Detection, differentiation, and VP1 sequencing of duck hepatitis A virus type 1 and type 3 by a 1-step duplex reverse-transcription PCR assay X. J. Wen,*† A. C. Cheng,*†‡1 M. S. Wang,*†‡ R. y. Jia,*†‡ D. K. Zhu,†‡ S. Chen,*†‡ M. F. Liu,*†‡ F. Liu,† and X. y. Chen*
ABSTRACT Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotypespecific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1
gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV.
Key words: duck viral hepatitis, duck hepatitis A virus type 1, duck hepatitis A virus type 3, VP1, epidemic investigation 2014 Poultry Science 93:2184–2192 http://dx.doi.org/10.3382/ps.2014-04024
INTRODUCTION Duck viral hepatitis is an acute, highly contagious, and fatal disease of young ducklings, 1 to 28 d of age (Woolcock and Fabricant, 2003; Pattison, 2008). It can be caused by 3 heterologous serotypes of virus: duck hepatitis A virus (DHAV, formerly called DHV-1), duck astrovirus 1, and duck astrovirus 2 (Haider and Calnek, 1979; Gough et al., 1984; Wang et al., 2008; Todd et al., 2009). The most severe and widely distributed virus, DHAV, belongs to genus Avihepatovirus of the family Picornaviridae (Levine and Fabricant, 1950; Woolcock and Fabricant, 2003; King et al., 2011). Based on phylogenetic analyses, DHAV have been clas-
©2014 Poultry Science Association Inc. Received March 11, 2014. Accepted June 1, 2014. 1 Corresponding author: [email protected]
sified into 3 genotypes: DHAV type 1 (DHAV-1), type 2 (DHAV-2), and type 3 (DHAV-3; Tseng et al., 2007; Fu et al., 2008; Kim et al., 2008; Wang et al., 2008). Moreover, DHAV-2 and DHAV-3 are genetically and serologically different from DHAV-1 (Kim et al., 2007a; Tseng and Tsai, 2007). Duck hepatitis A virus type 1 and type 3 have caused serious damage to the duck industry in China and South Korea (Kim et al., 2007a; Fu et al., 2008; Liu et al., 2011; Wei et al., 2012; Xu et al., 2012). To date, several neutralization tests and molecular biological methods for detection of DHAV isolates have been described. Neutralization tests including indirect hemagglutination test (Taylor and Hanson, 1967), agar gel diffusion precipitation (Murty, 1961), and direct fluorescence-antibody technique (Vertinskiĭ et al., 1968; Maiboroda, 1972) have been used in virus identification for years. However, the tests are labor intensive and time consuming. Molecular biological methods can quickly and specially detect DHAV directly from sam-
2184
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
*Institute of Preventive Veterinary Medicine, and †Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Wenjiang, Chengdu city, Sichuan, 611130, P. R. China; and ‡Avian Disease Research Center, College of Veterinary Medicine, Sichuan Agricultural University, 46# Xinkang Road, Ya’an, Sichuan 625014, P. R. China
2185
DETECTION OF DUCK HEPATITIS A VIRUS
MATERIALS AND METHODS Viruses and Bacteria Two DHAV reference strains available in our laboratory, as well as 9 other avian viruses and bacteria used in this study, are listed in Table 1. The DHAV-1 strain H and DHAV-3 strain CH1 were as DHAV reference strains to develop the 1-step duplex RT-PCR assay. Other 9 avian pathogenic viruses and bacteria: duck plague virus strain (DPV), Pasteurella multocida, Muscovy duck parvovirus (MDPV), infectious laryngotracheitis virus (ILTV), Marek’s disease virus (MDV), Riemerella anatipestifer, Staphylococcus aureus, Escherichia coli, and Salmonella anatis were used to evaluate the specificity of the method developed in this study.
Nucleic Acid Isolation The RNA was isolated using the EZNA Viral RNA Kit (Omega Bio-Tek, Doraville, GA), according to the manufacturer’s recommendation. The DNA was extracted using a DNA extraction kit (TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s instructions. Isolated nucleic acids were eluted in 100 μL of RNase-free water (TaKaRa Biotechnology) and measured using an ND-1000 Spectrophotometer (Nanodrop Technologies, Wilmington, DE) at OD260 and OD280, before being used.
Birds Three-day-old Pekin ducklings were obtained from CHAOBA Duck Farm (Yaan, China) and determined to be free of DHAV-1 and DHAV-3 using neutralization tests (http://www.oie.int). The ducklings were housed in cages with a 12L:12D cycle and free access to food and water under controlled temperature (24 to 30°C) during the study. All ducklings were handled in compliance with the local animal welfare regulations and maintained according to standard protocols.
Design of 1-Step Duplex RT-PCR Primers The sequences for the primers developed in this study are listed in Table 2. The genotype-specific primers were designed based on all DHAV genome sequences retrieved from GenBank. Lyophilized primers were generated by Invitrogen Life Technologies (Invitrogen, Shanghai, China), resuspended in RNase-free water to a working concentration, and stored at −20°C.
Establishment of the 1-Step Duplex RT-PCR Assay The 1-step RT-PCR was performed in a 25-μL reaction volume containing 1 μL of viral RNA, 1 μL of each primer (5 pmol/mL) for DHAV-1, and 1 μL of each primer (10 pmol/mL) for DAHV-3, using the PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa Biotechnology) according to the manufacturer’s instructions. The 1-step duplex RT-PCR step was carried out at 50°C for 30 min followed by a denaturation step at 94°C for 2 min, and then 30 cycles of a denaturation step at 94°C for 30 s, an annealing step of 55°C for 30 s, and an extension step of 72°C for 1 min, with a final extension at 72°C for 10 min. The amplified products were analyzed by electrophoresis on a 1.5% (wt/vol) agarose Table 1. Viruses and bacteria used in this study1 Species
Source or reference
DHAV-1 strain H DHAV-3 strain CH1 DHAV-1 vaccine strain CH60 DHAV attenuated strain E80 Duck plague virus strain Infectious laryngotracheitis virus Muscovy duck parvovirus Marek’s disease virus Riemerella anatipestifer Staphylococcus aureus Escherichia coli Salmonella anatis Pasteurella multocida
KLADHHSP V201305 (CCTCC) V201248 (CCTCC) KLADHHSP V201209 (CCTCC) VR-783 (ATCC) AV238 (CVCC) VR-585 (ATCC) 11845 (ATCC) 6538 (ATCC) 83003 (CVCC) 50083 (CMCC) 12946 (ATCC)
1DHAV = duck hepatitis A virus (DHAV). CCTCC = China Center for Type Culture Collection (Wuhan, China); ATCC = American Type Culture Collection (Manassas, VA); CVCC = China Veterinary Culture Collection Center (Beijing, China); CMCC = National Center for Medical Culture Collections (Beijing, China); KLADHHSP = Key Laboratory of Animal Disease and Human Health of Sichuan Province.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
ples or from viral isolates, including reverse-transcription (RT) PCR assays (Kim et al., 2007b, 2008; Yang et al., 2008; Anchun et al., 2009; Huang et al., 2012; Chen et al., 2013) and RT loop-mediated isothermal amplification assays (Song et al., 2012; Li et al., 2014). However, ducklings vaccinated with DHAV can be detected from healthy ducklings vaccinated with live attenuated vaccines (Fu et al., 2012), and these methods cannot be used to detect the specimens that were vaccinated with live DHAV vaccines. Therefore, it would be of great clinical value to develop an assay that can be used for routine evaluation and monitoring of DHAV1 and DHAV-3 field isolates as an aid to improve the control of the circulation of DHAV. The major surface protein of picornavirus, VP1, plays important roles in viral pathogenesis and virulence, and its high diversity among isolates is probably linked to host adaptation (Mason et al., 2003; Fields et al., 2007; Kim et al., 2008). The coding sequence for the VP1 protein has been extensively used for antigenic characterization, phylogenetic analysis, and molecular epidemiology of Picornaviridae (Oberste et al., 1999; Shi et al., 2009; Perera et al., 2010; Cano-Gómez et al., 2011; Malirat et al., 2012). In this study, a genotypespecific 1-step duplex RT-PCR assay was developed for detection, differentiation, and VP1 sequencing of DHAV-1 and DHAV-3.
2186
Wen et al.
Table 2. Primers used for 1-step duplex reverse-transcription PCR Target virus1
Forward sequence (5′ to 3′)
Reverse sequence (5′ to 3′)
DHAV-1 DHAV-3
TCTGCCATTTACATCAACCAC GCTATATAACCTGGCATGTTGT
TGCCAACAACTAAGATAGGTC CCTCTCCATTGAGTGCAGA
1Duck
Expected product size (bp) 992 1,533
hepatitis A virus (DHAV) was typed on http://www.picornaviridae.com/.
Detection of DHAV-1 and DHAV-3 in Clinical Samples
Specificity of the 1-Step Duplex RT-PCR
A total of 26 specimens collected from duck flocks in different regions of China between 1996 and 2013, as well as 2 specimens collected from flocks that had been vaccinated for live attenuated strains, were detected by the assay established above. The liver samples used in this study were homogenized in PBS (10% wt/vol), and these suspensions were clarified by centrifugation (8,000 × g at room temperature for 20 min). Total RNA from field cases was isolated from 200 μL of supernatant of 10% tissue homogenates as appropriate using the EZNA Viral RNA Kit, according to the manufacturer’s recommendation. The VP1 sequences obtained in this study (Table 3) were compared with 28 other representative DHAV sequences (Table 4) downloaded from GenBank. The maximum-likelihood phylogenetic tree of these nucleotide sequences was constructed from by MEGA 6.0 (Tamura et al., 2013) with 1,000 bootstrap replicates.
Specificity of the 1-step duplex RT-PCR was evaluated with nucleic acids extracted from 2 DHAV reference strains and 9 other infectious viruses and bacteria: DPV, P. multocida, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, E. coli, and S. anatis. Simultaneously, RNA extracted from a healthy duckling liver sample served as a negative control.
Sensitivity of the 1-Step Duplex RT-PCR To evaluate the sensitivity of the duplex RT-PCR, 10-fold serial dilutions of RNA templates of DHAV1 strain H, DHAV-3 strain CH1, and a mixture of 2 strains were tested by the optimized 1-step duplex RTPCR to determine their sensitivity. Individual DHAV-1 and DHAV-3 were diluted from 1 ng to 0.1 pg, respectively. Simultaneously, a mixture of 2 μL of 1 ng/μL to 0.1 pg/μL of DHAV-1 and DHAV-3 was detected by the duplex RT-PCR.
