Vol. 30, No. 6
JOURNAL OF CLINICAL MICROBIOLOGY, June 1992, p. 1374-1379
0095-1137/92/061374-06$02.00/0 Copyright X) 1992, American Society for Microbiology
Detection of Babesia bovis Carrier Cattle by Using Polymerase Chain Reaction Amplification of Parasite DNA YUDHA FAHRIMAL,l WILL L. GOFF,2
DOUGLAS P. JASMERl* Department of Veterinary Microbiology and Pathology, Washington State University, 1 and Animal Research Unit, Agricultural Research Service, U. S. Department of Agriculture,2 Pullman, Washington 99164 Received
5
AND
November 1991/Accepted 28 February 1992
Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginak, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytochrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. occur in peripheral blood.
Babesia bovis is a tick-transmitted protozoan parasite of cattle. The disease is considered one of the most important tick-borne diseases of cattle worldwide, and of the 1.2 x 109 cattle in the world, over 500 million of these cattle are potentially at risk of having bovine babesiosis (17). Animals that survive B. bovis infection generally become low-level carriers of the parasite and serve as a reservoir for transmission (11). Control of bovine babesiosis is primarily achieved by vaccination of animals with live attenuated vaccines (13, 14). However, live vaccines also induce the carrier state, which is an important consideration for disease transmission. Because of this and other limitations of blood-based vaccines (3, 4), much research has been devoted to the development of subunit vaccines for the control of B. bovis infection (5, 6, 21). For vaccine development, it will be important to determine both the extent to which these vaccines induce the carrier state and the duration of these infections. Sensitive methods for the detection of B. bovis carrier cattle are therefore needed. Currently, detection of B. bovis in carrier cattle is done by serological methods (27), subinoculation of blood into splenectomized cattle, or examination of thick blood smears (thick smears). However, serology is indirect and does not necessarily distinguish between past exposure and present infections. Subinoculation is expensive for routine use (10), and the sensitivity of thick smears in detecting carriers is an estimated 1,000 parasites per ml of blood (11, 15). Because parasite levels fluctuate over time, the percentage of carrier cattle detected by thick smears is low, ranging from 8 to 68% (15). Thus, alternative methods that are capable of accurately diagnosing B. bovis carrier cattle are needed. Nucleic *
acid probes have been described for B. bovis (8, 18). However, their relatively low sensitivities (100 pg of B. bovis DNA, or an estimated 2,000 parasites) are unlikely to be adequate for the detection of carrier cattle. The polymerase chain reaction (PCR) offers an alternative approach for detection of B. bovis carrier cattle. Previous research identified a B. bovis sequence (Bo6) which may be a useful target for PCR-assisted detection of the parasite. The sequence is associated with a 7.4-kb DNA element which appeared to be autonomous from larger chromosomal B. bovis DNA. Furthermore, the sequence appeared to be abundant within the genome, conserved among strains of B. bovis from different geographic regions, and divergent in Babesia bigemina (8). Therefore, it is likely that primers from this sequence can be designed to specifically amplify B. bovis DNA. In this report, we describe the use of PCR to specifically amplify a region of the Bo6 sequence and show that detection of the amplified product significantly increased the sensitivity of detecting B. bovis carrier cattle in comparison with that from the use of thick smears. MATERIALS AND METHODS Parasites. The B. bovis Mexico strain was maintained in culture as described previously (6). The origins and descriptions of the B. bovis Australia L and S and Texas strains were described elsewhere (25), and DNAs from these strains and Anaplasma marginale were kindly provided by Guy Palmer (Washington State University). For species specificity experiments, B. bigemina DNA was provided by Terry McElwain (Washington State University), and Trypanosoma brucei DNA was provided by Peter Myler (Seattle Biomedical Research Institute).
Corresponding author. 1374
DETECTION OF B. BOVIS CARRIER CATTLE BY PCR
VOL. 30, 1992
TABLE 1. Characteristics of B. bovis carrier cattle and methods
of determining carrier statusa Group and carrier animal no.
Group 1 103 368 527 548
Date of infection (mo/yr)
B. bovis
strainb
8/1989
T
387c 397c
10/1989 6/1989 6/1989 9/1989 9/1989
T T T M M
Group 2 453 454 457 461 463 467
6/1990 6/1990 6/1990 6/1990 6/1990 6/1990
T T T T T T
T7 H
pBo6 PCR Probe
N I
A
1375
T3 2.75 kb
,__ GGGTTTATAGTCGGTTTTGT ACCATTCTGGTACTATATGC
FIG. 1. Schematic of the pBo6 insert. The Bo6 insert was derived from a 7.4-kb DNA element from a B. bovis genomic DNA library (8) and contains sequences similar to those of the apocytochrome b genes (open box in the Bo6 insert; nucleotides 1 to 1036)
from other organisms (unpublished data). The relative location of
a All animals were B. bovis carriers. The carrier status of group 1 animals was determined by subinoculation of 200 ml of blood individually into splenectomized calves; this was followed by examination of thick blood smears. The carrier status of group 2 animals was determined by PCR and thick blood smear techniques. b T and M refer to B. bovis Texas and Mexico strains, respectively. c Cattle were vaccinated prior to homologous challenge.
