Arch Virol DOI 10.1007/s00705-013-1973-3
ORIGINAL ARTICLE
Detection of antibodies specific for foot-and-mouth disease virus infection using indirect ELISA based on recombinant nonstructural protein 2B Jitendra K. Biswal • Sarita Jena • Jajati K. Mohapatra Punam Bisht • Bramhadev Pattnaik
•
Received: 7 October 2013 / Accepted: 29 December 2013 Ó Springer-Verlag Wien 2014
Abstract Foot-and-mouth disease (FMD) is a highly contagious viral disease of transboundary importance. In India, since the launch of the FMD control programme, there has been a substantial increase in the vaccinated bovine population. In this scenario, there is a need for additional locally developed non-structural protein (NSP)based immnoassays for efficient identification of FMD virus (FMDV)-infected animals in the vaccinated population. The 2B NSP of FMDV, lacking the transmembrane domain (D2B), was expressed successfully in a prokaryotic system, and an indirect ELISA (I-ELISA) was developed and validated in this study. The diagnostic sensitivity and specificity of the D2B I-ELISA were found to be 95.3 % and 94.6 %, respectively. In experimentally infected cattle, the assay could consistently detect D2B-NSP-specific antibodies from 10 to approximately 400 days postinfection. The assay was further validated with bovine serum samples collected randomly from different parts of the country. The performance of the D2B I-ELISA was compared with the in-house r3AB3 I-ELISA, and the overall concordance in test results was found to be 86.49 %. The D2B I-ELISA could be useful as a screening or confirmatory assay in the surveillance of FMD irrespective of vaccination.
Introduction Foot-and-mouth disease is a highly contagious viral disease of both domesticated and wild ruminants as well as pigs.
J. K. Biswal S. Jena J. K. Mohapatra P. Bisht B. Pattnaik (&) Project Directorate on Foot-and-Mouth Disease (ICAR), Mukteswar, Nainital 263138, Uttarakhand, India e-mail: [email protected]
Owing to its contagiousness and potential for rapid spread among susceptible animals, the disease poses a serious threat to the international trade of animals and animal products. Culling of infected and in-contact animals is the favoured method of control of FMD in many parts of the world that are free from FMD. However, prophylactic biannual vaccination with extensive serosurveillance has been preferred over culling in India. Nevertheless, the strategy of vaccination has its own problems, and the most important one is that vaccinated animals may sometimes be infected with FMD virus (FMDV) with or without showing overt clinical signs [12]. Therefore, identification of FMDV-infected individuals among vaccinated animals is of utmost importance, especially in ruminants, which may act as carriers of the virus and can potentially become the source for new outbreaks. In this respect, it is imperative to develop highly sensitive and specific discriminatory assays to detect infection regardless of vaccination status. Detection of serum antibodies against FMDV nonstructural protein (NSP) in FMD-vaccinated and subsequently infected animals is used as a differential marker of infection, since vaccination with purified vaccine elicits antibodies only against the structural protein (SP) of FMDV [7]. A range of different ELISAs have been developed to detect antibodies against NSP of FMDV [16], and these assays have a further advantage over the conventional tests in that they are not serotype specific. However, the current NSP-based assays are not able to detect infection reliably in a vaccinated population [5]. During the validation of various NSP ELISAs in an international workshop at Brescia, Italy, it was found that none of the assays could provide a categorical assurance of detecting infection [5]. Therefore, it was suggested to use more than one NSP assay in order to enhance the overall sensitivity and specificity of determination of infection
123
J. K. Biswal et al.
status. Considering that recommendation, there is a need to produce a new NSP-based ELISA that can be used either as the screening or confirmatory method along with existing NSP tests or one that can be used in a multiple NSP-antigen-based assay [24] to enhance the confidence of detection of infection. Based on a series of experiments, Berger et al. [4] suggested to use NSP 2B along with other NSPs (2C, 3AB1 and/or 3C) for identification of FMDV replication in vaccinated cattle. Infection-related linear B-cell epitopes on the 2B NSP of FMDV have been mapped by analyzing synthetic peptides in an indirect ELISA [9]. Although the ELISA based on synthetic 2B peptides had shown some promising results [21] and was comparable to the Prio CHECK-NSP assay [10], these peptides were thought to be too expensive and poorly antigenic for use in ELISA [8]. Therefore, test systems based on recombinant NSP could be designed as a relatively cost-effective alternative. In this study, we report the expression in Escherichia coli of recombinant truncated 2B NSP lacking the transmembrane domain (D2B) and the development of a differential indirect ELISA (I-ELISA) for serosurveillance of FMD.
Materials and methods Serum samples Serum samples used in this study were collected either from cattle or buffalo, and the term ‘bovine’ in this manuscript implies both of them. Serum samples collected from naı¨ve, infected (both experimentally and naturally) and uninfected vaccinated animals were obtained from the serum repository maintained at Project Directorate on Foot and Mouth Disease (PDFMD), Mukteswar, India. This study complied with international standards for animal welfare. Serum samples from a naı¨ve bovine population A total of 196 serum samples collected from clinically healthy animals and found negative for anti-FMDV structural protein antibodies in liquid-phase blocking ELISA were used in this study. These samples included 131 serum samples derived from an unvaccinated, clinically healthy bovine population without any history of FMDV infection for at least 10 years, 60 serum samples collected at day ‘zero’ from cattle used in FMD vaccine potency studies, and five commercial healthy bovine sera. Serum samples from uninfected, vaccinated bovines Serum samples (n = 144, from 72 cattle) were collected from an FMD-free dairy cattle herd that was vaccinated
123
routinely at six-month intervals with a trivalent inactivated vaccine. These samples were collected at 28 and 180 days post-vaccination (dpv). Serum samples (n = 312) from FMD control programme (FMD-CP) areas without any report of FMD for the last five years were also included in the study. The majority of the adult bovines in the FMD-CP areas had received at least 8 rounds of prophylactic biannual vaccination. Samples (n = 60) were also collected at 21 dpv from cattle that were used in FMD vaccine potency studies. All of these 516 serum samples collected from vaccinated, uninfected animals along with the serum samples from naı¨ve bovines (n = 196) were used for the determination of the cutoff value and diagnostic specificity of D2B I-ELISA. Serum samples from infected bovines A total of 178 serum samples that were collected sequentially between 10 and 1000 days postinfection (dpi) from four unvaccinated bull calves were obtained from the serum repository of PDFMD. Two of them were inoculated intradermolingually with either FMDV A IND 40/2000 or Asia 1 IND 63/1972, while the other two calves were contact infected after being co-housed separately with each of the inoculated animals [19]. 120 out of these 178 serum samples (from 10-400 dpi) were used for the estimation of the cutoff value and diagnostic sensitivity of the D2B I-ELISA. Bovine serum samples (n = 1259) from clinical cases of FMD field outbreaks were also included in this study. These samples were collected at different time points during the outbreaks, ranging from the acute phase to nearly one year post-outbreak. Bovine serum samples collected at random Serum samples (n = 3500) that had been collected at random from different parts of the country were also analysed in D2B I-ELISA in order to determine the prevalence of 2B antibodies in bovines. Molecular cloning, expression and purification of recombinant 2B non-structural protein Construction of recombinant 2B gene expression vectors Total RNA was extracted using a QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) from baby hamster kidney cells (BHK-21) infected with FMDV isolate O IND R2/1975. The extracted RNA was reverse transcribed using oligo (dT)20 primer (Invitrogen, USA) and ThermoScriptTM reverse transcriptase enzyme (Invitrogen, USA). The full-length coding sequence of 2B NSP was amplified by PCR using upstream primer 2BF (GATCGGATCC
ELISA for detection of antibodies against FMDV 2B protein