Detection of DHAV-1 and DHAV-3 in Experimentally Infected Ducklings Sixty 3-d-old Pekin ducklings, which were free of DHAV-1 and DHAV-3, were divided into 5 experimental groups (10 ducklings per group) and 1 control group (10 ducklings). Ducklings in experimental groups were subcutaneously inoculated with 0.2 mL of DHAV-1 attenuated vaccine strain CH60 (group 1), DHAV-1 strain H (group 2), DHAV-3 strain CH1 (group 3), a mixture of DHAV-1 strain H and DHAV-3 strain CH1 (group 4), and a mixture of these 3 strains (group 5), respectively. The virus titers were determined as 106.5 embryo lethal median dose per 0.2 mL, and viruses were stored at −80°C until use. Ducklings in the control group were injected with the same volume of sterile PBS (10% wt/ vol). All ducklings were separated in different incubators, following strict biosafety controls, and were monitored for 10 d to determine pathogenicity. After death or euthanization with sodium pentobarbital, all ducklings were dissected to collect liver samples. Isolated RNA of these samples was detected directly by the 1-step duplex RT-PCR assay, and the PCR products were sent to Invitrogen Life Technologies (Invitrogen, Shanghai, China) for sequencing. These experiments have been replicated.
RESULTS Specificity of the 1-Step Duplex RT-PCR Assay Primer pair specificity for DHAV-1 and DHAV-3 was analyzed initially by single PCR; these 2 genotype-specific primer pairs produced a single PCR product with an expected product size (data not shown). Nucleic acids extracted from 2 DHAV reference strains, as well as 9 other pathogenic viruses and bacteria (Figure 1), were used to determine the specificity of the 1-step duplex RT-PCR assay. The 1-step duplex RT-PCR amplified a PCR fragment of 992 bp from DHAV-1, a PCR fragment of 1,533 bp from DHAV-3, and 2 PCR fragments of 992 and 1,533 bp from a mixture templates of DHAV-1 and DHAV-3. No specific PCR amplification occurred from the nucleic acids of 9 other pathogenic viruses and bacteria: DPV, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, P. multocida, E. coli, and S. anatis, and RNA extracted from healthy ducklings.
Sensitivity of the 1-Step Duplex RT-PCR Assay The sensitivity of the 1-step duplex RT-PCR assay was evaluated using RNA of reference viruses. The detection limit of the duplex RT-PCR was estimated to
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
gel containing GoldView (Beijing Solarbio Science and Technology, Beijing, China).
2187
DETECTION OF DUCK HEPATITIS A VIRUS Table 3. Clinical liver samples Origin
Accession number
Genotype1
Field isolate, BZ03 Field isolate, BZB Field isolate, CD131231 Field isolate, CH12 Attenuated vaccine strain, CH603 Field isolate, CZ130927 Field isolate, DG Field isolate, DY Field isolate, DY130804 Attenuated strain, E803 Field isolate, FJ Field isolate, GX09 Field isolate, HB Field isolate, HB131216 Field isolate, JS04 Field isolate, LY01 Field isolate, MY120414 Field isolate, MY121201 Field isolate, MY02 Field isolate, QL1312 Field isolate, QL120310 Field isolate, SD1207 Field isolate, WF07 Field isolate, WZ Field isolate, WZ12 Field isolate, XZ05 Field isolate, XZ130930 Field isolate, ZJ06
China/Shandong/201103 China/Shandong/201102 China/Sichuan/20131231 China/Shandong/201207 China China/Sichuan/20130927 China/Liaoning/201012 China/Sichuan/199008 China/Sichuan/20130804 China China/Fujian/201108 China/Guangxi/201009 China/Haerbing/199605 China/Hubei/20131216 China/Jiangshu/201005 China/Shandong/201101 China/Sichuan/20120414 China/Sichuan/20121201 China/Sichuan/200002 China/Sichuan/201312 China/Sichuan/20120310 China/Shandong/201207 China/Shandong/201007 China/Zhejiang/201108 China/Zhejiang/201112 China/Jiangshu/201005 China/Shandong/20130930 China/Zhejiang/201103
KJ461977 KJ461978 KJ461979 KJ461980 KJ461981 KJ461982 KJ461983 KJ461984 KJ461985 KJ461986 KJ461987 KJ461988 KJ461989 KJ461990 KJ461991 KJ461992 KJ461993 KJ461994 KJ461995 KJ461996 KJ461997 KJ461998 KJ461999 KJ462000 KJ462001 KJ462002 KJ462003 KJ462004
DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1
VP1 (bp) 714 714 711 720 714 711 714 714 711 714 714 714 714 720 714 714 714 714 720 711 714 714 714 714 714 714 720 714
1DHAV
= duck hepatitis A virus. used as reference strain for development of the reverse-transcription PCR assay and sensitivity test. 3Liver samples collected from healthy ducklings infected with live attenuated strain. 2Virus
Table 4. Reference duck hepatitis A virus (DHAV) trains used for comparison in this study Genotype1
Strain
Accession number
Origin
Reference
DHAV-1 DHAV-2 DHAV-3
Mild strain, A66 Moderate virulent strain, R Attenuated strain, ZJ-A Attenuated strain, MY Attenuated vaccine strain, C80 Attenuated vaccine strain, SH Attenuated vaccine strain, ZJ-A2 Attenuated vaccine strain, X Attenuated vaccine strain, AV2111 Attenuated vaccine strain, H Virulent strain, 5886 Virulent strain, 03D Virulent strain, DRL-62 Virulent strain, R85952 Virulent strain, JX Virulent strain, HS Virulent strain, HSS Virulent strain, FJ1220 (pigeon) Virulent strain, ZJ Virulent strain, 09D Virulent strain, 04G Virulent strain, AP-03337 Virulent strain, AP-04009 Virulent strain, AP-04203 Virulent strain, AP-04114 Virulent strain, D11-JW-018 Virulent strain, JT (goose) Virulent strain, B-N
DQ886445 EF585200 EF442072 GU944671 DQ864514 EF502171 EF502172 FJ496343 EU395440 DQ249300 DQ249301 DQ249299 DQ219396 DQ226541 EF093502 DQ812094 DQ812092 KC904272 EF382778 EF067924 EF067923 DQ256132 DQ256133 DQ256134 DQ812093 JX312194 JF835025 JX235698
China China China China China China China China China UK America Taiwan ATCC ATCC China South Korea South Korea China China Taiwan Taiwan South Korea South Korea South Korea South Korea South Korea China China
Luo et al., 2008 Luo et al., 2008 Liu et al., 2008 Wang et al., 2012 Ding and Zhang, 2007 Liu et al., 2008 Liu et al., 2008 Gao et al., 2012 Ma et al., 2009 Tseng et al., 2007 Tseng et al., 2007 Tseng et al., 2007 Kim et al., 2008 Kim et al., 2008 Jin et al., 2008 Kim et al., 2007a Kim et al., 2007a Shi et al., 2013 Liu et al., 2008 Tseng and Tsai, 2007 Tseng and Tsai, 2007 Kim et al., 2007a Kim et al., 2007a Kim et al., 2007a Kim et al., 2007a Cha et al., 2013 Liu et al., 2011 Wei et al., 2012
1Genotypes
of these DHAV strains are published on the website http://www.picornaviridae.com/.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Strain
2188
Wen et al.
be 10 pg of total RNA templates of DHAV-1 or DHAV3 or both (Figure 2).
Detection of DHAV-1 and DHAV-3 in Experimentally Infected Ducklings The DHAV-1 and DHAV-3 were successfully used to experimentally infect ducklings in this study. Clinical symptoms of the ducklings in groups 2 to 5 were first observed at 24 h postinfection, and the ducklings in groups 2 to 5 began to die at 24 h postinfection, with pathological changes typical of duck hepatitis. At 96 h postinfection, all ducklings in group 2 to 5 died. In contrast, no clinical signs or mortality were observed in ducklings of group 1 and the control group. After death or euthanization, the liver samples of all ducklings were detected by the 1-step duplex RT-PCR assay. The results showed that DHAV-1 could be detected in all the
samples of groups 1 and 2, DHAV-3 could be detected in all the samples of group 3, and these 2 viruses could be detected in all the samples of groups 4 and 5. However, DHAV-1 and DHAV-3 were not detected in any of the samples of the control group. In addition, DHAV was detected in the feces and serum of the ducklings of groups 1 to 5, which was consistent with those test results of the liver samples (data not shown). The sequencing results were in accordance with the known VP1 gene of DHAV-1 strain CH60 (group 1), H (group 2 and 4), and DHAV-3 strain CH1 (groups 3, 4, and 5). Meaningfully, many sequencing peaks appeared for the 992-bp fragment of group 5, suggesting the presence of different DHAV-1 strain amplification. After cloning the RT-PCR product into vector, plasmid DNA was purified from the separated insert-positive clones and sent to Invitrogen Life Technologies (Invitrogen, Shanghai, China) for sequencing. The result showed
Figure 2. Sensitivity of the 1-step duplex RT-PCR assay. The sensitivity of the 1-step duplex reverse-transcription (RT) PCR assay was evaluated using RNA of duck hepatitis A virus (DHAV)-1 strain H and DHAV-3 strain CH1. Individual DHAV-1 and DHAV-3 were diluted from 1 ng to 0.1 pg, respectively. Simultaneously, a mixture of 2 μL of 1 ng/μL to 0.1 pg/μL of DHAV-1 and DHAV-3 was detected by the duplex RT-PCR. The detection limit of the duplex RT-PCR was estimated to be 10 pg of total RNA templates of DHAV-1, DHAV-3, or a mixture of them. Lanes M, DL2000 DNA marker; lanes 1 to 5: the 1-step duplex RT-PCR amplification of RNA prepared from 10-fold serial dilutions ranging from 1 ng to 0.1 pg of total RNA of a mixture of DHAV-1 and DHAV-3; lanes 6 to 10: the 1-step duplex RT-PCR amplification of RNA prepared from 10fold serial dilutions ranging from 1 ng to 0.1 pg total RNA of DHAV-1; lanes 11 to 15: the 1-step duplex RT-PCR amplification of RNA prepared from 10-fold serial dilutions ranging from 1 ng to 0.1 pg of total RNA of DHAV-3.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Figure 1. Specificity of the 1-step duplex reverse-transcription (RT) PCR assay. The specificity of the 1-step duplex RT-PCR was determined using viral RNA extracted from 2 duck hepatitis A virus (DHAV) reference strains, and nucleic acids extracted from 9 other avian pathogenic viruses and bacteria: duck plague virus strain (DPV), Pasteurella multocida, Muscovy duck parvovirus (MDPV), infectious laryngotracheitis virus (ILTV), Marek’s disease virus (MDV), Riemerella anatipestifer, Staphylococcus aureus, Escherichia coli, and Salmonella anatis. Lane M, DL2000 DNA marker; lane 1, DHAV-1 strain H; lane 2, DHAV-3 strain CH1; lane 3, a mixture of DHAV-1 and DHAV-3; line 4, RNA extracted from healthy ducklings; lane 5, DPV; lane 6, MDPV; lane 7, ILTV; lane 8, MDV; lane 9, R. anatipestifer; lane 10, S. aureus; lane 11, P. multocida; lane 12, E. coli; lane 13, S. anatis. The 1-step duplex RT-PCR amplified a PCR fragment of 992 bp from DHAV-1, a PCR fragment of 1,533 bp from DHAV-3, and 2 PCR fragments of 992 and 1,533 bp from mixture templates of DHAV-1 and DHAV-3. No specific PCR amplification occurred from the nucleic acids of 9 other pathogenic viruses and bacteria: DPV, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, P. multocida, E. coli, and S. anatis, and RNA extracted from healthy ducklings.