Carrier cattle. Two groups of carrier cattle were used in this study (Table 1). The first group of six cattle (group 1) was infected with B. bovis in 1989. Four of these cattle were inoculated with the B. bovis Texas strain, and the other two were immunized with a culture supernatant of B. bovis Mexico strain prior to homologous challenge. All of these cattle were proven to be carrier cattle by subinoculation of their blood individually into splenectomized calves in November 1990 and by examination of blood smears (12). Blood was collected from group 1 carrier cattle prior to subinoculation and was prepared as described below. The second group of six carrier cattle (group 2) was inoculated with the B. bovis Texas strain in June 1990. Blood from group 2 carrier cattle was examined by thick smears at each time of blood collection; blood from these cattle was also analyzed by PCR and DNA hybridization. Since B. bovis is not naturally transmitted in Washington State, all carrier cattle were maintained on pasture or in enclosures. DNA isolation. Infected erythrocytes were pelleted by centrifugation at 3,000 x g for 10 min, depleted of the buffy coat, washed in phosphate-buffered saline (0.137 M NaCl, 10 mM Na2HPO4, 3.2 mM KH2PO4), and repelleted by centrifugation. Washed erythrocytes from group 1 carrier cattle were frozen in 0.5-ml aliquots. For blood from group 2 carrier cattle, an equal volume of sterile water was added; the sterile water differentially lysed uninfected erythrocytes (2). Infected erythrocytes were pelleted by centrifugation at 10,000 x g for 10 min. For all DNA extractions, the erythrocyte pellets were suspended in buffer (200 mM EDTA, 100 mM NaCl, and 50 mM Tris-Cl [pH 7.5]) at 4°C and were digested from 1 h to overnight with proteinase K (100 ,ug/ml) and 1% sodium dodecyl sulfate (SDS). Lysates were adjusted to 1 M NaCl and were extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1). The DNA in the aqueous phase was precipitated with 2 volumes of cold 95% ethanol, pelleted by centrifugation at 10,000 x g, dried, and resuspended in 10 mM Tris-HCl (pH 8.0)-i mM EDTA. The DNA was then treated with RNases A and Ti (15 ,ug/ml and 15 U/ml, respectively), extracted, precip-
the 711-bp PCR product (nucleotides 14 to 725) and 642-bp HincIl
(H)-NsiI (N) probe sequence (nucleotides 66 to 708) within Bo6 are shown below the insert map. The sequence of forward (--; nucleotides 14 to 33) and reverse (
JOURNAL OF CLINICAL MICROBIOLOGY, June 1992, p. 1374-1379
0095-1137/92/061374-06$02.00/0 Copyright X) 1992, American Society for Microbiology
Detection of Babesia bovis Carrier Cattle by Using Polymerase Chain Reaction Amplification of Parasite DNA YUDHA FAHRIMAL,l WILL L. GOFF,2
DOUGLAS P. JASMERl* Department of Veterinary Microbiology and Pathology, Washington State University, 1 and Animal Research Unit, Agricultural Research Service, U. S. Department of Agriculture,2 Pullman, Washington 99164 Received
5
AND
November 1991/Accepted 28 February 1992
Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginak, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytochrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. occur in peripheral blood.
Babesia bovis is a tick-transmitted protozoan parasite of cattle. The disease is considered one of the most important tick-borne diseases of cattle worldwide, and of the 1.2 x 109 cattle in the world, over 500 million of these cattle are potentially at risk of having bovine babesiosis (17). Animals that survive B. bovis infection generally become low-level carriers of the parasite and serve as a reservoir for transmission (11). Control of bovine babesiosis is primarily achieved by vaccination of animals with live attenuated vaccines (13, 14). However, live vaccines also induce the carrier state, which is an important consideration for disease transmission. Because of this and other limitations of blood-based vaccines (3, 4), much research has been devoted to the development of subunit vaccines for the control of B. bovis infection (5, 6, 21). For vaccine development, it will be important to determine both the extent to which these vaccines induce the carrier state and the duration of these infections. Sensitive methods for the detection of B. bovis carrier cattle are therefore needed. Currently, detection of B. bovis in carrier cattle is done by serological methods (27), subinoculation of blood into splenectomized cattle, or examination of thick blood smears (thick smears). However, serology is indirect and does not necessarily distinguish between past exposure and present infections. Subinoculation is expensive for routine use (10), and the sensitivity of thick smears in detecting carriers is an estimated 1,000 parasites per ml of blood (11, 15). Because parasite levels fluctuate over time, the percentage of carrier cattle detected by thick smears is low, ranging from 8 to 68% (15). Thus, alternative methods that are capable of accurately diagnosing B. bovis carrier cattle are needed. Nucleic *
acid probes have been described for B. bovis (8, 18). However, their relatively low sensitivities (100 pg of B. bovis DNA, or an estimated 2,000 parasites) are unlikely to be adequate for the detection of carrier cattle. The polymerase chain reaction (PCR) offers an alternative approach for detection of B. bovis carrier cattle. Previous research identified a B. bovis sequence (Bo6) which may be a useful target for PCR-assisted detection of the parasite. The sequence is associated with a 7.4-kb DNA element which appeared to be autonomous from larger chromosomal B. bovis DNA. Furthermore, the sequence appeared to be abundant within the genome, conserved among strains of B. bovis from different geographic regions, and divergent in Babesia bigemina (8). Therefore, it is likely that primers from this sequence can be designed to specifically amplify B. bovis DNA. In this report, we describe the use of PCR to specifically amplify a region of the Bo6 sequence and show that detection of the amplified product significantly increased the sensitivity of detecting B. bovis carrier cattle in comparison with that from the use of thick smears. MATERIALS AND METHODS Parasites. The B. bovis Mexico strain was maintained in culture as described previously (6). The origins and descriptions of the B. bovis Australia L and S and Texas strains were described elsewhere (25), and DNAs from these strains and Anaplasma marginale were kindly provided by Guy Palmer (Washington State University). For species specificity experiments, B. bigemina DNA was provided by Terry McElwain (Washington State University), and Trypanosoma brucei DNA was provided by Peter Myler (Seattle Biomedical Research Institute).