CCCTTCTTCTTC), which has a BamHI site (bold and underlined), and downstream primer 2BR (GATCAAGCTTCTGTTTTTCTG), which has a HindIII site (bold and underlined). The 2B NSP gene without the sequence encoding the transmembrane region (D2B) was amplified by an overlap extension PCR (OEP) in which two rounds of PCR were carried out to amplify two DNA fragments, F1 and F2 (F1, nucleotides 1-339; F2, nucleotides 412 to 462), of the 2B NSP gene with an overlap of 15 nucleotides. These fragments were combined in a subsequent fusion reaction in which the overlapping ends served as primers for the extension of complementary strands. The entire experiment was carried out as per the protocol developed by Urban et al. [27]. All of the PCRs were carried out using a KOD Hot Start DNA polymerase kit (Novagen, Germany). Subsequently the agarose gel purified 2B and D2B amplicons were ligated into the Bam HI and Hind III sites of bacterial expression vector pMAL-c5X (NEB, USA) to generate the recombinant plasmids pMAL-2B and pMALD2B. In these plasmids, the 2B and D2B genes were ligated in frame with the malE gene, which encodes the maltose binding protein (MBP). The ligated products were used to transform chemically competent E. coli JM109 cells (Promega, Madison, USA). The resultant recombinant clones were selected on ampicillin plates and screened by restriction enzyme digestion analysis. The nucleotide sequences of the inserts were confirmed using gene-specific primers in an ABI 3130 DNA automated sequencer (Applied Biosystems, CA, USA). Positive clones were subsequently subjected to protein expression screening. Purification and immunological characterisation of recombinant D2B NSP Expression and affinity purification of the recombinant MBP-D2B fusion protein was performed according to the manufacturer’s instructions (NEB, USA). Briefly, 25 ml of an overnight culture of a JM109 clone harbouring the MBP-D2B construct was inoculated into 250 ml of LB medium and grown at 37 °C until the optical density (O.D.) at 600 nm reached 0.6-0.7. Following addition of IPTG to a final concentration of 0.5 mM, the bacterial culture was incubated further at 28 °C for 5 hours. Bacterial cells were harvested by centrifugation at 4000 g for 20 minutes and then resuspended in 20 ml of column buffer (20 mM TrisCl [pH 7.4], 200 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol). The bacterial suspension was subjected to one freeze-thaw cycle and sonicated. The clarified supernatant was loaded onto a column containing amylase resin. The resin was washed four times with column buffer, and the fusion protein was eluted with column buffer containing 10 mM maltose. Fractions were collected, pooled, and
dialyzed against PBS. The purity of recombinant D2B NSP was assessed by SDS-PAGE [14]. The immunoreactivity of recombinant D2B protein was analysed by western blot using anti-MBP monoclonal antibody and rabbit antimouse HRP-conjugated secondary antibody. Differential reactivity of the recombinant NSP protein was also verified by western blot using FMDV-infected bovine serum (28 dpi) and naı¨ve serum diluted 1:100 in blocking buffer. Development of recombinant D2B I-ELISA During the development of the D2B I-ELISA, the concentrations of various components of the assay were optimised by the checkerboard titration method. Briefly, 96-well, flat-bottom polystyrene plates (Nunc, Roskilde, Denmark) were coated with recombinant purified MBPD2B protein diluted in carbonate-bicarbonate buffer and incubated at 4 °C overnight. The coated plates were washed four times with PBS and blocked with a buffer containing 10 g of fraction V bovine serum albumin, 15 g of glycine, and 40 g of sucrose in one litre of PBS. Serum samples were diluted (1:15 dilution) and pre-absorbed for one hour with purified MBP in a serum dilution buffer containing 10 g of BSA per litre of PBS. The D2B-NSPcoated ELISA plates were washed three times with PBS, and diluted serum (100 ll/well) was transferred to duplicate wells of the ELISA plate and incubated at 37 °C for one hour. The positive and negative sera were included as internal controls, while serum dilution buffer without any serum was included as conjugate control to determine any background activity. Subsequently, after washing, rabbit anti-cow immunoglobulin/HRP conjugate (DAKO, Denmark) diluted 1:2000 in dilution buffer was added and incubated for 1 hour. Finally, substrate solution containing o-phenylenediamine dihydrochloride (OPD)/H2O2 was added, and the reaction was stopped after 12 minutes of incubation by adding 1 M H2SO4. The optical density (OD) values were measured at 492 nm. The corrected mean OD values of the positive control (mODPOS), the negative control (mODNEG), and the test samples (mODsample) were determined after subtracting the mean OD value of the background control wells (mODBG). The OD for each test serum sample was expressed as a percentage of the positive control using the following formula: Percent of positive control (PP) = [mODsample] 9 100 / [mODPOS] Determination of the precision of D2B I-ELISA For the precision analysis, coefficients of variation (CVs) were calculated based on the PP values from intra-plate replicates (four replicates per sample), inter-plate replicates
123
J. K. Biswal et al. 2
Table 1 Estimate of the precision of the D2B I-ELISA based on a set of five serum samples
Mean PP
1
2
3
4
5
134.63
168.82
72.95
34.8
21.83
Intra-plate CV
2.87
3.91
12.12
6.29
11.11
Inter-plate CV Inter-day CV
2.4 2.07
5.07 2.06
4.71 1.529
7.97 11.17
8.4 7.727
Global CV
5.34
3.61
4.526
11.78
11.46
O.D at 600 nm
Serum sample*
1.8
WT 2B - IPTG
1.6
WT 2B + IPTG
1.4
Δ2B + IPTG
1.2 1 0.8 0.6 0.4 0.2 0
* 1 51 dpi serum sample from A IND 40/2000 intradermolingually infected calf; 2 serum sample collected from a FMDV infected bull at approximately two months post infection, 3 135 dpi serum sample from A IND 40/2000 contact infected calf; 4 serum sample from a calf at 21 dpv with a single dose of FMD monovalent vaccine, 5 serum sample from a naı¨ve calf used in a vaccine potency experiment CV: coefficient of variation
(three plates per day), and inter-day replicates (between five different days) of five selected serum samples (Table 1) in D2B I-ELISA. The precision estimation of the D2B I-ELISA was carried out as described by Jaworski et al. [11]. r3AB3 I-ELISA In order to determine the concordance between D2B I-ELISA and the in-house r3AB3 I-ELISA, a selected set of serum samples (n = 2500) were also tested by r3AB3 I-ELISA as described earlier [19]. Bioinformatics and statistical analysis The prediction of transmembrane helices of FMDV 2B protein was carried out using various methods, including DAS (http://www.sbc.su.se/*miklos/DAS), PHDtm (http://www.predictprotein.org/), TMHMM (http://www. cbs.dtu.dk/services/TMHMM), and TMpred (http://www. ch.embnet.org/software/TMPRED_form.htm). Estimation of the cutoff value and other assay parameters were performed by receiver operating characteristic (ROC) curve analysis using XLstat software (Addinsoft, http://www.xlstat.com/en/home/).
Results Cloning, expression, purification and immunoreactivity of MBP-D2B protein Even after cloning the full-length 2B gene in various expression vectors (pMAL-c5X, pQE30Xa, pET-45, pET28) and transformation of different E. coli host cells, it
123
0
30
60
90
120
150
180
210
Minutes post induction
Fig. 1 Cytotoxic activity of FMDV 2B protein in E. coli. The optical density at 600 nm of uninduced (diamonds), full-length 2B (squares) and D2B-expressing cultures (triangles) was determined at 30-minute intervals for 3.5 hours. The optical density of E. coli culture medium containing the full-length 2B protein was found to decrease significantly after induction
was not possible to express the recombinant 2B NSP (data not shown). Interestingly, the O.D of E. coli culture medium containing the expression vector (pMAL-2B) was found to drop significantly after induction (Fig. 1). However, D2B protein lacking its transmembrane domain (amino acid residues 114-137) could be cloned and expressed successfully, mostly in soluble form. SDSPAGE analysis revealed a protein band of approximately 60 kDa (Fig. 2), which corresponds to the calculated molecular weight of MBP-D2B NSP. The immunoreactivity of recombinant MBP-D2B was confirmed by western blotting with an MBP-tag-specific monoclonal antibody (Fig. 3a). Further, D2B protein readily reacted with 28 dpi bovine serum in western blot, whereas no visible reactivity was observed with naı¨ve serum (Fig. 3b and c). The purified recombinant D2B protein also showed differential immunoreactivity in I-ELISA with serum samples (n = 5) collected from experimentally infected calves and serum samples (n = 5) collected from naı¨ve calves, confirming the suitability of recombinant D2B protein as an ELISA antigen. Development of recombinant D2B I-ELISA For the standardisation of the I-ELISA protocol, the optimum concentration of recombinant antigen and test serum dilutions were fixed after conducting a checkerboard titration. The serum dilution was selected to attain an acceptable signal-to-noise ratio at the minimum concentration of recombinant antigen. The optimal coating antigen concentration and serum dilution were finalized at 0.350 lg per well of the ELISA plate and 1:15,
ELISA for detection of antibodies against FMDV 2B protein Fig. 2 SDS-PAGE profile of expressed D2B protein. Lane M, protein marker (NEB); lane 1, uninduced JM109 E. coli lysate; lane 2, IPTG-induced purified D2B protein; lane 3, IPTGinduced purified MBP
M
1
2
3
76 kDa
Induced Δ 2B protein (~60 kDa)
52 kDa
38 kDa
31 kDa
24 kDa
a
M
2
3
b
c 3
2
1
M
M
1
2
3
76kDa
55kDa
76kDa
55kDa 38kDa 38kDa 31kDa
31kDa
24kDa 24kDa 17kDa 17kDa 12kDa
Fig. 3 Western blot analysis of expressed D2B protein to determine its reactivity with (a) anti-MBP monoclonal antibody, (b) FMD-infected serum and (c) naı¨ve serum. Lane M, protein marker; lane 1, uninduced E. coli lysate; lane 2, purified MBP; lane 3, purified D2B protein
respectively (Fig. 4). To ensure the validity of the assay, the following criteria were chosen: (i) The corrected mean absorbance of the positive control should be between 1.0 to 1.4. (ii) The PP values of the negative and conjugate control should not exceed 20 % and 10 %, respectively
Determination of the cutoff value, diagnostic specificity, and sensitivity of recombinant D2B I-ELISA Normalised PP values of serum samples (n = 2091), consisting of samples from known naı¨ve (n = 196), uninfected
123
J. K. Biswal et al.
serum samples collected at random from FMD-CP areas with no history of an FMD outbreak for the last five years where animals underwent intensive biannual vaccination, the 2B antibody seroconversion rate was 6.08 % (19 out of 312 animals). In addition, in serum samples collected from various vaccine potency experiments at 21 dpv, only 2 out of the 60 primo-vaccinated animals (3.34 %) were found positive in D2B I-ELISA.