DETECTION OF DUCK HEPATITIS A VIRUS
that it was a mixed infection of DHAV-1 strains H and CH60. In this way it could identify the multiple genotypes of DHAV circulating within infected birds, especially for vaccinated ones.
Detection of DHAV-1 and DHAV-3 in Clinical Samples
DISCUSSION To date, prevention of DHAV is mostly based on the use of live attenuated vaccines (Rispens, 1969; Crighton and Woolcock, 1978; Kim et al., 2009; Chen et al., 2014) or inoculation of antibodies in chicken egg yolk (http://www.oie.int). However, live attenuated vaccines could shed from vaccinated individuals, which sometimes presents a risk to unvaccinated individuals with impaired immunity. Duck viral hepatitis has occurred in many duck flocks that were already vaccinated with live attenuated vaccine. Variation of virulence of DHAV
isolates may be responsible for immune failure (Davis, 1987; Lauring et al., 2010). Therefore, it would be of great clinical value to develop a assay for epidemic investigation of DHAV-1 and DHAV-3 concerning DHAV management (Jin et al., 2008; Cha et al., 2013). It has been shown that genetic diversity at VP1 of DHAV is closely associated with the difference in viral serotypes, and can be used as a target for genotyping of DHAV (Wang et al., 2008). Furthermore, VP1 of DHAV may play important roles in animal vaccination, evolution, and virulence (Jin et al., 2008; Liu et al., 2008, 2010; Li et al., 2013a) and can be used to monitor of DHAV to follow local trends of DHAV infection (Li et al., 2013b). In this study, we developed a genotype-specific 1-step duplex RT-PCR assay that can intuitively distinguish DHAV-1 and DHAV-3 according to size by electrophoresis, and can be used to amplify and sequence the fragments encompassing the VP1 gene of DHAV-1 and DHAV-3. This assay was confirmed to be specific with no specific PCR amplification occurring from the nucleic acids of 9 other pathogenic viruses and bacteria. The detection limit of the 1-step duplex RT-PCR was estimated to be 10 pg for DHAV-1 or DHAV-3 or both. The assay was evaluated in experimentally infected ducklings, and results showed that DHAV-1 could be detected from the liver and serum of ducklings vaccinated with live attenuated vaccine, and different nucleic acid base pairs presented in VP1 of DHAV-1 have utility for distinguishing wild type and vaccine strains. The 1-step duplex RT-PCR assay was performed on liver samples collected from different duck flocks in different regions of China. A total of 26 DHAV field isolates from different commercial farms were detected. Among the 26 isolates, 22 grouped into the DHAV-1 genotype, and 4 grouped into the DHAV-3 genotype. Although co-infections of DHAV-1 and DHAV-3 have been found in some areas of China (Ding and Zhang, 2007; Fu et al., 2008; Jin et al., 2008; Liu et al., 2008; Gao et al., 2012; Xu et al., 2012), we did not find any mixed infection of DHAV in clinical samples. The result suggests that DHAV-1 is still the most prevalent serotype in China, and co-infections of DHAV types are only common in some farms or areas. Phylogenetic analysis on the basis of these VP1 sequences suggested that there might exist a main genetic group of DHAV-1 distributed in China. Significantly, the VP1 sequences of 4 field isolates recently obtained from flocks in Sichuan province of China are 711 bp long and coded 238 amino acids. Although several RT-RCR methods have been developed for detection of DHAV-1 and DHAV-3, these methods cannot be used to detect the specimens that were vaccinated with live DHAV vaccines. The assay developed in this study could differentially diagnose between DHAV wild type and vaccine strains by sequencing the VP1 gene. Therefore, this method can be used to make disease diagnosis in ducklings that have been vaccinated, and also can be used for epidemiological investigations of DHAV-1 and DHAV-3 in China.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Using the 1-step duplex RT-PCR assay, a total of 26 DHAV field isolates from different commercial farms and 2 DHAV live attenuated strains were detected. The results confirmed the presence of DHAV in all of the clinical samples. Twenty-two flocks were identified as having infection with DHAV-1 only, 4 flocks had infection with DHAV-3 only, and no flocks were detected as having mixed infection with DHAV-1 and DHAV3. The actual size of the PCR product varied slightly. The VP1 sequences obtained in this study were 714 (18 DHAV-1 isolates), 711 (4 DHAV-1 isolates), or 720 (4 DHAV-3 isolates) bp long. Interestingly, the VP1 gene of 4 DHAV-1 field isolates, which were recently obtained from flocks in Sichuan province of China, is 711 bp long, and ducklings were not protected by administration of serum from DHAV-1-immune ducks. The sequences obtained in this study were compared with 28 other DHAV sequence data available in GenBank. The maximum-likelihood phylogenetic tree of these VP1 gene sequences is presented in Figure 3. Consistent with DHAV genotypes, these VP1 sequences clustered into 3 major groups: DHAV-1, DHAV-2, and DHAV-3. Moreover, VP1 gene sequences of 22 DHAV-1 field isolates were clustered into 3 major genetic groups: clade 1, clade 2, and clade 3. The DHAV-1 strains in clade 1 did not display significant geographical correlation, and were widely distributed in China. In contrast, clade 3 only included 4 virulent isolates recently isolated from duck flocks in Sichuan province of China and 1 virulent strain (FJ1220) isolated from a dead pigeon in eastern China. The majority of strains in clade 2 were live attenuated strains, but 2 virulent strain JX and HB were clustered in this clade. The VP1 sequences of DHAV-3 clustered into 2 major clades: clade 1 and clade 2. They displayed significant geographical correlation. Viral strains in clade 1 were isolated outside China, and 4 DHAV-3 field isolates obtained in this study were clustered into another clade.
2189
2190
Wen et al.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Figure 3. Phylogenetic tree of 56 duck hepatitis A virus (DHAV) VP1 gene. The VP1 sequences of 28 DHAV field isolates obtained in this study were compared with 28 other DHAV sequence data available in GenBank. This tree was generated by the maximum-likelihood algorithm with MEGA 6.0 (Tamura et al., 2013) based on alignment of VP1 gene nucleotide sequences. The reliability of the tree was assessed by bootstrap analysis with 1,000 replicates; numbers at nodes indicate neighboring joining bootstrap values and only bootstrap values ≥80% are shown. Scale bars signify a genetic distance of 0.05 nucleotide substitutions per site. A closed triangle (▲) indicates the strains obtained by the 1-step duplex reverse-transcription PCR assay, an open triangle (△) indicates the live attended virus, and an open circle (○) indicates moderate or low pathogenic virulent strains. Consistent with DHAV genotypes, these VP1 sequences clustered into 3 major groups: DHAV-1, DHAV-2, and DHAV-3. Based on the distribution of branches in phylogenetic trees, VP1 gene sequences of DHAV-1 sequences clustered into 3 major genetic groups: clade 1, clade 2, and clade 3, and DHAV-3 sequences clustered into 2 major clades: clade 1 and clade 2.
DETECTION OF DUCK HEPATITIS A VIRUS
In summary, the assay that established in this study could be applied as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV.
ACKNOWLEDGMENTS
REFERENCES Anchun, C., W. Mingshu, X. Hongyi, Z. Dekang, L. Xinran, C. Haijuen, J. Renyong, and Y. Miao. 2009. Development and application of a reverse transcriptase polymerase chain reaction to detect Chinese isolates of duck hepatitis virus type 1. J. Microbiol. Methods 77:332–336. Cano-Gómez, C., F. Palero, M. D. Buitrago, M. A. García-Casado, J. Fernández-Pinero, P. Fernández-Pacheco, M. Agüero, C. Gómez-Tejedor, and M. Á. Jiménez-Clavero. 2011. Analyzing the genetic diversity of teschoviruses in Spanish pig populations using complete VP1 sequences. Infect. Genet. Evol. 11:2144–2150. Cha, S.-Y., J.-H. Roh, M. Kang, B. Kim, and H.-K. Jang. 2013. Isolation and characterization of a low pathogenic duck hepatitis A virus 3 from South Korea. Vet. Microbiol. 162:254–258. Chen, L. L., Q. Xu, R. H. Zhang, L. Yang, J. X. Li, Z. J. Xie, Y. L. Zhu, S. J. Jiang, and X. K. Si. 2013. Improved duplex RT-PCR assay for differential diagnosis of mixed infection of duck hepatitis A virus type 1 and type 3 in ducklings. J. Virol. Methods 192:12–17. Chen, Y., W. Xiong, L. Zeng, D. Wang, J. Liu, Y. Wu, and Y. Hu. 2014. Comparison of Bush Sophora Root polysaccharide and its sulfate’s anti-duck hepatitis A virus activity and mechanism. Carbohydr. Polym. 102:333–340. Crighton, G., and P. Woolcock. 1978. Active immunisation of ducklings against duck virus hepatitis. Vet. Rec. 102:358–361. Davis, D. 1987. Triple plaque purified strains of duck hepatitis virus and their potential as vaccines. Res. Vet. Sci. 43:44–48. Ding, C., and D. Zhang. 2007. Molecular analysis of duck hepatitis virus type 1. Virology 361:9–17. Fields, B., D. Knipe, and P. Howley. 2007. Fields’ Virology. 5th ed. Lippincott, Williams and Wilkins, Philadelphia, PA. Fu, Y., Z. Chen, C. Li, and G. Liu. 2012. Protective immune responses in ducklings induced by a suicidal DNA vaccine of the VP1 gene of duck hepatitis virus type 1. Vet. Microbiol. 160:314–318. Fu, Y., M. Pan, X. Wang, Y. Xu, H. Yang, and D. Zhang. 2008. Molecular detection and typing of duck hepatitis A virus directly from clinical specimens. Vet. Microbiol. 131:247–257. Gao, J., J. Chen, X. Si, Z. Xie, Y. Zhu, X. Zhang, S. Wang, and S. Jiang. 2012. Genetic variation of the VP1 gene of the virulent duck hepatitis A virus type 1 (DHAV-1) isolates in Shandong province of China. Virol. Sin. 27:248–253. Gough, R., M. Collins, E. Borland, and L. Keymer. 1984. Astrovirus-like particles associated with hepatitis in ducklings. Vet. Rec. 114:279. Haider, S. A., and B. W. Calnek. 1979. In vitro isolation, propagation, and characterization of duck hepatitis virus type III. Avian Dis. 23:715–729.