Corresponding author. 1374
DETECTION OF B. BOVIS CARRIER CATTLE BY PCR
VOL. 30, 1992
TABLE 1. Characteristics of B. bovis carrier cattle and methods
of determining carrier statusa Group and carrier animal no.
Group 1 103 368 527 548
Date of infection (mo/yr)
B. bovis
strainb
8/1989
T
387c 397c
10/1989 6/1989 6/1989 9/1989 9/1989
T T T M M
Group 2 453 454 457 461 463 467
6/1990 6/1990 6/1990 6/1990 6/1990 6/1990
T T T T T T
T7 H
pBo6 PCR Probe
N I
A
1375
T3 2.75 kb
,__ GGGTTTATAGTCGGTTTTGT ACCATTCTGGTACTATATGC
FIG. 1. Schematic of the pBo6 insert. The Bo6 insert was derived from a 7.4-kb DNA element from a B. bovis genomic DNA library (8) and contains sequences similar to those of the apocytochrome b genes (open box in the Bo6 insert; nucleotides 1 to 1036)
from other organisms (unpublished data). The relative location of
a All animals were B. bovis carriers. The carrier status of group 1 animals was determined by subinoculation of 200 ml of blood individually into splenectomized calves; this was followed by examination of thick blood smears. The carrier status of group 2 animals was determined by PCR and thick blood smear techniques. b T and M refer to B. bovis Texas and Mexico strains, respectively. c Cattle were vaccinated prior to homologous challenge.
Carrier cattle. Two groups of carrier cattle were used in this study (Table 1). The first group of six cattle (group 1) was infected with B. bovis in 1989. Four of these cattle were inoculated with the B. bovis Texas strain, and the other two were immunized with a culture supernatant of B. bovis Mexico strain prior to homologous challenge. All of these cattle were proven to be carrier cattle by subinoculation of their blood individually into splenectomized calves in November 1990 and by examination of blood smears (12). Blood was collected from group 1 carrier cattle prior to subinoculation and was prepared as described below. The second group of six carrier cattle (group 2) was inoculated with the B. bovis Texas strain in June 1990. Blood from group 2 carrier cattle was examined by thick smears at each time of blood collection; blood from these cattle was also analyzed by PCR and DNA hybridization. Since B. bovis is not naturally transmitted in Washington State, all carrier cattle were maintained on pasture or in enclosures. DNA isolation. Infected erythrocytes were pelleted by centrifugation at 3,000 x g for 10 min, depleted of the buffy coat, washed in phosphate-buffered saline (0.137 M NaCl, 10 mM Na2HPO4, 3.2 mM KH2PO4), and repelleted by centrifugation. Washed erythrocytes from group 1 carrier cattle were frozen in 0.5-ml aliquots. For blood from group 2 carrier cattle, an equal volume of sterile water was added; the sterile water differentially lysed uninfected erythrocytes (2). Infected erythrocytes were pelleted by centrifugation at 10,000 x g for 10 min. For all DNA extractions, the erythrocyte pellets were suspended in buffer (200 mM EDTA, 100 mM NaCl, and 50 mM Tris-Cl [pH 7.5]) at 4°C and were digested from 1 h to overnight with proteinase K (100 ,ug/ml) and 1% sodium dodecyl sulfate (SDS). Lysates were adjusted to 1 M NaCl and were extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1). The DNA in the aqueous phase was precipitated with 2 volumes of cold 95% ethanol, pelleted by centrifugation at 10,000 x g, dried, and resuspended in 10 mM Tris-HCl (pH 8.0)-i mM EDTA. The DNA was then treated with RNases A and Ti (15 ,ug/ml and 15 U/ml, respectively), extracted, precip-
the 711-bp PCR product (nucleotides 14 to 725) and 642-bp HincIl
(H)-NsiI (N) probe sequence (nucleotides 66 to 708) within Bo6 are shown below the insert map. The sequence of forward (--; nucleotides 14 to 33) and reverse (