4 3.5
Optimal Δ2B antigen concentration and serum dilution
O.D. @492nm
3 2.5
P 1:5
2
P1:10 P1:15
1.5
P1:20
1
P1:30
Postinfection kinetics of 2B antibody response
0.5 0 22.4
11.2
5.6
2.8
1.4
0.7
0.35 0.175 0.087
Recombinant 2B antigen in µg/well
Fig. 4 Checkerboard titration to optimise D2B protein concentration and serum dilution. Twofold dilutions of positive control serum indicated by different markers are shown at one side of the plot
vaccinated (n = 516), and infected (n = 1379) animals, were used for the determination of the cutoff value of D2B I-ELISA by ROC and TG-ROC analysis (Fig. 5a and b). At a cutoff value of 50 PP, a diagnostic specificity of 94.6 % (95 % confidence interval, 93.4–96.6) and a diagnostic sensitivity of 95.3 % (95 % confidence interval, 90.9–96.9) were achieved. A detailed analysis of assay parameters at different cutoff values is shown in Table 2. Antibody response to 2B protein in vaccinated animals In an FMD-free dairy cattle herd that had undergone regular biannual vaccination, an antibody response to the 2B protein was detected in 15 out of 72 serum samples (20.83 %) at 28 dpv. However, this antibody response was of low titre and waned to 5.5 % (4 out of 72) at 180 dpv. In
AUC=0.973
Performance of D2B I-ELISA as compared to 3AB3 I-ELISA The in-house r3AB3 I-ELISA has been used extensively throughout the country for differentiation of the FMDVinfected from the vaccinated bovine population for the last four years [3]. Therefore, it was necessary to compare the newly developed D2B I-ELISA with that of the r3AB3 I-ELISA. For making this comparison, serum samples were selected arbitrarily, representing various epidemiological situations. The highest level of concordance was observed
b
1
1
0.9
0.9
0.8
0.8
Sensitivity / Specificity
True positive rate (Sensitivity)
a
The postinfection kinetics of the 2B antibody response was studied using four sets of serum samples collected sequentially from four bull calves following experimental infection. By 10 dpi, all four calves had seroconverted against D2B NSP (Fig. 6). However, the duration of persistence of the 2B antibody response varied widely among the infected calves. Consistent positivity was observed until 306 to 900 dpi in the individual calves, followed by a pattern of intermittent positivity varying from 530 to 1000 dpi (Fig. 6).
0.7 0.6 0.5 0.4 0.3 0.2
Sensitivity
Specificity
0.7 0.6 0.5 0.4 0.3 0.2 0.1
0.1
0
0 0
0.2
0.4
0.6
0.8
1
False negative rate (1 - Specificity)
Fig. 5 ROC and TG-ROC analysis for determination of the cutoff value of the D2B I-ELISA. (a) Sensitivity over 1 and specificity at different cutoff values. Each point on the ROC plot represents a pair
123
0
100
200
300
400
500
PP values
of sensitivity and specificity values for a particular cutoff value. (b) Curves of the relative sensitivity and specificity of D2B I-ELISA produced by TG-ROC analysis
ELISA for detection of antibodies against FMDV 2B protein Table 2 Diagnostic sensitivity and diagnostic specificity of the recombinant D2B I-ELISA at different cutoff points as determined by ROC analysis. The cutoff points are given as percentage of positivity. The selected cutoff point (50 PP) is highlighted Cutoff values
Sensitivity
95 % confidence interval
Specificity
Lower limit
Upper limit
95 % confidence interval Lower limit
Upper limit
LR?
LR-
10.0
1.000
0.993
1.000
0.054
0.031
0.091
1.057
0.000
20.0
0.999
0.991
1.000
0.286
0.233
0.347
1.399
0.005
30.0 40.1
0.997 0.983
0.989 0.970
1.000 0.991
0.564 0.788
0.501 0.732
0.625 0.835
2.289 4.646
0.005 0.021
50.0
0.953
0.934
0.966
0.946
0.909
0.969
17.658
0.050
60.0
0.771
0.739
0.800
0.967
0.934
0.984
23.225
0.237
70.1
0.589
0.553
0.625
0.975
0.945
0.990
23.674
0.421
80.2
0.453
0.416
0.489
0.988
0.962
0.997
36.352
0.554
90.1
0.370
0.336
0.406
0.992
0.968
1.000
44.598
0.635
100.2
0.306
0.273
0.341
0.992
0.968
1.000
36.857
0.700
LR? Likelihood-ratio for a positive test result; LR- Likelihood-ratio for a negative test result
Fig. 6 Postinfection kinetics of the anti-2B antibody response in experimentally infected calves. The infection status of each calf is indicated
160 Type A intradermolingual infection 140
Type A contact infection Type Asia 1 intradermolingual infection
120
Type Asia 1 contact infection
PP value
100
80
60
40
20
0 12
28
37
51
64
78
94 106 121 135 149 163 171 191 219 304 389 451 524 555 604 755 816 878 939 998
Days post infection
for naı¨ve serum samples (98.4 %), while the lowest level of concordance was observed for serum samples collected at random (84.48 %). The overall concordance between these two I-ELISAs was found to be 86.49 % (Table 3).
Discussion NSP ELISAs have become an essential part of the vaccination-based control and serosurveillance policy in many FMD-endemic countries. Furthermore, non-endemic countries are seriously debating in favour of vaccinating animals in order to obviate the need for stamping out susceptible in-contact animals under a ‘vaccinate-to-live’ policy [2]. In India, vaccination-based FMD-CP was launched in 2003-04 with the aim of creating disease-free
zones. In this context, it is imperative to have information on the level of FMDV exposure in domesticated large ruminants irrespective of vaccination status. For this purpose, national FMD serosurveillance is being carried out in India by determining seroconversion against 3AB3 NSP using an in-house r3AB3 I-ELISA [19]. However, as per the suggestions made at an international NSP test validation workshop at Brescia, Italy, there is a need to use more than one NSP assay to increase the efficiency of detection [22]. Further, when the epidemiological picture does not correlate with the screening test results, in particular because of vaccinal NSP response, it is important to establish the reliability of the screening test results through the profiling of multiple NSP antibodies in the serum samples [20]. Therefore, the availability of a locally produced efficient diagnostic assay making use of an NSP
123
J. K. Biswal et al. Table 3 Comparison of the performance of 2B I-ELISA with that of r3AB3 I-ELISA Sera
Total number tested
r2BL ELISA
3AB3 ELISA (no. concordance)
Positive
Positive
Negative
Concordance rate
Negative
Unvaccinated naı¨ve samples
130
2
128
130 (128)
98.4 % (128/130)
Vaccinated uninfected samples
240
18
222
15 (12)
225 (213)
93.75 % (225/240)
Samples from field outbreak
500
465
35
482 (440)
18 (10)
90.0 % (450/500)
2500
730
1770
605 (515)
1895 (1597)
84.48 % (2112/2500)
Random samples
other than 3AB3 could be a suitable alternative to the expensive kits available commercially. In that respect, an attempt was initially made to express the full-length 2B protein in prokaryotic cells. However, it was not possible to express the full-length 2B NSP. Interestingly, the optical density of the E. coli cells containing the prokaryotic expression vector pMAL-2B started to decline following induction with IPTG, which might be attributed to the cytotoxicity of the heterologous recombinant protein to E. coli. Similar observations have been reported for the expression of the 2B protein of poliovirus in prokaryotic cells [15], which were attributed to viroporin-mediated permeabilization of the cell membrane [1, 17]. Owing to the cytotoxic nature of the FMDV 2B protein to E. coli cells, the 2B NSP of FMD virus may be considered as a putative viroporin. However, further experimental analysis needs to be conducted in order to confirm the viroporin activity of FMDV 2B. A typical feature exhibited by viroporins is the presence of at least one transmembrane sequence. In the present study, a transmembrane domain was predicted between amino acid residues 114 and 137. It was decided to express the 2B region lacking the transmembrane domain. D2B could be expressed successfully as a recombinant MBP-tagged protein of *60 kDa (43 kDa from MBP and 16 kDa from 2B) in soluble form. In a western blot assay, the recombinant D2B demonstrated differential reactivity with FMD convalescent and naı¨ve serum. While developing and validating the MBP tagged recombinant D2B I-ELISA, attention was paid to reducing the nonspecific reactivity of the serum antibodies with the large MBP tag by pre-adsorbing the serum samples with the purified MBP protein, as described by others [13, 26]. However, the possibility of residual anti-MBP antibodies leading to some nonspecific reaction, as evidenced by the false-positive reactions with naı¨ve and vaccinated uninfected serum samples, cannot be ruled out completely. In serum samples from multiply vaccinated, uninfected animals, the 2B-antibody response declined from 20.83 % (at 28 dpv) to 5.5 % (at 180 dpv). Further, 6.08 % false positivity was observed in serum samples collected from FMDCP areas where there had been no reported outbreaks or cases for five years. This response could be explained
123
0
either by nonspecific binding or by the residual anti-NSP response from unreported past infections. At the fixed cutoff value of 50 PP, a sensitivity of 95.3 % and specificity of 94.3 % were determined for the D2B I-ELISA. Also, preliminary precision studies based on PP values from intra-plate, inter-plate and inter-day replicates showed the CV values to be within the acceptable limits, in support of the repeatability of the optimised assay (Table 1). The diagnostic sensitivity and diagnostic specificity of indirect r3AB3 I-ELISA for bovines were found to be 96 % and 96.4 %, respectively [19]. As the performance of the recently developed recombinant D2B I-ELISA is comparable to that of the r3AB3 I-ELISA, the D2B assay has the potential to be used as either a screening or confirmatory assay in conjunction with the r3AB3 I-ELISA. Further, it is also preferable to have the second test, which uses a different NSP, than the first test to confirm the presence of infection. This was shown in a study [23] in which, to confirm the FMD infection in sheep, a 2B-peptide-based indirect ELISA was used to confirm the result of the PrioCHECK-NSP assay. During the current analysis, a good overall concordance was observed between the 3AB3 and D2B I-ELISAs. Considering that there are no assays with absolute sensitivity and specificity, no surveillance plan can provide an absolute guarantee of freedom from infection. Therefore, serosurveillance should be seen as a part of a package of risk-mitigation measures that will include movement restriction, epidemiological tracing, and clinical surveillance [22]. The earliest possible detection of FMD post-exposure by anti-NSP antibody assay is of paramount importance for adopting control measures. However, there has been variation in the time at which early detection of antibodies against various NSPs is possible [25]. Although the precise time of onset of 2B antibodies could not be deduced in this study, seroconversion to 2B protein was evident at 10 dpi in the serum samples collected from four experimentally infected calves. While studying the post-infection kinetics of 2B antibodies in serum samples collected from four experimentally infected calves, a variation in the persistence of 2B antibodies was observed. This variation in antibody response could be attributed to a difference in the route of infection or load of virus challenge. Although the