Huang, Q., H. Yue, B. Zhang, P. Nie, and C. Tang. 2012. Development of a real-time quantitative PCR for detecting duck hepatitis a virus genotype C. J. Clin. Microbiol. 50:3318–3323. Jin, X., W. Zhang, W. Zhang, C. Gu, G. Cheng, and X. Hu. 2008. Identification and molecular analysis of the highly pathogenic duck hepatitis virus type 1 in Hubei province of China. Res. Vet. Sci. 85:595–598. Kim, M.-C., M.-J. Kim, Y.-K. Kwon, A. M. Lindberg, S.-J. Joh, H.M. Kwon, Y.-J. Lee, and J.-H. Kwon. 2009. Development of duck hepatitis A virus type 3 vaccine and its use to protect ducklings against infections. Vaccine 27:6688–6694. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, S.-J. Kim, C. Tolf, J.-H. Kim, H.-W. Sung, A. M. Lindberg, and J.-H. Kwon. 2007a. Recent Korean isolates of duck hepatitis virus reveal the presence of a new geno- and serotype when compared to duck hepatitis virus type 1 type strains. Arch. Virol. 152:2059–2072. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, J.-H. Kwon, J.-H. Kim, and S.-J. Kim. 2007b. Development of one-step reverse transcriptasepolymerase chain reaction to detect duck hepatitis virus type 1. Avian Dis. 51:540–545. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, J.-H. Kwon, and A. Michael Lindberg. 2008. Differential diagnosis between type-specific duck hepatitis virus type 1 (DHV-1) and recent Korean DHV-1-like isolates using a multiplex polymerase chain reaction. Avian Pathol. 37:171–177. King, A. M., M. J. Adams, and E. Lefkowitz. 2011. Virus taxonomy: Ninth report of the international committee on taxonomy of viruses. Elsevier Academic Press, San Diego, CA. Lauring, A. S., J. O. Jones, and R. Andino. 2010. Rationalizing the development of live attenuated virus vaccines. Nat. Biotechnol. 28:573–579. Levine, P., and J. Fabricant. 1950. A hitherto-undescribed virus disease of ducks in North America. Cornell Vet. 40:71–86. Li, C., Z. Chen, C. Meng, L. Li, and G. Liu. 2013a. High yield expression of duck hepatitis A virus VP1 protein in Escherichia coli, and production and characterization of polyclonal antibody. J. Virol. Methods 191:69–75. Li, C., Z. Chen, C. Meng, and G. Liu. 2014. Rapid detection of duck hepatitis A virus genotype C using reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 196:193–198. Li, J., Y. Bi, C. Chen, L. Yang, C. Ding, and W. Liu. 2013b. Genetic characterization of Duck Hepatitis A Viruses isolated in China. Virus Res. 178:211–216. Liu, G., F. Wang, Z. Ni, T. Yun, B. Yu, J. Huang, and J. Chen. 2008. Genetic diversity of the VP1 gene of duck hepatitis virus type I (DHV-I) isolates from southeast China is related to isolate attenuation. Virus Res. 137:137–141. Liu, M., X.-j. Li, Z. Zhang, S. Liu, and Y. Zhang. 2011. Goose haemorrhagic hepatitis caused by a new subtype duck hepatitis type 1 virus. Vet. Microbiol. 152:280–283. Liu, M., T. Zhang, Y. Zhang, F. Meng, X. Li, Z. Hou, X. Feng, and X. Kong. 2010. Development and evaluation of a VP1-ELISA for detection of antibodies to duck hepatitis type 1 virus. J. Virol. Methods 169:66–69. Luo, Y.-J., G.-H. Zhang, J.-H. Chen, M. Liao, X. Xu, T. Ren, J.-P. Zhang, and K.-J. Luo. 2008. Genomic analysis and establishment of diagnostic technology for duck hepatitis virus type 1. Sci Agric. Sin. 41:2835–2842. Ma, X.-L., K.-X. Yu, J. Wu, M.-X. Song, M. Liao, and C.-A. Xin. 2009. Complete genome sequencing and variations analysis of seven isolated strains and one vaccine strain of duck hepatitis virus. Chin. J. Anim. Vet. Sci. 8:017. Maiboroda, A. 1972. Formation of duck hepatitis virus in culture cells. Veterinariya 8:50–52. Malirat, V., I. E. Bergmann, R. de Mendonca Campos, F. Conde, J. L. Quiroga, M. Villamil, G. Salgado, and S. Ortiz. 2012. Molecular epidemiology of foot-and-mouth disease virus type A in South America. Vet. Microbiol. 158:82–94. Mason, P. W., M. J. Grubman, and B. Baxt. 2003. Molecular basis of pathogenesis of FMDV. Virus Res. 91:9–32. Murty, D. K. 1961. A modified microgel diffusion method and its application in the study of the virus of duck hepatitis. Am. J. Vet. Res. 22:274–278.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
This work was supported by grants from the Special Fund for Agro-scientific Research in the Public Interest (no. 201003012, Beijing), Innovative Research Team Program in Education Department of Sichuan Province (12TD005/2013TD005, Chengdu), the Science and Technology Support Programs of Sichuan Province, China (2011ZO0034, Chengdu, and 2011JO0040, Chengdu), and the China Agricultural Research System (CARS-43-8, Beijing).
2191
2192
Wen et al. rus-like viruses, duck hepatitis virus type 2 and duck hepatitis virus type 3 as astroviruses. Avian Pathol. 38:21–30. Tseng, C. H., N. J. Knowles, and H. J. Tsai. 2007. Molecular analysis of duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus Res. 123:190–203. Tseng, C. H., and H. J. Tsai. 2007. Molecular characterization of a new serotype of duck hepatitis virus. Virus Res. 126:19–31. Vertinskiĭ, K., B. Bessarabov, A. Kurilenko, A. Strel’nikov, and P. Makhno. 1968. The pathogenesis and diagnosis of viral hepatitis of ducklings. Veterinariia. 45:27–30. (in Russian) Wang, L., M. Pan, Y. Fu, and D. Zhang. 2008. Classification of duck hepatitis virus into three genotypes based on molecular evolutionary analysis. Virus Genes 37:52–59. Wang, Y., C. Li, Z. Chen, B. Xu, G. Li, and G. Liu. 2012. Complete genome comparison of duck hepatitis virus type 1 parental and attenuated strains. Virus Genes 45:398–401. Wei, C.-Y., S. Su, Z. Huang, W.-J. Zhu, J.-D. Chen, F.-R. Zhao, Y.-J. Wang, J.-X. Xie, H. Wang, and G. Zhang. 2012. Complete genome sequence of a novel duck hepatitis A virus discovered in southern China. J. Virol. 86:10247. Woolcock, P. and J. Fabricant. 2003. Duck hepatitis. Diseases of Poultry 10:661–673. Xu, Q., R. Zhang, L. Chen, L. Yang, J. Li, P. Dou, H. Wang, Z. Xie, Y. Wang, and S. Jiang. 2012. Complete genome sequence of a duck hepatitis a virus type 3 identified in eastern China. J. Virol. 86:13848. Yang, M., A. Cheng, M. Wang, and H. Xing. 2008. Development and application of a one-step real-time Taqman RT-PCR assay for detection of duck hepatitis virus type1. J. Virol. Methods 153:55–60.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Oberste, M. S., K. Maher, D. R. Kilpatrick, M. R. Flemister, B. A. Brown, and M. A. Pallansch. 1999. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37:1288– 1293. Pattison, M. 2008. Poultry Diseases. Saunders Elsevier, London, UK. Perera, D., H. Shimizu, H. Yoshida, P. Van Tu, H. Ishiko, P. C. McMinn, and M. J. Cardosa. 2010. A comparison of the VP1, VP2, and VP4 regions for molecular typing of human enteroviruses. J. Med. Virol. 82:649–657. Rispens, B. H. 1969. Some aspects of control of infectious hepatitis in ducklings. Avian Dis. 13:417–426. Shi, S., H. Chen, Z. Chen, G. Fu, C. Wan, Y. Huang, S. Lin, L. Cheng, Q. Fu and J. Lin. 2013. Complete genome sequence of a duck hepatitis A virus 1 isolated from a pigeon in china. Genome Announc. 11:1(4). Shi, W.-F., Z. Zhang, A.-S. Dun, Y.-Z. Zhang, G.-F. Yu, D.-M. Zhuang, and C.-D. Zhu. 2009. Positive selection analysis of VP1 genes of worldwide human enterovirus 71 viruses. Virol. Sin. 24:59–64. Song, C., H. Wan, S. Yu, X. Han, X. Qiu, Q. Hu, L. Tan, and C. Ding. 2012. Rapid detection of duck hepatitis virus type-1 by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 182:76–81. Tamura, K., G. Stecher, D. Peterson, A. Filipski, S. Kumar, and K. Tamura. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30:2725–2729. Taylor, P. L., and L. E. Hanson. 1967. Indirect hemagglutination with duck hepatitis virus. Avian Dis. 11:586–593. Todd, D., V. J. Smyth, N. Ball, B. M. Donnelly, M. Wylie, N. J. Knowles, and B. Adair. 2009. Identification of chicken enterovi-
ABSTRACT Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotypespecific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1
gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV.
