studies could not be detected by PCR (11, 12,23). However, our results and those of Rotbart (10) suggest that the genomic RNA of echovirus 22 has at least partial homology with other enteroviruses IX
bcand J Infect DIS
272 A . Abebe et al.
Scand J Infect Dis 24
in the S'non-coding region and therefore may be detected by highly sensitive PCR procedures using general primers. In summary, the present results show that PCR can be used as a very efficient tool for the demonstration of enteroviral RNA in stool samples. Our further work aims at evaluating the usefulness of PCR for the detection of enteroviruses in other types of clinical specimens and at using PCR for the determination of possible associations between enteroviruses and a variety of chronic diseases.
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
ACKNOWLEDGEMENTS The first author was supported by a WHO fellowship grant during this study. Additional grants were obtained from the Karolinska Institue, Stockholm, and from the Swedish Medical Research Council. We thank Dr Martin Glimgker for kindly providing us with samples from patients with meningitis of non-enteroviral etiology. The expert technical assistance of Ms Mina Kalantari, Ms h a Staland, Ms Anna Karin Bergman. Ms Kicki Englund and Ms Irene Hjalmardotter is gratefully acknowledged.
REFERENCES 1. Melnick JL. Enteroviruses: Poliovirus, coxsackie-viruses, echoviruses and newer enteroviruses. In: Fields BN, Knipe DM, eds. Fields virology, 2"d ed. New York: Raven Press, 549-605, 1990. 2. Jarvis WR, Tucker G , Echovirus type 7 meningitis in young children. Am J Dis Child 135: 1009-1012, 1981. 3. Woodruff JF. Viral myocarditis. A review. Am J Pathol 101: 427483, 1980. 4. Jenson AB, Rosenberg H. Multiple viruses in diabetes mellitus. Prog Med Virol29: 197-217,1984. 5 . Grandien M, Forsgren M, Ehrnst A. Enteroviruses and reoviruses. In: Schmidt NJ, Emmons RW, eds. Diagnostic procedures for viral, rickettsia1 and chlamydia1 infection. Washington DC: American Public Health Association, 513-578. 1989. 6. Lizuka N, Kuge S, Nomoto A. Complete nucleotide sequence of the genome of coxsackievirus B1. Virology 156: 6473, 1987. 7. Lindberg AM, Stilhandske POK, Pettersson U . Genome of coxsackievirus B3. Virology 156: 50-63, 1987. 8. Jenkins 0. Booth JD, Minor PD, Almond JW. The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the picornaviridae. J Gen Virol 68: 1835-1848, 1987. 9. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 135CL1354, 1985. 10. Rotbart HA. Enzymatic RNA amplification of the enteroviruses. J Clin Microbiol 28: 438-442, 1990. 11. Chapman NM, Tracy S, Gauntt CJ, Fortmuller U. Molecular detection of enteroviruses using enzymatic amplification and nucleic acid hybridization. J Clin Microbiol 28: 843-850, 1990. 12. Hyypia T, Auvinen P, Maaronen M. Polymerase chain reaction for human picornaviruses. J Gen Virol 70: 3261-3268, 1989. 13. Rotbart HA, Kinsella PJ, Wasserman RL. Persistent enterovirus infection in culture-negative meningoencephalitis: demonstration by enzymatic RNA amplification. J Infect Dis 161: 787-791, 1990. 14. Rotbart HA. Diagnosis of enteroviral meningitis with the polymerase chain reaction. J Pediatr 117: 85-89, 1990. 15. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory. New York: 122-133, 46W67, 1982. 16. Samuelson A, Skoog E, Forsgren M. Aspects on the serodiagnosis of enterovirus infections by ELISA. Serodiagn Immunother Infect Dis 4: 395-406, 1990. 17. Glimlker M, Ehrnst A , Magnius L, Berglund P, Forsgren M, Vikerfors T, Olcen P. Early diagnosis of enteroviral meningitis by a solid phase reverse immunosorbent test and virus isolation. Scand J Infect Dis 22: 519-526, 1990. 18. Cova L, Kopecka H, Aymard H, Girard M. Use of cRNA probes for the detection of enteroviruses by molecular hybridization. J Med Virol 24: 11-18, 1988. I Y . Hyypia T, Stdlhandske P, Vainionpaa R, Pettersson U. Detection of enteroviruses by spot hybridization. J Clin Microbiol 19: 436438, 1984.
Scand J Infect Dir 24
Detection of enteroviruses bv PCR 273
Scand J Infect Dis Downloaded from informahealthcare.com by University of Newcastle on 01/07/15 For personal use only.
20. Rotbart HA, Levin MJ, Villarreal LP. Use of subgenomic poliovirus DNA hybridization probey to detect the major subgroups of enteroviruses. J Clin Microbiol 20: 1105-1108, 1984. 21. Rotbart HA, Eastman PS, Ruth JL, Hirata KK, Levin JM. Nonisotopic oligomeric probes for the human enteroviruses. J Clin Microbiol26: 2669-2671, 1988. 22. Petitjean J, Quibriac M, Freymuth F, Fuchs F. Laconche N, Aymard M, Kopecka H. Specific detection of enteroviruses in clinical samples by molecular hybridization using poliovirus subgenomic riboprobes. J Clin Microbiol 28: 307-31 1 , 1990. 23. Coller BA, Chapman NM. Beck MA, Pallansch MA, Gauntt CJ, Tracy SM. Echovirus 22 is an atypical enterovirus. J Virol 64: 2692-2701. 1990.
18’