ELISA for detection of antibodies against FMDV 2B protein
relationship between the persistence of 2B antibody and identification of known FMD carrier animals was not determined in the current study, from earlier findings of others [10, 21] it can be proposed that recombinant-D2BNSP-based I-ELISA could be used for the identification of persistently infected animals. Testing of random bovine serum samples collected from different parts of the country in D2B I-ELISA suggested an overall seroconversion rate of 29.2 %. The apparent prevalence of 2B NSP antibody estimated in the current work is similar to that against 3AB3 NSP (26.41 %), which was determined under the national FMD serosurveillance programme [3]. As the amino acid sequence of the 2B NSP region is known to be highly conserved among the different serotypes of FMDV [6], the recombinant 2B protein assay is expected to detect infection-specific antibodies against all seven serotypes of FMDV. At the same time, it should be emphasised that there is a significant difference between the 2B protein sequences of members of various genera of the family Picornaviridae [18]. Therefore, it could be presumed that there may be less chance of cross-reaction of FMDV 2B protein with antibodies against other related picornaviruses that cause clinically indistinguishable vesicular diseases in cattle. Although analytical specificity is an important parameter for any newly developed assay system, it could not be determined for D2B I-ELISA due to the unavailability of known serum samples derived from other clinically similar diseases because most of these diseases are exotic to India at present. In conclusion, an I-ELISA based on recombinant D2B NSP, which has been developed for the first time, could be used for the serological detection of FMDV circulation. A situation of controlled FMD incidence due to extensive vaccination is expected in India after a few years of successful FMD-CP. In that case, the use of more than one NSP ELISA would be helpful in increasing the efficiency of detection of infection. It would also be useful to evaluate the D2B NSP I-ELISA using serum samples from FMD-vaccinated and/or infected small ruminants and pigs in the future. Acknowledgement This work was supported by Indian Council of Agricultural Research under the project IXX08487. The assistance of Mr. N. S. Singh in sorting the serum samples is appreciated.
References 1. Agirre A, Barco A, Carrasco L, Nieva JL (2002) Viroporinmediated membrane permeabilization. Pore formation by nonstructural poliovirus 2B protein. J Biol Chem 277:40434–40441 2. Anonymous (2003) Council Directive 2003/85/EC on Community measures for the control of foot-and-mouth disease repealing Directive 85/511/EEC and Decisions 89/531/EEC and 96/665/ EEC and amending Directive 92/46/EEC. Off J Eur Union L 306:46
3. Anonymous (2012) PD-FMD annual report, 2011–12. In: Project Directorate on foot and mouth disease, Mukteswar 4. Berger HG, Straub OC, Ahl R, Tesar M, Marquardt O (1990) Identification of foot-and-mouth disease virus replication in vaccinated cattle by antibodies to non-structural virus proteins. Vaccine 8:213–216 5. Brocchi E, Bergmann IE, Dekker A, Paton DJ, Sammin DJ, Greiner M, Grazioli S, De Simone F, Yadin H, Haas B, Bulut N, Malirat V, Neitzert E, Goris N, Parida S, Sorensen K, De Clercq K (2006) Comparative evaluation of six ELISAs for the detection of antibodies to the non-structural proteins of foot-and-mouth disease virus. Vaccine 24:6966–6979 6. Carrillo C, Tulman ER, Delhon G, Lu Z, Carreno A, Vagnozzi A, Kutish GF, Rock DL (2005) Comparative genomics of foot-andmouth disease virus. J Virol 79:6487–6504 7. Clavijo A, Wright P, Kitching P (2004) Developments in diagnostic techniques for differentiating infection from vaccination in foot-and-mouth disease. Vet J 167:9–22 8. Hema M, Nagendrakumar SB, Yamini R, Chandran D, Rajendra L, Thiagarajan D, Parida S, Paton DJ, Srinivasan VA (2007) Chimeric tymovirus-like particles displaying foot-and-mouth disease virus non-structural protein epitopes and its use for detection of FMDV-NSP antibodies. Vaccine 25:4784–4794 9. Hohlich BJ, Wiesmuller KH, Schlapp T, Haas B, Pfaff E, Saalmuller A (2003) Identification of foot-and-mouth disease virusspecific linear B-cell epitopes to differentiate between infected and vaccinated cattle. J Virol 77:8633–8639 10. Inoue T, Parida S, Paton DJ, Linchongsubongkoch W, Mackay D, Oh Y, Aunpomma D, Gubbins S, Saeki T (2006) Development and evaluation of an indirect enzyme-linked immunosorbent assay for detection of foot-and-mouth disease virus nonstructural protein antibody using a chemically synthesized 2B peptide as antigen. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn Inc 18:545–552 11. Jaworski JP, Compaired D, Trotta M, Perez M, Trono K, Fondevila N (2011) Validation of an r3AB1-FMDV-NSP ELISA to distinguish between cattle infected and vaccinated with foot-andmouth disease virus. J Virol Methods 178:191–200 12. Kitching RP (2002) Identification of foot and mouth disease virus carrier and subclinically infected animals and differentiation from vaccinated animals. Revue Scientifique et Technique 21:531–538 13. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller D, McElwain T (1996) Antibody against an anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J Clin Microbiol 34:2225–2230 14. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685 15. Lama J, Carrasco L (1992) Expression of poliovirus nonstructural proteins in Escherichia coli cells. Modification of membrane permeability induced by 2B and 3A. J Biol Chem 267: 15932–15937 16. Ma LN, Zhang J, Chen HT, Zhou JH, Ding YZ, Liu YS (2011) An overview on ELISA techniques for FMD. Virol J 8:419 17. Madan V, Sanchez-Martinez S, Vedovato N, Rispoli G, Carrasco L, Nieva JL (2007) Plasma membrane-porating domain in poliovirus 2B protein. A short peptide mimics viroporin activity. J Mol Biol 374:951–964 18. Moffat K, Howell G, Knox C, Belsham GJ, Monaghan P, Ryan MD, Wileman T (2005) Effects of foot-and-mouth disease virus nonstructural proteins on the structure and function of the early secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport. J Virol 79:4382–4395 19. Mohapatra JK, Pandey LK, Sanyal A, Pattnaik B (2011) Recombinant non-structural polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bovines irrespective of vaccination. J Virol Methods 177:184–192
123
J. K. Biswal et al. 20. OIE (2004) Foot and mouth disease. In: OIE Standards Commission (ed). Manual of standards for diagnostic tests and vaccines, Office International des Epizooties (chapter 2.1.1), 5th edn. Paris, France 21. Parida S, Cox SJ, Reid SM, Hamblin P, Barnett PV, Inoue T, Anderson J, Paton DJ (2005) The application of new techniques to the improved detection of persistently infected cattle after vaccination and contact exposure to foot-and-mouth disease. Vaccine 23:5186–5195 22. Paton DJ, de Clercq K, Greiner M, Dekker A, Brocchi E, Bergmann I, Sammin DJ, Gubbins S, Parida S (2006) Application of non-structural protein antibody tests in substantiating freedom from foot-and-mouth disease virus infection after emergency vaccination of cattle. Vaccine 24:6503–6512 23. Paton DJ, Ferris NP, Hutchings GH, Li Y, Swabey K, Keel P, Hamblin P, King DP, Reid SM, Ebert K, Parida S, Savva S, Georgiou K, Kakoyiannis C (2009) Investigations into the cause of foot-and-mouth disease virus seropositive small ruminants in Cyprus during 2007. Transboundary Emerg Dis 56:321–328
123
24. Perkins J, Clavijo A, Hindson BJ, Lenhoff RJ, McBride MT (2006) Multiplexed detection of antibodies to nonstructural proteins of foot-and-mouth disease virus. Anal Chem 78:5462–5468 25. Sorensen KJ, Madsen KG, Madsen ES, Salt JS, Nqindi J, Mackay DK (1998) Differentiation of infection from vaccination in footand-mouth disease by the detection of antibodies to the nonstructural proteins 3D, 3AB and 3ABC in ELISA using antigens expressed in baculovirus. Arch Virol 143:1461–1476 26. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH, Suarez CE, McElwain TF (1998) Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J Clin Microbiol 36:777–782 27. Urban A, Neukirchen S, Jaeger KE (1997) A rapid and efficient method for site-directed mutagenesis using one-step overlap extension PCR. Nucl Acids Res 25:2227–2228
ORIGINAL ARTICLE
Detection of antibodies specific for foot-and-mouth disease virus infection using indirect ELISA based on recombinant nonstructural protein 2B Jitendra K. Biswal • Sarita Jena • Jajati K. Mohapatra Punam Bisht • Bramhadev Pattnaik
•
Received: 7 October 2013 / Accepted: 29 December 2013 Ó Springer-Verlag Wien 2014
Abstract Foot-and-mouth disease (FMD) is a highly contagious viral disease of transboundary importance. In India, since the launch of the FMD control programme, there has been a substantial increase in the vaccinated bovine population. In this scenario, there is a need for additional locally developed non-structural protein (NSP)based immnoassays for efficient identification of FMD virus (FMDV)-infected animals in the vaccinated population. The 2B NSP of FMDV, lacking the transmembrane domain (D2B), was expressed successfully in a prokaryotic system, and an indirect ELISA (I-ELISA) was developed and validated in this study. The diagnostic sensitivity and specificity of the D2B I-ELISA were found to be 95.3 % and 94.6 %, respectively. In experimentally infected cattle, the assay could consistently detect D2B-NSP-specific antibodies from 10 to approximately 400 days postinfection. The assay was further validated with bovine serum samples collected randomly from different parts of the country. The performance of the D2B I-ELISA was compared with the in-house r3AB3 I-ELISA, and the overall concordance in test results was found to be 86.49 %. The D2B I-ELISA could be useful as a screening or confirmatory assay in the surveillance of FMD irrespective of vaccination.