Key words: duck viral hepatitis, duck hepatitis A virus type 1, duck hepatitis A virus type 3, VP1, epidemic investigation 2014 Poultry Science 93:2184–2192 http://dx.doi.org/10.3382/ps.2014-04024
INTRODUCTION Duck viral hepatitis is an acute, highly contagious, and fatal disease of young ducklings, 1 to 28 d of age (Woolcock and Fabricant, 2003; Pattison, 2008). It can be caused by 3 heterologous serotypes of virus: duck hepatitis A virus (DHAV, formerly called DHV-1), duck astrovirus 1, and duck astrovirus 2 (Haider and Calnek, 1979; Gough et al., 1984; Wang et al., 2008; Todd et al., 2009). The most severe and widely distributed virus, DHAV, belongs to genus Avihepatovirus of the family Picornaviridae (Levine and Fabricant, 1950; Woolcock and Fabricant, 2003; King et al., 2011). Based on phylogenetic analyses, DHAV have been clas-
©2014 Poultry Science Association Inc. Received March 11, 2014. Accepted June 1, 2014. 1 Corresponding author: [email protected]
sified into 3 genotypes: DHAV type 1 (DHAV-1), type 2 (DHAV-2), and type 3 (DHAV-3; Tseng et al., 2007; Fu et al., 2008; Kim et al., 2008; Wang et al., 2008). Moreover, DHAV-2 and DHAV-3 are genetically and serologically different from DHAV-1 (Kim et al., 2007a; Tseng and Tsai, 2007). Duck hepatitis A virus type 1 and type 3 have caused serious damage to the duck industry in China and South Korea (Kim et al., 2007a; Fu et al., 2008; Liu et al., 2011; Wei et al., 2012; Xu et al., 2012). To date, several neutralization tests and molecular biological methods for detection of DHAV isolates have been described. Neutralization tests including indirect hemagglutination test (Taylor and Hanson, 1967), agar gel diffusion precipitation (Murty, 1961), and direct fluorescence-antibody technique (Vertinskiĭ et al., 1968; Maiboroda, 1972) have been used in virus identification for years. However, the tests are labor intensive and time consuming. Molecular biological methods can quickly and specially detect DHAV directly from sam-
2184
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
*Institute of Preventive Veterinary Medicine, and †Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Wenjiang, Chengdu city, Sichuan, 611130, P. R. China; and ‡Avian Disease Research Center, College of Veterinary Medicine, Sichuan Agricultural University, 46# Xinkang Road, Ya’an, Sichuan 625014, P. R. China
2185
DETECTION OF DUCK HEPATITIS A VIRUS
MATERIALS AND METHODS Viruses and Bacteria Two DHAV reference strains available in our laboratory, as well as 9 other avian viruses and bacteria used in this study, are listed in Table 1. The DHAV-1 strain H and DHAV-3 strain CH1 were as DHAV reference strains to develop the 1-step duplex RT-PCR assay. Other 9 avian pathogenic viruses and bacteria: duck plague virus strain (DPV), Pasteurella multocida, Muscovy duck parvovirus (MDPV), infectious laryngotracheitis virus (ILTV), Marek’s disease virus (MDV), Riemerella anatipestifer, Staphylococcus aureus, Escherichia coli, and Salmonella anatis were used to evaluate the specificity of the method developed in this study.
Nucleic Acid Isolation The RNA was isolated using the EZNA Viral RNA Kit (Omega Bio-Tek, Doraville, GA), according to the manufacturer’s recommendation. The DNA was extracted using a DNA extraction kit (TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s instructions. Isolated nucleic acids were eluted in 100 μL of RNase-free water (TaKaRa Biotechnology) and measured using an ND-1000 Spectrophotometer (Nanodrop Technologies, Wilmington, DE) at OD260 and OD280, before being used.
Birds Three-day-old Pekin ducklings were obtained from CHAOBA Duck Farm (Yaan, China) and determined to be free of DHAV-1 and DHAV-3 using neutralization tests (http://www.oie.int). The ducklings were housed in cages with a 12L:12D cycle and free access to food and water under controlled temperature (24 to 30°C) during the study. All ducklings were handled in compliance with the local animal welfare regulations and maintained according to standard protocols.
Design of 1-Step Duplex RT-PCR Primers The sequences for the primers developed in this study are listed in Table 2. The genotype-specific primers were designed based on all DHAV genome sequences retrieved from GenBank. Lyophilized primers were generated by Invitrogen Life Technologies (Invitrogen, Shanghai, China), resuspended in RNase-free water to a working concentration, and stored at −20°C.
Establishment of the 1-Step Duplex RT-PCR Assay The 1-step RT-PCR was performed in a 25-μL reaction volume containing 1 μL of viral RNA, 1 μL of each primer (5 pmol/mL) for DHAV-1, and 1 μL of each primer (10 pmol/mL) for DAHV-3, using the PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa Biotechnology) according to the manufacturer’s instructions. The 1-step duplex RT-PCR step was carried out at 50°C for 30 min followed by a denaturation step at 94°C for 2 min, and then 30 cycles of a denaturation step at 94°C for 30 s, an annealing step of 55°C for 30 s, and an extension step of 72°C for 1 min, with a final extension at 72°C for 10 min. The amplified products were analyzed by electrophoresis on a 1.5% (wt/vol) agarose Table 1. Viruses and bacteria used in this study1 Species
Source or reference
DHAV-1 strain H DHAV-3 strain CH1 DHAV-1 vaccine strain CH60 DHAV attenuated strain E80 Duck plague virus strain Infectious laryngotracheitis virus Muscovy duck parvovirus Marek’s disease virus Riemerella anatipestifer Staphylococcus aureus Escherichia coli Salmonella anatis Pasteurella multocida
KLADHHSP V201305 (CCTCC) V201248 (CCTCC) KLADHHSP V201209 (CCTCC) VR-783 (ATCC) AV238 (CVCC) VR-585 (ATCC) 11845 (ATCC) 6538 (ATCC) 83003 (CVCC) 50083 (CMCC) 12946 (ATCC)
1DHAV = duck hepatitis A virus (DHAV). CCTCC = China Center for Type Culture Collection (Wuhan, China); ATCC = American Type Culture Collection (Manassas, VA); CVCC = China Veterinary Culture Collection Center (Beijing, China); CMCC = National Center for Medical Culture Collections (Beijing, China); KLADHHSP = Key Laboratory of Animal Disease and Human Health of Sichuan Province.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
ples or from viral isolates, including reverse-transcription (RT) PCR assays (Kim et al., 2007b, 2008; Yang et al., 2008; Anchun et al., 2009; Huang et al., 2012; Chen et al., 2013) and RT loop-mediated isothermal amplification assays (Song et al., 2012; Li et al., 2014). However, ducklings vaccinated with DHAV can be detected from healthy ducklings vaccinated with live attenuated vaccines (Fu et al., 2012), and these methods cannot be used to detect the specimens that were vaccinated with live DHAV vaccines. Therefore, it would be of great clinical value to develop an assay that can be used for routine evaluation and monitoring of DHAV1 and DHAV-3 field isolates as an aid to improve the control of the circulation of DHAV. The major surface protein of picornavirus, VP1, plays important roles in viral pathogenesis and virulence, and its high diversity among isolates is probably linked to host adaptation (Mason et al., 2003; Fields et al., 2007; Kim et al., 2008). The coding sequence for the VP1 protein has been extensively used for antigenic characterization, phylogenetic analysis, and molecular epidemiology of Picornaviridae (Oberste et al., 1999; Shi et al., 2009; Perera et al., 2010; Cano-Gómez et al., 2011; Malirat et al., 2012). In this study, a genotypespecific 1-step duplex RT-PCR assay was developed for detection, differentiation, and VP1 sequencing of DHAV-1 and DHAV-3.
2186
Wen et al.
Table 2. Primers used for 1-step duplex reverse-transcription PCR Target virus1
Forward sequence (5′ to 3′)
Reverse sequence (5′ to 3′)
DHAV-1 DHAV-3
TCTGCCATTTACATCAACCAC GCTATATAACCTGGCATGTTGT
TGCCAACAACTAAGATAGGTC CCTCTCCATTGAGTGCAGA
1Duck
Expected product size (bp) 992 1,533
hepatitis A virus (DHAV) was typed on http://www.picornaviridae.com/.
Detection of DHAV-1 and DHAV-3 in Clinical Samples
Specificity of the 1-Step Duplex RT-PCR
A total of 26 specimens collected from duck flocks in different regions of China between 1996 and 2013, as well as 2 specimens collected from flocks that had been vaccinated for live attenuated strains, were detected by the assay established above. The liver samples used in this study were homogenized in PBS (10% wt/vol), and these suspensions were clarified by centrifugation (8,000 × g at room temperature for 20 min). Total RNA from field cases was isolated from 200 μL of supernatant of 10% tissue homogenates as appropriate using the EZNA Viral RNA Kit, according to the manufacturer’s recommendation. The VP1 sequences obtained in this study (Table 3) were compared with 28 other representative DHAV sequences (Table 4) downloaded from GenBank. The maximum-likelihood phylogenetic tree of these nucleotide sequences was constructed from by MEGA 6.0 (Tamura et al., 2013) with 1,000 bootstrap replicates.
Specificity of the 1-step duplex RT-PCR was evaluated with nucleic acids extracted from 2 DHAV reference strains and 9 other infectious viruses and bacteria: DPV, P. multocida, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, E. coli, and S. anatis. Simultaneously, RNA extracted from a healthy duckling liver sample served as a negative control.
Sensitivity of the 1-Step Duplex RT-PCR To evaluate the sensitivity of the duplex RT-PCR, 10-fold serial dilutions of RNA templates of DHAV1 strain H, DHAV-3 strain CH1, and a mixture of 2 strains were tested by the optimized 1-step duplex RTPCR to determine their sensitivity. Individual DHAV-1 and DHAV-3 were diluted from 1 ng to 0.1 pg, respectively. Simultaneously, a mixture of 2 μL of 1 ng/μL to 0.1 pg/μL of DHAV-1 and DHAV-3 was detected by the duplex RT-PCR.
Detection of DHAV-1 and DHAV-3 in Experimentally Infected Ducklings Sixty 3-d-old Pekin ducklings, which were free of DHAV-1 and DHAV-3, were divided into 5 experimental groups (10 ducklings per group) and 1 control group (10 ducklings). Ducklings in experimental groups were subcutaneously inoculated with 0.2 mL of DHAV-1 attenuated vaccine strain CH60 (group 1), DHAV-1 strain H (group 2), DHAV-3 strain CH1 (group 3), a mixture of DHAV-1 strain H and DHAV-3 strain CH1 (group 4), and a mixture of these 3 strains (group 5), respectively. The virus titers were determined as 106.5 embryo lethal median dose per 0.2 mL, and viruses were stored at −80°C until use. Ducklings in the control group were injected with the same volume of sterile PBS (10% wt/ vol). All ducklings were separated in different incubators, following strict biosafety controls, and were monitored for 10 d to determine pathogenicity. After death or euthanization with sodium pentobarbital, all ducklings were dissected to collect liver samples. Isolated RNA of these samples was detected directly by the 1-step duplex RT-PCR assay, and the PCR products were sent to Invitrogen Life Technologies (Invitrogen, Shanghai, China) for sequencing. These experiments have been replicated.
RESULTS Specificity of the 1-Step Duplex RT-PCR Assay Primer pair specificity for DHAV-1 and DHAV-3 was analyzed initially by single PCR; these 2 genotype-specific primer pairs produced a single PCR product with an expected product size (data not shown). Nucleic acids extracted from 2 DHAV reference strains, as well as 9 other pathogenic viruses and bacteria (Figure 1), were used to determine the specificity of the 1-step duplex RT-PCR assay. The 1-step duplex RT-PCR amplified a PCR fragment of 992 bp from DHAV-1, a PCR fragment of 1,533 bp from DHAV-3, and 2 PCR fragments of 992 and 1,533 bp from a mixture templates of DHAV-1 and DHAV-3. No specific PCR amplification occurred from the nucleic acids of 9 other pathogenic viruses and bacteria: DPV, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, P. multocida, E. coli, and S. anatis, and RNA extracted from healthy ducklings.
Sensitivity of the 1-Step Duplex RT-PCR Assay The sensitivity of the 1-step duplex RT-PCR assay was evaluated using RNA of reference viruses. The detection limit of the duplex RT-PCR was estimated to
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
gel containing GoldView (Beijing Solarbio Science and Technology, Beijing, China).
2187
DETECTION OF DUCK HEPATITIS A VIRUS Table 3. Clinical liver samples Origin
Accession number
Genotype1
Field isolate, BZ03 Field isolate, BZB Field isolate, CD131231 Field isolate, CH12 Attenuated vaccine strain, CH603 Field isolate, CZ130927 Field isolate, DG Field isolate, DY Field isolate, DY130804 Attenuated strain, E803 Field isolate, FJ Field isolate, GX09 Field isolate, HB Field isolate, HB131216 Field isolate, JS04 Field isolate, LY01 Field isolate, MY120414 Field isolate, MY121201 Field isolate, MY02 Field isolate, QL1312 Field isolate, QL120310 Field isolate, SD1207 Field isolate, WF07 Field isolate, WZ Field isolate, WZ12 Field isolate, XZ05 Field isolate, XZ130930 Field isolate, ZJ06
China/Shandong/201103 China/Shandong/201102 China/Sichuan/20131231 China/Shandong/201207 China China/Sichuan/20130927 China/Liaoning/201012 China/Sichuan/199008 China/Sichuan/20130804 China China/Fujian/201108 China/Guangxi/201009 China/Haerbing/199605 China/Hubei/20131216 China/Jiangshu/201005 China/Shandong/201101 China/Sichuan/20120414 China/Sichuan/20121201 China/Sichuan/200002 China/Sichuan/201312 China/Sichuan/20120310 China/Shandong/201207 China/Shandong/201007 China/Zhejiang/201108 China/Zhejiang/201112 China/Jiangshu/201005 China/Shandong/20130930 China/Zhejiang/201103
KJ461977 KJ461978 KJ461979 KJ461980 KJ461981 KJ461982 KJ461983 KJ461984 KJ461985 KJ461986 KJ461987 KJ461988 KJ461989 KJ461990 KJ461991 KJ461992 KJ461993 KJ461994 KJ461995 KJ461996 KJ461997 KJ461998 KJ461999 KJ462000 KJ462001 KJ462002 KJ462003 KJ462004
DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-1 DHAV-3 DHAV-1
VP1 (bp) 714 714 711 720 714 711 714 714 711 714 714 714 714 720 714 714 714 714 720 711 714 714 714 714 714 714 720 714
1DHAV
= duck hepatitis A virus. used as reference strain for development of the reverse-transcription PCR assay and sensitivity test. 3Liver samples collected from healthy ducklings infected with live attenuated strain. 2Virus
Table 4. Reference duck hepatitis A virus (DHAV) trains used for comparison in this study Genotype1
Strain
Accession number
Origin
Reference
DHAV-1 DHAV-2 DHAV-3
Mild strain, A66 Moderate virulent strain, R Attenuated strain, ZJ-A Attenuated strain, MY Attenuated vaccine strain, C80 Attenuated vaccine strain, SH Attenuated vaccine strain, ZJ-A2 Attenuated vaccine strain, X Attenuated vaccine strain, AV2111 Attenuated vaccine strain, H Virulent strain, 5886 Virulent strain, 03D Virulent strain, DRL-62 Virulent strain, R85952 Virulent strain, JX Virulent strain, HS Virulent strain, HSS Virulent strain, FJ1220 (pigeon) Virulent strain, ZJ Virulent strain, 09D Virulent strain, 04G Virulent strain, AP-03337 Virulent strain, AP-04009 Virulent strain, AP-04203 Virulent strain, AP-04114 Virulent strain, D11-JW-018 Virulent strain, JT (goose) Virulent strain, B-N
DQ886445 EF585200 EF442072 GU944671 DQ864514 EF502171 EF502172 FJ496343 EU395440 DQ249300 DQ249301 DQ249299 DQ219396 DQ226541 EF093502 DQ812094 DQ812092 KC904272 EF382778 EF067924 EF067923 DQ256132 DQ256133 DQ256134 DQ812093 JX312194 JF835025 JX235698
China China China China China China China China China UK America Taiwan ATCC ATCC China South Korea South Korea China China Taiwan Taiwan South Korea South Korea South Korea South Korea South Korea China China
Luo et al., 2008 Luo et al., 2008 Liu et al., 2008 Wang et al., 2012 Ding and Zhang, 2007 Liu et al., 2008 Liu et al., 2008 Gao et al., 2012 Ma et al., 2009 Tseng et al., 2007 Tseng et al., 2007 Tseng et al., 2007 Kim et al., 2008 Kim et al., 2008 Jin et al., 2008 Kim et al., 2007a Kim et al., 2007a Shi et al., 2013 Liu et al., 2008 Tseng and Tsai, 2007 Tseng and Tsai, 2007 Kim et al., 2007a Kim et al., 2007a Kim et al., 2007a Kim et al., 2007a Cha et al., 2013 Liu et al., 2011 Wei et al., 2012
1Genotypes
of these DHAV strains are published on the website http://www.picornaviridae.com/.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Strain
2188
Wen et al.
be 10 pg of total RNA templates of DHAV-1 or DHAV3 or both (Figure 2).
Detection of DHAV-1 and DHAV-3 in Experimentally Infected Ducklings The DHAV-1 and DHAV-3 were successfully used to experimentally infect ducklings in this study. Clinical symptoms of the ducklings in groups 2 to 5 were first observed at 24 h postinfection, and the ducklings in groups 2 to 5 began to die at 24 h postinfection, with pathological changes typical of duck hepatitis. At 96 h postinfection, all ducklings in group 2 to 5 died. In contrast, no clinical signs or mortality were observed in ducklings of group 1 and the control group. After death or euthanization, the liver samples of all ducklings were detected by the 1-step duplex RT-PCR assay. The results showed that DHAV-1 could be detected in all the
samples of groups 1 and 2, DHAV-3 could be detected in all the samples of group 3, and these 2 viruses could be detected in all the samples of groups 4 and 5. However, DHAV-1 and DHAV-3 were not detected in any of the samples of the control group. In addition, DHAV was detected in the feces and serum of the ducklings of groups 1 to 5, which was consistent with those test results of the liver samples (data not shown). The sequencing results were in accordance with the known VP1 gene of DHAV-1 strain CH60 (group 1), H (group 2 and 4), and DHAV-3 strain CH1 (groups 3, 4, and 5). Meaningfully, many sequencing peaks appeared for the 992-bp fragment of group 5, suggesting the presence of different DHAV-1 strain amplification. After cloning the RT-PCR product into vector, plasmid DNA was purified from the separated insert-positive clones and sent to Invitrogen Life Technologies (Invitrogen, Shanghai, China) for sequencing. The result showed
Figure 2. Sensitivity of the 1-step duplex RT-PCR assay. The sensitivity of the 1-step duplex reverse-transcription (RT) PCR assay was evaluated using RNA of duck hepatitis A virus (DHAV)-1 strain H and DHAV-3 strain CH1. Individual DHAV-1 and DHAV-3 were diluted from 1 ng to 0.1 pg, respectively. Simultaneously, a mixture of 2 μL of 1 ng/μL to 0.1 pg/μL of DHAV-1 and DHAV-3 was detected by the duplex RT-PCR. The detection limit of the duplex RT-PCR was estimated to be 10 pg of total RNA templates of DHAV-1, DHAV-3, or a mixture of them. Lanes M, DL2000 DNA marker; lanes 1 to 5: the 1-step duplex RT-PCR amplification of RNA prepared from 10-fold serial dilutions ranging from 1 ng to 0.1 pg of total RNA of a mixture of DHAV-1 and DHAV-3; lanes 6 to 10: the 1-step duplex RT-PCR amplification of RNA prepared from 10fold serial dilutions ranging from 1 ng to 0.1 pg total RNA of DHAV-1; lanes 11 to 15: the 1-step duplex RT-PCR amplification of RNA prepared from 10-fold serial dilutions ranging from 1 ng to 0.1 pg of total RNA of DHAV-3.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Figure 1. Specificity of the 1-step duplex reverse-transcription (RT) PCR assay. The specificity of the 1-step duplex RT-PCR was determined using viral RNA extracted from 2 duck hepatitis A virus (DHAV) reference strains, and nucleic acids extracted from 9 other avian pathogenic viruses and bacteria: duck plague virus strain (DPV), Pasteurella multocida, Muscovy duck parvovirus (MDPV), infectious laryngotracheitis virus (ILTV), Marek’s disease virus (MDV), Riemerella anatipestifer, Staphylococcus aureus, Escherichia coli, and Salmonella anatis. Lane M, DL2000 DNA marker; lane 1, DHAV-1 strain H; lane 2, DHAV-3 strain CH1; lane 3, a mixture of DHAV-1 and DHAV-3; line 4, RNA extracted from healthy ducklings; lane 5, DPV; lane 6, MDPV; lane 7, ILTV; lane 8, MDV; lane 9, R. anatipestifer; lane 10, S. aureus; lane 11, P. multocida; lane 12, E. coli; lane 13, S. anatis. The 1-step duplex RT-PCR amplified a PCR fragment of 992 bp from DHAV-1, a PCR fragment of 1,533 bp from DHAV-3, and 2 PCR fragments of 992 and 1,533 bp from mixture templates of DHAV-1 and DHAV-3. No specific PCR amplification occurred from the nucleic acids of 9 other pathogenic viruses and bacteria: DPV, MDPV, ILTV, MDV, R. anatipestifer, S. aureus, P. multocida, E. coli, and S. anatis, and RNA extracted from healthy ducklings.