Introduction Foot-and-mouth disease is a highly contagious viral disease of both domesticated and wild ruminants as well as pigs.
J. K. Biswal S. Jena J. K. Mohapatra P. Bisht B. Pattnaik (&) Project Directorate on Foot-and-Mouth Disease (ICAR), Mukteswar, Nainital 263138, Uttarakhand, India e-mail: [email protected]
Owing to its contagiousness and potential for rapid spread among susceptible animals, the disease poses a serious threat to the international trade of animals and animal products. Culling of infected and in-contact animals is the favoured method of control of FMD in many parts of the world that are free from FMD. However, prophylactic biannual vaccination with extensive serosurveillance has been preferred over culling in India. Nevertheless, the strategy of vaccination has its own problems, and the most important one is that vaccinated animals may sometimes be infected with FMD virus (FMDV) with or without showing overt clinical signs [12]. Therefore, identification of FMDV-infected individuals among vaccinated animals is of utmost importance, especially in ruminants, which may act as carriers of the virus and can potentially become the source for new outbreaks. In this respect, it is imperative to develop highly sensitive and specific discriminatory assays to detect infection regardless of vaccination status. Detection of serum antibodies against FMDV nonstructural protein (NSP) in FMD-vaccinated and subsequently infected animals is used as a differential marker of infection, since vaccination with purified vaccine elicits antibodies only against the structural protein (SP) of FMDV [7]. A range of different ELISAs have been developed to detect antibodies against NSP of FMDV [16], and these assays have a further advantage over the conventional tests in that they are not serotype specific. However, the current NSP-based assays are not able to detect infection reliably in a vaccinated population [5]. During the validation of various NSP ELISAs in an international workshop at Brescia, Italy, it was found that none of the assays could provide a categorical assurance of detecting infection [5]. Therefore, it was suggested to use more than one NSP assay in order to enhance the overall sensitivity and specificity of determination of infection
123
J. K. Biswal et al.
status. Considering that recommendation, there is a need to produce a new NSP-based ELISA that can be used either as the screening or confirmatory method along with existing NSP tests or one that can be used in a multiple NSP-antigen-based assay [24] to enhance the confidence of detection of infection. Based on a series of experiments, Berger et al. [4] suggested to use NSP 2B along with other NSPs (2C, 3AB1 and/or 3C) for identification of FMDV replication in vaccinated cattle. Infection-related linear B-cell epitopes on the 2B NSP of FMDV have been mapped by analyzing synthetic peptides in an indirect ELISA [9]. Although the ELISA based on synthetic 2B peptides had shown some promising results [21] and was comparable to the Prio CHECK-NSP assay [10], these peptides were thought to be too expensive and poorly antigenic for use in ELISA [8]. Therefore, test systems based on recombinant NSP could be designed as a relatively cost-effective alternative. In this study, we report the expression in Escherichia coli of recombinant truncated 2B NSP lacking the transmembrane domain (D2B) and the development of a differential indirect ELISA (I-ELISA) for serosurveillance of FMD.
Materials and methods Serum samples Serum samples used in this study were collected either from cattle or buffalo, and the term ‘bovine’ in this manuscript implies both of them. Serum samples collected from naı¨ve, infected (both experimentally and naturally) and uninfected vaccinated animals were obtained from the serum repository maintained at Project Directorate on Foot and Mouth Disease (PDFMD), Mukteswar, India. This study complied with international standards for animal welfare. Serum samples from a naı¨ve bovine population A total of 196 serum samples collected from clinically healthy animals and found negative for anti-FMDV structural protein antibodies in liquid-phase blocking ELISA were used in this study. These samples included 131 serum samples derived from an unvaccinated, clinically healthy bovine population without any history of FMDV infection for at least 10 years, 60 serum samples collected at day ‘zero’ from cattle used in FMD vaccine potency studies, and five commercial healthy bovine sera. Serum samples from uninfected, vaccinated bovines Serum samples (n = 144, from 72 cattle) were collected from an FMD-free dairy cattle herd that was vaccinated
123
routinely at six-month intervals with a trivalent inactivated vaccine. These samples were collected at 28 and 180 days post-vaccination (dpv). Serum samples (n = 312) from FMD control programme (FMD-CP) areas without any report of FMD for the last five years were also included in the study. The majority of the adult bovines in the FMD-CP areas had received at least 8 rounds of prophylactic biannual vaccination. Samples (n = 60) were also collected at 21 dpv from cattle that were used in FMD vaccine potency studies. All of these 516 serum samples collected from vaccinated, uninfected animals along with the serum samples from naı¨ve bovines (n = 196) were used for the determination of the cutoff value and diagnostic specificity of D2B I-ELISA. Serum samples from infected bovines A total of 178 serum samples that were collected sequentially between 10 and 1000 days postinfection (dpi) from four unvaccinated bull calves were obtained from the serum repository of PDFMD. Two of them were inoculated intradermolingually with either FMDV A IND 40/2000 or Asia 1 IND 63/1972, while the other two calves were contact infected after being co-housed separately with each of the inoculated animals [19]. 120 out of these 178 serum samples (from 10-400 dpi) were used for the estimation of the cutoff value and diagnostic sensitivity of the D2B I-ELISA. Bovine serum samples (n = 1259) from clinical cases of FMD field outbreaks were also included in this study. These samples were collected at different time points during the outbreaks, ranging from the acute phase to nearly one year post-outbreak. Bovine serum samples collected at random Serum samples (n = 3500) that had been collected at random from different parts of the country were also analysed in D2B I-ELISA in order to determine the prevalence of 2B antibodies in bovines. Molecular cloning, expression and purification of recombinant 2B non-structural protein Construction of recombinant 2B gene expression vectors Total RNA was extracted using a QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) from baby hamster kidney cells (BHK-21) infected with FMDV isolate O IND R2/1975. The extracted RNA was reverse transcribed using oligo (dT)20 primer (Invitrogen, USA) and ThermoScriptTM reverse transcriptase enzyme (Invitrogen, USA). The full-length coding sequence of 2B NSP was amplified by PCR using upstream primer 2BF (GATCGGATCC
ELISA for detection of antibodies against FMDV 2B protein
CCCTTCTTCTTC), which has a BamHI site (bold and underlined), and downstream primer 2BR (GATCAAGCTTCTGTTTTTCTG), which has a HindIII site (bold and underlined). The 2B NSP gene without the sequence encoding the transmembrane region (D2B) was amplified by an overlap extension PCR (OEP) in which two rounds of PCR were carried out to amplify two DNA fragments, F1 and F2 (F1, nucleotides 1-339; F2, nucleotides 412 to 462), of the 2B NSP gene with an overlap of 15 nucleotides. These fragments were combined in a subsequent fusion reaction in which the overlapping ends served as primers for the extension of complementary strands. The entire experiment was carried out as per the protocol developed by Urban et al. [27]. All of the PCRs were carried out using a KOD Hot Start DNA polymerase kit (Novagen, Germany). Subsequently the agarose gel purified 2B and D2B amplicons were ligated into the Bam HI and Hind III sites of bacterial expression vector pMAL-c5X (NEB, USA) to generate the recombinant plasmids pMAL-2B and pMALD2B. In these plasmids, the 2B and D2B genes were ligated in frame with the malE gene, which encodes the maltose binding protein (MBP). The ligated products were used to transform chemically competent E. coli JM109 cells (Promega, Madison, USA). The resultant recombinant clones were selected on ampicillin plates and screened by restriction enzyme digestion analysis. The nucleotide sequences of the inserts were confirmed using gene-specific primers in an ABI 3130 DNA automated sequencer (Applied Biosystems, CA, USA). Positive clones were subsequently subjected to protein expression screening. Purification and immunological characterisation of recombinant D2B NSP Expression and affinity purification of the recombinant MBP-D2B fusion protein was performed according to the manufacturer’s instructions (NEB, USA). Briefly, 25 ml of an overnight culture of a JM109 clone harbouring the MBP-D2B construct was inoculated into 250 ml of LB medium and grown at 37 °C until the optical density (O.D.) at 600 nm reached 0.6-0.7. Following addition of IPTG to a final concentration of 0.5 mM, the bacterial culture was incubated further at 28 °C for 5 hours. Bacterial cells were harvested by centrifugation at 4000 g for 20 minutes and then resuspended in 20 ml of column buffer (20 mM TrisCl [pH 7.4], 200 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol). The bacterial suspension was subjected to one freeze-thaw cycle and sonicated. The clarified supernatant was loaded onto a column containing amylase resin. The resin was washed four times with column buffer, and the fusion protein was eluted with column buffer containing 10 mM maltose. Fractions were collected, pooled, and