DETECTION OF DUCK HEPATITIS A VIRUS
that it was a mixed infection of DHAV-1 strains H and CH60. In this way it could identify the multiple genotypes of DHAV circulating within infected birds, especially for vaccinated ones.
Detection of DHAV-1 and DHAV-3 in Clinical Samples
DISCUSSION To date, prevention of DHAV is mostly based on the use of live attenuated vaccines (Rispens, 1969; Crighton and Woolcock, 1978; Kim et al., 2009; Chen et al., 2014) or inoculation of antibodies in chicken egg yolk (http://www.oie.int). However, live attenuated vaccines could shed from vaccinated individuals, which sometimes presents a risk to unvaccinated individuals with impaired immunity. Duck viral hepatitis has occurred in many duck flocks that were already vaccinated with live attenuated vaccine. Variation of virulence of DHAV
isolates may be responsible for immune failure (Davis, 1987; Lauring et al., 2010). Therefore, it would be of great clinical value to develop a assay for epidemic investigation of DHAV-1 and DHAV-3 concerning DHAV management (Jin et al., 2008; Cha et al., 2013). It has been shown that genetic diversity at VP1 of DHAV is closely associated with the difference in viral serotypes, and can be used as a target for genotyping of DHAV (Wang et al., 2008). Furthermore, VP1 of DHAV may play important roles in animal vaccination, evolution, and virulence (Jin et al., 2008; Liu et al., 2008, 2010; Li et al., 2013a) and can be used to monitor of DHAV to follow local trends of DHAV infection (Li et al., 2013b). In this study, we developed a genotype-specific 1-step duplex RT-PCR assay that can intuitively distinguish DHAV-1 and DHAV-3 according to size by electrophoresis, and can be used to amplify and sequence the fragments encompassing the VP1 gene of DHAV-1 and DHAV-3. This assay was confirmed to be specific with no specific PCR amplification occurring from the nucleic acids of 9 other pathogenic viruses and bacteria. The detection limit of the 1-step duplex RT-PCR was estimated to be 10 pg for DHAV-1 or DHAV-3 or both. The assay was evaluated in experimentally infected ducklings, and results showed that DHAV-1 could be detected from the liver and serum of ducklings vaccinated with live attenuated vaccine, and different nucleic acid base pairs presented in VP1 of DHAV-1 have utility for distinguishing wild type and vaccine strains. The 1-step duplex RT-PCR assay was performed on liver samples collected from different duck flocks in different regions of China. A total of 26 DHAV field isolates from different commercial farms were detected. Among the 26 isolates, 22 grouped into the DHAV-1 genotype, and 4 grouped into the DHAV-3 genotype. Although co-infections of DHAV-1 and DHAV-3 have been found in some areas of China (Ding and Zhang, 2007; Fu et al., 2008; Jin et al., 2008; Liu et al., 2008; Gao et al., 2012; Xu et al., 2012), we did not find any mixed infection of DHAV in clinical samples. The result suggests that DHAV-1 is still the most prevalent serotype in China, and co-infections of DHAV types are only common in some farms or areas. Phylogenetic analysis on the basis of these VP1 sequences suggested that there might exist a main genetic group of DHAV-1 distributed in China. Significantly, the VP1 sequences of 4 field isolates recently obtained from flocks in Sichuan province of China are 711 bp long and coded 238 amino acids. Although several RT-RCR methods have been developed for detection of DHAV-1 and DHAV-3, these methods cannot be used to detect the specimens that were vaccinated with live DHAV vaccines. The assay developed in this study could differentially diagnose between DHAV wild type and vaccine strains by sequencing the VP1 gene. Therefore, this method can be used to make disease diagnosis in ducklings that have been vaccinated, and also can be used for epidemiological investigations of DHAV-1 and DHAV-3 in China.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Using the 1-step duplex RT-PCR assay, a total of 26 DHAV field isolates from different commercial farms and 2 DHAV live attenuated strains were detected. The results confirmed the presence of DHAV in all of the clinical samples. Twenty-two flocks were identified as having infection with DHAV-1 only, 4 flocks had infection with DHAV-3 only, and no flocks were detected as having mixed infection with DHAV-1 and DHAV3. The actual size of the PCR product varied slightly. The VP1 sequences obtained in this study were 714 (18 DHAV-1 isolates), 711 (4 DHAV-1 isolates), or 720 (4 DHAV-3 isolates) bp long. Interestingly, the VP1 gene of 4 DHAV-1 field isolates, which were recently obtained from flocks in Sichuan province of China, is 711 bp long, and ducklings were not protected by administration of serum from DHAV-1-immune ducks. The sequences obtained in this study were compared with 28 other DHAV sequence data available in GenBank. The maximum-likelihood phylogenetic tree of these VP1 gene sequences is presented in Figure 3. Consistent with DHAV genotypes, these VP1 sequences clustered into 3 major groups: DHAV-1, DHAV-2, and DHAV-3. Moreover, VP1 gene sequences of 22 DHAV-1 field isolates were clustered into 3 major genetic groups: clade 1, clade 2, and clade 3. The DHAV-1 strains in clade 1 did not display significant geographical correlation, and were widely distributed in China. In contrast, clade 3 only included 4 virulent isolates recently isolated from duck flocks in Sichuan province of China and 1 virulent strain (FJ1220) isolated from a dead pigeon in eastern China. The majority of strains in clade 2 were live attenuated strains, but 2 virulent strain JX and HB were clustered in this clade. The VP1 sequences of DHAV-3 clustered into 2 major clades: clade 1 and clade 2. They displayed significant geographical correlation. Viral strains in clade 1 were isolated outside China, and 4 DHAV-3 field isolates obtained in this study were clustered into another clade.
2189
2190
Wen et al.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Figure 3. Phylogenetic tree of 56 duck hepatitis A virus (DHAV) VP1 gene. The VP1 sequences of 28 DHAV field isolates obtained in this study were compared with 28 other DHAV sequence data available in GenBank. This tree was generated by the maximum-likelihood algorithm with MEGA 6.0 (Tamura et al., 2013) based on alignment of VP1 gene nucleotide sequences. The reliability of the tree was assessed by bootstrap analysis with 1,000 replicates; numbers at nodes indicate neighboring joining bootstrap values and only bootstrap values ≥80% are shown. Scale bars signify a genetic distance of 0.05 nucleotide substitutions per site. A closed triangle (▲) indicates the strains obtained by the 1-step duplex reverse-transcription PCR assay, an open triangle (△) indicates the live attended virus, and an open circle (○) indicates moderate or low pathogenic virulent strains. Consistent with DHAV genotypes, these VP1 sequences clustered into 3 major groups: DHAV-1, DHAV-2, and DHAV-3. Based on the distribution of branches in phylogenetic trees, VP1 gene sequences of DHAV-1 sequences clustered into 3 major genetic groups: clade 1, clade 2, and clade 3, and DHAV-3 sequences clustered into 2 major clades: clade 1 and clade 2.
DETECTION OF DUCK HEPATITIS A VIRUS
In summary, the assay that established in this study could be applied as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV.
ACKNOWLEDGMENTS
REFERENCES Anchun, C., W. Mingshu, X. Hongyi, Z. Dekang, L. Xinran, C. Haijuen, J. Renyong, and Y. Miao. 2009. Development and application of a reverse transcriptase polymerase chain reaction to detect Chinese isolates of duck hepatitis virus type 1. J. Microbiol. Methods 77:332–336. Cano-Gómez, C., F. Palero, M. D. Buitrago, M. A. García-Casado, J. Fernández-Pinero, P. Fernández-Pacheco, M. Agüero, C. Gómez-Tejedor, and M. Á. Jiménez-Clavero. 2011. Analyzing the genetic diversity of teschoviruses in Spanish pig populations using complete VP1 sequences. Infect. Genet. Evol. 11:2144–2150. Cha, S.-Y., J.-H. Roh, M. Kang, B. Kim, and H.-K. Jang. 2013. Isolation and characterization of a low pathogenic duck hepatitis A virus 3 from South Korea. Vet. Microbiol. 162:254–258. Chen, L. L., Q. Xu, R. H. Zhang, L. Yang, J. X. Li, Z. J. Xie, Y. L. Zhu, S. J. Jiang, and X. K. Si. 2013. Improved duplex RT-PCR assay for differential diagnosis of mixed infection of duck hepatitis A virus type 1 and type 3 in ducklings. J. Virol. Methods 192:12–17. Chen, Y., W. Xiong, L. Zeng, D. Wang, J. Liu, Y. Wu, and Y. Hu. 2014. Comparison of Bush Sophora Root polysaccharide and its sulfate’s anti-duck hepatitis A virus activity and mechanism. Carbohydr. Polym. 102:333–340. Crighton, G., and P. Woolcock. 1978. Active immunisation of ducklings against duck virus hepatitis. Vet. Rec. 102:358–361. Davis, D. 1987. Triple plaque purified strains of duck hepatitis virus and their potential as vaccines. Res. Vet. Sci. 43:44–48. Ding, C., and D. Zhang. 2007. Molecular analysis of duck hepatitis virus type 1. Virology 361:9–17. Fields, B., D. Knipe, and P. Howley. 2007. Fields’ Virology. 5th ed. Lippincott, Williams and Wilkins, Philadelphia, PA. Fu, Y., Z. Chen, C. Li, and G. Liu. 2012. Protective immune responses in ducklings induced by a suicidal DNA vaccine of the VP1 gene of duck hepatitis virus type 1. Vet. Microbiol. 160:314–318. Fu, Y., M. Pan, X. Wang, Y. Xu, H. Yang, and D. Zhang. 2008. Molecular detection and typing of duck hepatitis A virus directly from clinical specimens. Vet. Microbiol. 131:247–257. Gao, J., J. Chen, X. Si, Z. Xie, Y. Zhu, X. Zhang, S. Wang, and S. Jiang. 2012. Genetic variation of the VP1 gene of the virulent duck hepatitis A virus type 1 (DHAV-1) isolates in Shandong province of China. Virol. Sin. 27:248–253. Gough, R., M. Collins, E. Borland, and L. Keymer. 1984. Astrovirus-like particles associated with hepatitis in ducklings. Vet. Rec. 114:279. Haider, S. A., and B. W. Calnek. 1979. In vitro isolation, propagation, and characterization of duck hepatitis virus type III. Avian Dis. 23:715–729.
Huang, Q., H. Yue, B. Zhang, P. Nie, and C. Tang. 2012. Development of a real-time quantitative PCR for detecting duck hepatitis a virus genotype C. J. Clin. Microbiol. 50:3318–3323. Jin, X., W. Zhang, W. Zhang, C. Gu, G. Cheng, and X. Hu. 2008. Identification and molecular analysis of the highly pathogenic duck hepatitis virus type 1 in Hubei province of China. Res. Vet. Sci. 85:595–598. Kim, M.-C., M.-J. Kim, Y.-K. Kwon, A. M. Lindberg, S.-J. Joh, H.M. Kwon, Y.-J. Lee, and J.-H. Kwon. 2009. Development of duck hepatitis A virus type 3 vaccine and its use to protect ducklings against infections. Vaccine 27:6688–6694. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, S.-J. Kim, C. Tolf, J.-H. Kim, H.-W. Sung, A. M. Lindberg, and J.-H. Kwon. 2007a. Recent Korean isolates of duck hepatitis virus reveal the presence of a new geno- and serotype when compared to duck hepatitis virus type 1 type strains. Arch. Virol. 152:2059–2072. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, J.-H. Kwon, J.-H. Kim, and S.-J. Kim. 2007b. Development of one-step reverse transcriptasepolymerase chain reaction to detect duck hepatitis virus type 1. Avian Dis. 51:540–545. Kim, M.-C., Y.-K. Kwon, S.-J. Joh, J.-H. Kwon, and A. Michael Lindberg. 2008. Differential diagnosis between type-specific duck hepatitis virus type 1 (DHV-1) and recent Korean DHV-1-like isolates using a multiplex polymerase chain reaction. Avian Pathol. 37:171–177. King, A. M., M. J. Adams, and E. Lefkowitz. 2011. Virus taxonomy: Ninth report of the international committee on taxonomy of viruses. Elsevier Academic Press, San Diego, CA. Lauring, A. S., J. O. Jones, and R. Andino. 2010. Rationalizing the development of live attenuated virus vaccines. Nat. Biotechnol. 28:573–579. Levine, P., and J. Fabricant. 1950. A hitherto-undescribed virus disease of ducks in North America. Cornell Vet. 40:71–86. Li, C., Z. Chen, C. Meng, L. Li, and G. Liu. 2013a. High yield expression of duck hepatitis A virus VP1 protein in Escherichia coli, and production and characterization of polyclonal antibody. J. Virol. Methods 191:69–75. Li, C., Z. Chen, C. Meng, and G. Liu. 2014. Rapid detection of duck hepatitis A virus genotype C using reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 196:193–198. Li, J., Y. Bi, C. Chen, L. Yang, C. Ding, and W. Liu. 2013b. Genetic characterization of Duck Hepatitis A Viruses isolated in China. Virus Res. 178:211–216. Liu, G., F. Wang, Z. Ni, T. Yun, B. Yu, J. Huang, and J. Chen. 2008. Genetic diversity of the VP1 gene of duck hepatitis virus type I (DHV-I) isolates from southeast China is related to isolate attenuation. Virus Res. 137:137–141. Liu, M., X.-j. Li, Z. Zhang, S. Liu, and Y. Zhang. 2011. Goose haemorrhagic hepatitis caused by a new subtype duck hepatitis type 1 virus. Vet. Microbiol. 152:280–283. Liu, M., T. Zhang, Y. Zhang, F. Meng, X. Li, Z. Hou, X. Feng, and X. Kong. 2010. Development and evaluation of a VP1-ELISA for detection of antibodies to duck hepatitis type 1 virus. J. Virol. Methods 169:66–69. Luo, Y.-J., G.-H. Zhang, J.-H. Chen, M. Liao, X. Xu, T. Ren, J.-P. Zhang, and K.-J. Luo. 2008. Genomic analysis and establishment of diagnostic technology for duck hepatitis virus type 1. Sci Agric. Sin. 41:2835–2842. Ma, X.-L., K.-X. Yu, J. Wu, M.-X. Song, M. Liao, and C.-A. Xin. 2009. Complete genome sequencing and variations analysis of seven isolated strains and one vaccine strain of duck hepatitis virus. Chin. J. Anim. Vet. Sci. 8:017. Maiboroda, A. 1972. Formation of duck hepatitis virus in culture cells. Veterinariya 8:50–52. Malirat, V., I. E. Bergmann, R. de Mendonca Campos, F. Conde, J. L. Quiroga, M. Villamil, G. Salgado, and S. Ortiz. 2012. Molecular epidemiology of foot-and-mouth disease virus type A in South America. Vet. Microbiol. 158:82–94. Mason, P. W., M. J. Grubman, and B. Baxt. 2003. Molecular basis of pathogenesis of FMDV. Virus Res. 91:9–32. Murty, D. K. 1961. A modified microgel diffusion method and its application in the study of the virus of duck hepatitis. Am. J. Vet. Res. 22:274–278.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
This work was supported by grants from the Special Fund for Agro-scientific Research in the Public Interest (no. 201003012, Beijing), Innovative Research Team Program in Education Department of Sichuan Province (12TD005/2013TD005, Chengdu), the Science and Technology Support Programs of Sichuan Province, China (2011ZO0034, Chengdu, and 2011JO0040, Chengdu), and the China Agricultural Research System (CARS-43-8, Beijing).
2191
2192
Wen et al. rus-like viruses, duck hepatitis virus type 2 and duck hepatitis virus type 3 as astroviruses. Avian Pathol. 38:21–30. Tseng, C. H., N. J. Knowles, and H. J. Tsai. 2007. Molecular analysis of duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus Res. 123:190–203. Tseng, C. H., and H. J. Tsai. 2007. Molecular characterization of a new serotype of duck hepatitis virus. Virus Res. 126:19–31. Vertinskiĭ, K., B. Bessarabov, A. Kurilenko, A. Strel’nikov, and P. Makhno. 1968. The pathogenesis and diagnosis of viral hepatitis of ducklings. Veterinariia. 45:27–30. (in Russian) Wang, L., M. Pan, Y. Fu, and D. Zhang. 2008. Classification of duck hepatitis virus into three genotypes based on molecular evolutionary analysis. Virus Genes 37:52–59. Wang, Y., C. Li, Z. Chen, B. Xu, G. Li, and G. Liu. 2012. Complete genome comparison of duck hepatitis virus type 1 parental and attenuated strains. Virus Genes 45:398–401. Wei, C.-Y., S. Su, Z. Huang, W.-J. Zhu, J.-D. Chen, F.-R. Zhao, Y.-J. Wang, J.-X. Xie, H. Wang, and G. Zhang. 2012. Complete genome sequence of a novel duck hepatitis A virus discovered in southern China. J. Virol. 86:10247. Woolcock, P. and J. Fabricant. 2003. Duck hepatitis. Diseases of Poultry 10:661–673. Xu, Q., R. Zhang, L. Chen, L. Yang, J. Li, P. Dou, H. Wang, Z. Xie, Y. Wang, and S. Jiang. 2012. Complete genome sequence of a duck hepatitis a virus type 3 identified in eastern China. J. Virol. 86:13848. Yang, M., A. Cheng, M. Wang, and H. Xing. 2008. Development and application of a one-step real-time Taqman RT-PCR assay for detection of duck hepatitis virus type1. J. Virol. Methods 153:55–60.
Downloaded from http://ps.oxfordjournals.org/ at Virginia Polytechnic Institute and State University on August 29, 2014
Oberste, M. S., K. Maher, D. R. Kilpatrick, M. R. Flemister, B. A. Brown, and M. A. Pallansch. 1999. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37:1288– 1293. Pattison, M. 2008. Poultry Diseases. Saunders Elsevier, London, UK. Perera, D., H. Shimizu, H. Yoshida, P. Van Tu, H. Ishiko, P. C. McMinn, and M. J. Cardosa. 2010. A comparison of the VP1, VP2, and VP4 regions for molecular typing of human enteroviruses. J. Med. Virol. 82:649–657. Rispens, B. H. 1969. Some aspects of control of infectious hepatitis in ducklings. Avian Dis. 13:417–426. Shi, S., H. Chen, Z. Chen, G. Fu, C. Wan, Y. Huang, S. Lin, L. Cheng, Q. Fu and J. Lin. 2013. Complete genome sequence of a duck hepatitis A virus 1 isolated from a pigeon in china. Genome Announc. 11:1(4). Shi, W.-F., Z. Zhang, A.-S. Dun, Y.-Z. Zhang, G.-F. Yu, D.-M. Zhuang, and C.-D. Zhu. 2009. Positive selection analysis of VP1 genes of worldwide human enterovirus 71 viruses. Virol. Sin. 24:59–64. Song, C., H. Wan, S. Yu, X. Han, X. Qiu, Q. Hu, L. Tan, and C. Ding. 2012. Rapid detection of duck hepatitis virus type-1 by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 182:76–81. Tamura, K., G. Stecher, D. Peterson, A. Filipski, S. Kumar, and K. Tamura. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30:2725–2729. Taylor, P. L., and L. E. Hanson. 1967. Indirect hemagglutination with duck hepatitis virus. Avian Dis. 11:586–593. Todd, D., V. J. Smyth, N. Ball, B. M. Donnelly, M. Wylie, N. J. Knowles, and B. Adair. 2009. Identification of chicken enterovi-