dialyzed against PBS. The purity of recombinant D2B NSP was assessed by SDS-PAGE [14]. The immunoreactivity of recombinant D2B protein was analysed by western blot using anti-MBP monoclonal antibody and rabbit antimouse HRP-conjugated secondary antibody. Differential reactivity of the recombinant NSP protein was also verified by western blot using FMDV-infected bovine serum (28 dpi) and naı¨ve serum diluted 1:100 in blocking buffer. Development of recombinant D2B I-ELISA During the development of the D2B I-ELISA, the concentrations of various components of the assay were optimised by the checkerboard titration method. Briefly, 96-well, flat-bottom polystyrene plates (Nunc, Roskilde, Denmark) were coated with recombinant purified MBPD2B protein diluted in carbonate-bicarbonate buffer and incubated at 4 °C overnight. The coated plates were washed four times with PBS and blocked with a buffer containing 10 g of fraction V bovine serum albumin, 15 g of glycine, and 40 g of sucrose in one litre of PBS. Serum samples were diluted (1:15 dilution) and pre-absorbed for one hour with purified MBP in a serum dilution buffer containing 10 g of BSA per litre of PBS. The D2B-NSPcoated ELISA plates were washed three times with PBS, and diluted serum (100 ll/well) was transferred to duplicate wells of the ELISA plate and incubated at 37 °C for one hour. The positive and negative sera were included as internal controls, while serum dilution buffer without any serum was included as conjugate control to determine any background activity. Subsequently, after washing, rabbit anti-cow immunoglobulin/HRP conjugate (DAKO, Denmark) diluted 1:2000 in dilution buffer was added and incubated for 1 hour. Finally, substrate solution containing o-phenylenediamine dihydrochloride (OPD)/H2O2 was added, and the reaction was stopped after 12 minutes of incubation by adding 1 M H2SO4. The optical density (OD) values were measured at 492 nm. The corrected mean OD values of the positive control (mODPOS), the negative control (mODNEG), and the test samples (mODsample) were determined after subtracting the mean OD value of the background control wells (mODBG). The OD for each test serum sample was expressed as a percentage of the positive control using the following formula: Percent of positive control (PP) = [mODsample] 9 100 / [mODPOS] Determination of the precision of D2B I-ELISA For the precision analysis, coefficients of variation (CVs) were calculated based on the PP values from intra-plate replicates (four replicates per sample), inter-plate replicates
123
J. K. Biswal et al. 2
Table 1 Estimate of the precision of the D2B I-ELISA based on a set of five serum samples
Mean PP
1
2
3
4
5
134.63
168.82
72.95
34.8
21.83
Intra-plate CV
2.87
3.91
12.12
6.29
11.11
Inter-plate CV Inter-day CV
2.4 2.07
5.07 2.06
4.71 1.529
7.97 11.17
8.4 7.727
Global CV
5.34
3.61
4.526
11.78
11.46
O.D at 600 nm
Serum sample*
1.8
WT 2B - IPTG
1.6
WT 2B + IPTG
1.4
Δ2B + IPTG
1.2 1 0.8 0.6 0.4 0.2 0
* 1 51 dpi serum sample from A IND 40/2000 intradermolingually infected calf; 2 serum sample collected from a FMDV infected bull at approximately two months post infection, 3 135 dpi serum sample from A IND 40/2000 contact infected calf; 4 serum sample from a calf at 21 dpv with a single dose of FMD monovalent vaccine, 5 serum sample from a naı¨ve calf used in a vaccine potency experiment CV: coefficient of variation
(three plates per day), and inter-day replicates (between five different days) of five selected serum samples (Table 1) in D2B I-ELISA. The precision estimation of the D2B I-ELISA was carried out as described by Jaworski et al. [11]. r3AB3 I-ELISA In order to determine the concordance between D2B I-ELISA and the in-house r3AB3 I-ELISA, a selected set of serum samples (n = 2500) were also tested by r3AB3 I-ELISA as described earlier [19]. Bioinformatics and statistical analysis The prediction of transmembrane helices of FMDV 2B protein was carried out using various methods, including DAS (http://www.sbc.su.se/*miklos/DAS), PHDtm (http://www.predictprotein.org/), TMHMM (http://www. cbs.dtu.dk/services/TMHMM), and TMpred (http://www. ch.embnet.org/software/TMPRED_form.htm). Estimation of the cutoff value and other assay parameters were performed by receiver operating characteristic (ROC) curve analysis using XLstat software (Addinsoft, http://www.xlstat.com/en/home/).
Results Cloning, expression, purification and immunoreactivity of MBP-D2B protein Even after cloning the full-length 2B gene in various expression vectors (pMAL-c5X, pQE30Xa, pET-45, pET28) and transformation of different E. coli host cells, it
123
0
30
60
90
120
150
180
210
Minutes post induction
Fig. 1 Cytotoxic activity of FMDV 2B protein in E. coli. The optical density at 600 nm of uninduced (diamonds), full-length 2B (squares) and D2B-expressing cultures (triangles) was determined at 30-minute intervals for 3.5 hours. The optical density of E. coli culture medium containing the full-length 2B protein was found to decrease significantly after induction
was not possible to express the recombinant 2B NSP (data not shown). Interestingly, the O.D of E. coli culture medium containing the expression vector (pMAL-2B) was found to drop significantly after induction (Fig. 1). However, D2B protein lacking its transmembrane domain (amino acid residues 114-137) could be cloned and expressed successfully, mostly in soluble form. SDSPAGE analysis revealed a protein band of approximately 60 kDa (Fig. 2), which corresponds to the calculated molecular weight of MBP-D2B NSP. The immunoreactivity of recombinant MBP-D2B was confirmed by western blotting with an MBP-tag-specific monoclonal antibody (Fig. 3a). Further, D2B protein readily reacted with 28 dpi bovine serum in western blot, whereas no visible reactivity was observed with naı¨ve serum (Fig. 3b and c). The purified recombinant D2B protein also showed differential immunoreactivity in I-ELISA with serum samples (n = 5) collected from experimentally infected calves and serum samples (n = 5) collected from naı¨ve calves, confirming the suitability of recombinant D2B protein as an ELISA antigen. Development of recombinant D2B I-ELISA For the standardisation of the I-ELISA protocol, the optimum concentration of recombinant antigen and test serum dilutions were fixed after conducting a checkerboard titration. The serum dilution was selected to attain an acceptable signal-to-noise ratio at the minimum concentration of recombinant antigen. The optimal coating antigen concentration and serum dilution were finalized at 0.350 lg per well of the ELISA plate and 1:15,
ELISA for detection of antibodies against FMDV 2B protein Fig. 2 SDS-PAGE profile of expressed D2B protein. Lane M, protein marker (NEB); lane 1, uninduced JM109 E. coli lysate; lane 2, IPTG-induced purified D2B protein; lane 3, IPTGinduced purified MBP
M
1
2
3
76 kDa
Induced Δ 2B protein (~60 kDa)
52 kDa
38 kDa
31 kDa
24 kDa
a
M
2
3
b
c 3
2
1
M
M
1
2
3
76kDa
55kDa
76kDa
55kDa 38kDa 38kDa 31kDa
31kDa
24kDa 24kDa 17kDa 17kDa 12kDa
Fig. 3 Western blot analysis of expressed D2B protein to determine its reactivity with (a) anti-MBP monoclonal antibody, (b) FMD-infected serum and (c) naı¨ve serum. Lane M, protein marker; lane 1, uninduced E. coli lysate; lane 2, purified MBP; lane 3, purified D2B protein
respectively (Fig. 4). To ensure the validity of the assay, the following criteria were chosen: (i) The corrected mean absorbance of the positive control should be between 1.0 to 1.4. (ii) The PP values of the negative and conjugate control should not exceed 20 % and 10 %, respectively
Determination of the cutoff value, diagnostic specificity, and sensitivity of recombinant D2B I-ELISA Normalised PP values of serum samples (n = 2091), consisting of samples from known naı¨ve (n = 196), uninfected
123
J. K. Biswal et al.
serum samples collected at random from FMD-CP areas with no history of an FMD outbreak for the last five years where animals underwent intensive biannual vaccination, the 2B antibody seroconversion rate was 6.08 % (19 out of 312 animals). In addition, in serum samples collected from various vaccine potency experiments at 21 dpv, only 2 out of the 60 primo-vaccinated animals (3.34 %) were found positive in D2B I-ELISA.
4 3.5
Optimal Δ2B antigen concentration and serum dilution
O.D. @492nm
3 2.5
P 1:5
2
P1:10 P1:15
1.5
P1:20
1
P1:30
Postinfection kinetics of 2B antibody response
0.5 0 22.4
11.2
5.6
2.8
1.4
0.7
0.35 0.175 0.087
Recombinant 2B antigen in µg/well
Fig. 4 Checkerboard titration to optimise D2B protein concentration and serum dilution. Twofold dilutions of positive control serum indicated by different markers are shown at one side of the plot
vaccinated (n = 516), and infected (n = 1379) animals, were used for the determination of the cutoff value of D2B I-ELISA by ROC and TG-ROC analysis (Fig. 5a and b). At a cutoff value of 50 PP, a diagnostic specificity of 94.6 % (95 % confidence interval, 93.4–96.6) and a diagnostic sensitivity of 95.3 % (95 % confidence interval, 90.9–96.9) were achieved. A detailed analysis of assay parameters at different cutoff values is shown in Table 2. Antibody response to 2B protein in vaccinated animals In an FMD-free dairy cattle herd that had undergone regular biannual vaccination, an antibody response to the 2B protein was detected in 15 out of 72 serum samples (20.83 %) at 28 dpv. However, this antibody response was of low titre and waned to 5.5 % (4 out of 72) at 180 dpv. In
AUC=0.973
Performance of D2B I-ELISA as compared to 3AB3 I-ELISA The in-house r3AB3 I-ELISA has been used extensively throughout the country for differentiation of the FMDVinfected from the vaccinated bovine population for the last four years [3]. Therefore, it was necessary to compare the newly developed D2B I-ELISA with that of the r3AB3 I-ELISA. For making this comparison, serum samples were selected arbitrarily, representing various epidemiological situations. The highest level of concordance was observed
b
1
1
0.9
0.9
0.8
0.8
Sensitivity / Specificity
True positive rate (Sensitivity)
a
The postinfection kinetics of the 2B antibody response was studied using four sets of serum samples collected sequentially from four bull calves following experimental infection. By 10 dpi, all four calves had seroconverted against D2B NSP (Fig. 6). However, the duration of persistence of the 2B antibody response varied widely among the infected calves. Consistent positivity was observed until 306 to 900 dpi in the individual calves, followed by a pattern of intermittent positivity varying from 530 to 1000 dpi (Fig. 6).
0.7 0.6 0.5 0.4 0.3 0.2
Sensitivity
Specificity
0.7 0.6 0.5 0.4 0.3 0.2 0.1
0.1
0
0 0
0.2
0.4
0.6
0.8
1
False negative rate (1 - Specificity)
Fig. 5 ROC and TG-ROC analysis for determination of the cutoff value of the D2B I-ELISA. (a) Sensitivity over 1 and specificity at different cutoff values. Each point on the ROC plot represents a pair
123
0
100
200
300
400
500
PP values
of sensitivity and specificity values for a particular cutoff value. (b) Curves of the relative sensitivity and specificity of D2B I-ELISA produced by TG-ROC analysis
ELISA for detection of antibodies against FMDV 2B protein Table 2 Diagnostic sensitivity and diagnostic specificity of the recombinant D2B I-ELISA at different cutoff points as determined by ROC analysis. The cutoff points are given as percentage of positivity. The selected cutoff point (50 PP) is highlighted Cutoff values
Sensitivity
95 % confidence interval
Specificity
Lower limit
Upper limit
95 % confidence interval Lower limit
Upper limit
LR?
LR-
10.0
1.000
0.993
1.000
0.054
0.031
0.091
1.057
0.000
20.0
0.999
0.991
1.000
0.286
0.233
0.347
1.399
0.005
30.0 40.1
0.997 0.983
0.989 0.970
1.000 0.991
0.564 0.788
0.501 0.732
0.625 0.835
2.289 4.646
0.005 0.021
50.0
0.953
0.934
0.966
0.946
0.909
0.969
17.658
0.050
60.0
0.771
0.739
0.800
0.967
0.934
0.984
23.225
0.237
70.1
0.589
0.553
0.625
0.975
0.945
0.990
23.674
0.421
80.2
0.453
0.416
0.489
0.988
0.962
0.997
36.352
0.554
90.1
0.370
0.336
0.406
0.992
0.968
1.000
44.598
0.635
100.2
0.306
0.273
0.341
0.992
0.968
1.000
36.857
0.700
LR? Likelihood-ratio for a positive test result; LR- Likelihood-ratio for a negative test result
Fig. 6 Postinfection kinetics of the anti-2B antibody response in experimentally infected calves. The infection status of each calf is indicated
160 Type A intradermolingual infection 140
Type A contact infection Type Asia 1 intradermolingual infection
120
Type Asia 1 contact infection
PP value
100
80
60
40
20
0 12
28
37
51
64
78
94 106 121 135 149 163 171 191 219 304 389 451 524 555 604 755 816 878 939 998
Days post infection
for naı¨ve serum samples (98.4 %), while the lowest level of concordance was observed for serum samples collected at random (84.48 %). The overall concordance between these two I-ELISAs was found to be 86.49 % (Table 3).
Discussion NSP ELISAs have become an essential part of the vaccination-based control and serosurveillance policy in many FMD-endemic countries. Furthermore, non-endemic countries are seriously debating in favour of vaccinating animals in order to obviate the need for stamping out susceptible in-contact animals under a ‘vaccinate-to-live’ policy [2]. In India, vaccination-based FMD-CP was launched in 2003-04 with the aim of creating disease-free
zones. In this context, it is imperative to have information on the level of FMDV exposure in domesticated large ruminants irrespective of vaccination status. For this purpose, national FMD serosurveillance is being carried out in India by determining seroconversion against 3AB3 NSP using an in-house r3AB3 I-ELISA [19]. However, as per the suggestions made at an international NSP test validation workshop at Brescia, Italy, there is a need to use more than one NSP assay to increase the efficiency of detection [22]. Further, when the epidemiological picture does not correlate with the screening test results, in particular because of vaccinal NSP response, it is important to establish the reliability of the screening test results through the profiling of multiple NSP antibodies in the serum samples [20]. Therefore, the availability of a locally produced efficient diagnostic assay making use of an NSP
123
J. K. Biswal et al. Table 3 Comparison of the performance of 2B I-ELISA with that of r3AB3 I-ELISA Sera
Total number tested
r2BL ELISA
3AB3 ELISA (no. concordance)
Positive
Positive
Negative
Concordance rate
Negative
Unvaccinated naı¨ve samples
130
2
128
130 (128)
98.4 % (128/130)
Vaccinated uninfected samples
240
18
222
15 (12)
225 (213)
93.75 % (225/240)
Samples from field outbreak
500
465
35
482 (440)
18 (10)
90.0 % (450/500)
2500
730
1770
605 (515)
1895 (1597)
84.48 % (2112/2500)
Random samples
other than 3AB3 could be a suitable alternative to the expensive kits available commercially. In that respect, an attempt was initially made to express the full-length 2B protein in prokaryotic cells. However, it was not possible to express the full-length 2B NSP. Interestingly, the optical density of the E. coli cells containing the prokaryotic expression vector pMAL-2B started to decline following induction with IPTG, which might be attributed to the cytotoxicity of the heterologous recombinant protein to E. coli. Similar observations have been reported for the expression of the 2B protein of poliovirus in prokaryotic cells [15], which were attributed to viroporin-mediated permeabilization of the cell membrane [1, 17]. Owing to the cytotoxic nature of the FMDV 2B protein to E. coli cells, the 2B NSP of FMD virus may be considered as a putative viroporin. However, further experimental analysis needs to be conducted in order to confirm the viroporin activity of FMDV 2B. A typical feature exhibited by viroporins is the presence of at least one transmembrane sequence. In the present study, a transmembrane domain was predicted between amino acid residues 114 and 137. It was decided to express the 2B region lacking the transmembrane domain. D2B could be expressed successfully as a recombinant MBP-tagged protein of *60 kDa (43 kDa from MBP and 16 kDa from 2B) in soluble form. In a western blot assay, the recombinant D2B demonstrated differential reactivity with FMD convalescent and naı¨ve serum. While developing and validating the MBP tagged recombinant D2B I-ELISA, attention was paid to reducing the nonspecific reactivity of the serum antibodies with the large MBP tag by pre-adsorbing the serum samples with the purified MBP protein, as described by others [13, 26]. However, the possibility of residual anti-MBP antibodies leading to some nonspecific reaction, as evidenced by the false-positive reactions with naı¨ve and vaccinated uninfected serum samples, cannot be ruled out completely. In serum samples from multiply vaccinated, uninfected animals, the 2B-antibody response declined from 20.83 % (at 28 dpv) to 5.5 % (at 180 dpv). Further, 6.08 % false positivity was observed in serum samples collected from FMDCP areas where there had been no reported outbreaks or cases for five years. This response could be explained
123
0
either by nonspecific binding or by the residual anti-NSP response from unreported past infections. At the fixed cutoff value of 50 PP, a sensitivity of 95.3 % and specificity of 94.3 % were determined for the D2B I-ELISA. Also, preliminary precision studies based on PP values from intra-plate, inter-plate and inter-day replicates showed the CV values to be within the acceptable limits, in support of the repeatability of the optimised assay (Table 1). The diagnostic sensitivity and diagnostic specificity of indirect r3AB3 I-ELISA for bovines were found to be 96 % and 96.4 %, respectively [19]. As the performance of the recently developed recombinant D2B I-ELISA is comparable to that of the r3AB3 I-ELISA, the D2B assay has the potential to be used as either a screening or confirmatory assay in conjunction with the r3AB3 I-ELISA. Further, it is also preferable to have the second test, which uses a different NSP, than the first test to confirm the presence of infection. This was shown in a study [23] in which, to confirm the FMD infection in sheep, a 2B-peptide-based indirect ELISA was used to confirm the result of the PrioCHECK-NSP assay. During the current analysis, a good overall concordance was observed between the 3AB3 and D2B I-ELISAs. Considering that there are no assays with absolute sensitivity and specificity, no surveillance plan can provide an absolute guarantee of freedom from infection. Therefore, serosurveillance should be seen as a part of a package of risk-mitigation measures that will include movement restriction, epidemiological tracing, and clinical surveillance [22]. The earliest possible detection of FMD post-exposure by anti-NSP antibody assay is of paramount importance for adopting control measures. However, there has been variation in the time at which early detection of antibodies against various NSPs is possible [25]. Although the precise time of onset of 2B antibodies could not be deduced in this study, seroconversion to 2B protein was evident at 10 dpi in the serum samples collected from four experimentally infected calves. While studying the post-infection kinetics of 2B antibodies in serum samples collected from four experimentally infected calves, a variation in the persistence of 2B antibodies was observed. This variation in antibody response could be attributed to a difference in the route of infection or load of virus challenge. Although the
ELISA for detection of antibodies against FMDV 2B protein
relationship between the persistence of 2B antibody and identification of known FMD carrier animals was not determined in the current study, from earlier findings of others [10, 21] it can be proposed that recombinant-D2BNSP-based I-ELISA could be used for the identification of persistently infected animals. Testing of random bovine serum samples collected from different parts of the country in D2B I-ELISA suggested an overall seroconversion rate of 29.2 %. The apparent prevalence of 2B NSP antibody estimated in the current work is similar to that against 3AB3 NSP (26.41 %), which was determined under the national FMD serosurveillance programme [3]. As the amino acid sequence of the 2B NSP region is known to be highly conserved among the different serotypes of FMDV [6], the recombinant 2B protein assay is expected to detect infection-specific antibodies against all seven serotypes of FMDV. At the same time, it should be emphasised that there is a significant difference between the 2B protein sequences of members of various genera of the family Picornaviridae [18]. Therefore, it could be presumed that there may be less chance of cross-reaction of FMDV 2B protein with antibodies against other related picornaviruses that cause clinically indistinguishable vesicular diseases in cattle. Although analytical specificity is an important parameter for any newly developed assay system, it could not be determined for D2B I-ELISA due to the unavailability of known serum samples derived from other clinically similar diseases because most of these diseases are exotic to India at present. In conclusion, an I-ELISA based on recombinant D2B NSP, which has been developed for the first time, could be used for the serological detection of FMDV circulation. A situation of controlled FMD incidence due to extensive vaccination is expected in India after a few years of successful FMD-CP. In that case, the use of more than one NSP ELISA would be helpful in increasing the efficiency of detection of infection. It would also be useful to evaluate the D2B NSP I-ELISA using serum samples from FMD-vaccinated and/or infected small ruminants and pigs in the future. Acknowledgement This work was supported by Indian Council of Agricultural Research under the project IXX08487. The assistance of Mr. N. S. Singh in sorting the serum samples is appreciated.
References 1. Agirre A, Barco A, Carrasco L, Nieva JL (2002) Viroporinmediated membrane permeabilization. Pore formation by nonstructural poliovirus 2B protein. J Biol Chem 277:40434–40441 2. Anonymous (2003) Council Directive 2003/85/EC on Community measures for the control of foot-and-mouth disease repealing Directive 85/511/EEC and Decisions 89/531/EEC and 96/665/ EEC and amending Directive 92/46/EEC. Off J Eur Union L 306:46
3. Anonymous (2012) PD-FMD annual report, 2011–12. In: Project Directorate on foot and mouth disease, Mukteswar 4. Berger HG, Straub OC, Ahl R, Tesar M, Marquardt O (1990) Identification of foot-and-mouth disease virus replication in vaccinated cattle by antibodies to non-structural virus proteins. Vaccine 8:213–216 5. Brocchi E, Bergmann IE, Dekker A, Paton DJ, Sammin DJ, Greiner M, Grazioli S, De Simone F, Yadin H, Haas B, Bulut N, Malirat V, Neitzert E, Goris N, Parida S, Sorensen K, De Clercq K (2006) Comparative evaluation of six ELISAs for the detection of antibodies to the non-structural proteins of foot-and-mouth disease virus. Vaccine 24:6966–6979 6. Carrillo C, Tulman ER, Delhon G, Lu Z, Carreno A, Vagnozzi A, Kutish GF, Rock DL (2005) Comparative genomics of foot-andmouth disease virus. J Virol 79:6487–6504 7. Clavijo A, Wright P, Kitching P (2004) Developments in diagnostic techniques for differentiating infection from vaccination in foot-and-mouth disease. Vet J 167:9–22 8. Hema M, Nagendrakumar SB, Yamini R, Chandran D, Rajendra L, Thiagarajan D, Parida S, Paton DJ, Srinivasan VA (2007) Chimeric tymovirus-like particles displaying foot-and-mouth disease virus non-structural protein epitopes and its use for detection of FMDV-NSP antibodies. Vaccine 25:4784–4794 9. Hohlich BJ, Wiesmuller KH, Schlapp T, Haas B, Pfaff E, Saalmuller A (2003) Identification of foot-and-mouth disease virusspecific linear B-cell epitopes to differentiate between infected and vaccinated cattle. J Virol 77:8633–8639 10. Inoue T, Parida S, Paton DJ, Linchongsubongkoch W, Mackay D, Oh Y, Aunpomma D, Gubbins S, Saeki T (2006) Development and evaluation of an indirect enzyme-linked immunosorbent assay for detection of foot-and-mouth disease virus nonstructural protein antibody using a chemically synthesized 2B peptide as antigen. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn Inc 18:545–552 11. Jaworski JP, Compaired D, Trotta M, Perez M, Trono K, Fondevila N (2011) Validation of an r3AB1-FMDV-NSP ELISA to distinguish between cattle infected and vaccinated with foot-andmouth disease virus. J Virol Methods 178:191–200 12. Kitching RP (2002) Identification of foot and mouth disease virus carrier and subclinically infected animals and differentiation from vaccinated animals. Revue Scientifique et Technique 21:531–538 13. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller D, McElwain T (1996) Antibody against an anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J Clin Microbiol 34:2225–2230 14. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685 15. Lama J, Carrasco L (1992) Expression of poliovirus nonstructural proteins in Escherichia coli cells. Modification of membrane permeability induced by 2B and 3A. J Biol Chem 267: 15932–15937 16. Ma LN, Zhang J, Chen HT, Zhou JH, Ding YZ, Liu YS (2011) An overview on ELISA techniques for FMD. Virol J 8:419 17. Madan V, Sanchez-Martinez S, Vedovato N, Rispoli G, Carrasco L, Nieva JL (2007) Plasma membrane-porating domain in poliovirus 2B protein. A short peptide mimics viroporin activity. J Mol Biol 374:951–964 18. Moffat K, Howell G, Knox C, Belsham GJ, Monaghan P, Ryan MD, Wileman T (2005) Effects of foot-and-mouth disease virus nonstructural proteins on the structure and function of the early secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport. J Virol 79:4382–4395 19. Mohapatra JK, Pandey LK, Sanyal A, Pattnaik B (2011) Recombinant non-structural polyprotein 3AB-based serodiagnostic strategy for FMD surveillance in bovines irrespective of vaccination. J Virol Methods 177:184–192
123
J. K. Biswal et al. 20. OIE (2004) Foot and mouth disease. In: OIE Standards Commission (ed). Manual of standards for diagnostic tests and vaccines, Office International des Epizooties (chapter 2.1.1), 5th edn. Paris, France 21. Parida S, Cox SJ, Reid SM, Hamblin P, Barnett PV, Inoue T, Anderson J, Paton DJ (2005) The application of new techniques to the improved detection of persistently infected cattle after vaccination and contact exposure to foot-and-mouth disease. Vaccine 23:5186–5195 22. Paton DJ, de Clercq K, Greiner M, Dekker A, Brocchi E, Bergmann I, Sammin DJ, Gubbins S, Parida S (2006) Application of non-structural protein antibody tests in substantiating freedom from foot-and-mouth disease virus infection after emergency vaccination of cattle. Vaccine 24:6503–6512 23. Paton DJ, Ferris NP, Hutchings GH, Li Y, Swabey K, Keel P, Hamblin P, King DP, Reid SM, Ebert K, Parida S, Savva S, Georgiou K, Kakoyiannis C (2009) Investigations into the cause of foot-and-mouth disease virus seropositive small ruminants in Cyprus during 2007. Transboundary Emerg Dis 56:321–328
123
24. Perkins J, Clavijo A, Hindson BJ, Lenhoff RJ, McBride MT (2006) Multiplexed detection of antibodies to nonstructural proteins of foot-and-mouth disease virus. Anal Chem 78:5462–5468 25. Sorensen KJ, Madsen KG, Madsen ES, Salt JS, Nqindi J, Mackay DK (1998) Differentiation of infection from vaccination in footand-mouth disease by the detection of antibodies to the nonstructural proteins 3D, 3AB and 3ABC in ELISA using antigens expressed in baculovirus. Arch Virol 143:1461–1476 26. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH, Suarez CE, McElwain TF (1998) Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J Clin Microbiol 36:777–782 27. Urban A, Neukirchen S, Jaeger KE (1997) A rapid and efficient method for site-directed mutagenesis using one-step overlap extension PCR. Nucl Acids Res 25:2227–2228
