G Model VETPAR-7740; No. of Pages 7

ARTICLE IN PRESS Veterinary Parasitology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Short communication

Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes Imtiaz Hussain a , Barbara Jaskulska a , Michael Hess a,b , Ivana Bilic a,∗ a Clinic for Poultry and Fish Medicine, Department for Farm Animals and Veterinary Public Health, University of Veterinary Medicine, Veterinaerplatz 1, 1210 Vienna, Austria b Christian Doppler Laboratory for Innovative Poultry Vaccines, Vienna, Austria

a r t i c l e

i n f o

Article history: Received 26 May 2015 Received in revised form 23 July 2015 Accepted 1 August 2015 Keywords: Histomonas meleagridis rpb1 Fe-hydrogenase Real-time PCR Southern blotting

a b s t r a c t Histomonas meleagridis, a protozoan parasite that can infect gallinaceous birds, affects mainly the liver and caeca of infected birds. As a consequence of the recent ban of chemotherapeuticals in Europe and the USA, histomonosis gained somewhat more attention due to its re-emergence and the fact that there is no effective treatment available. Therefore, special attention is now also given towards the diagnosis and the control of the disease. In the actual study we report the development of highly specific and sensitive real-time PCR methods for detection and quantification of the parasite, based on two protein coding genes, Fe-hydrogenase (FeHYD) and rpb1. Both genes seem to be in a single copy in H. meleagridis as shown by southern blotting and absolute quantification using real-time PCRs on samples containing a known amount of the parasite. The real-time PCR assays based on FeHYD and rpb1 genes were found to be an efficient method for the quantification and detection of H. meleagridis in in vitro grown cultures, tissues of infected birds and in faecal samples. Both real-time PCRs were able to detect up to a single cell in in vitro cultures of H. meleagridis and in fecal samples spiked with H. meleagridis. Finally, qPCR assays were shown to be highly specific for H. meleagridis as samples containing either of the two H. meleagridis genotypes were positive, whereas samples containing other protozoa such as Tetratrichomonas gallinarum, Trichomonas gallinae, Simplicimonas sp., Tritrichomonas sp., Parahistomonas wenrichi, Dientamoebidae sp. and Blastocystis sp. were all negative. © 2015 Published by Elsevier B.V.

1. Introduction Histomonosis is an important disease of gallinaceous birds that gained much attention in recent years due to its re-emergence after the ban on chemotherapeutics in Europe and USA (Commission Regulation (EC), 2001; Hess et al., 2015). Histomonas meleagridis is the causative agent of histomonosis which could lead to high losses in the poultry industry due to high mortality and morbidity (Tyzzer, 1920). Histomonosis, caused by the protozoan parasite H. meleagridis, can be fatal in turkeys, whereas in chickens it can cause severe economic losses with some mortality (McDougald, 2005). Due to the non-availability of effective treatment the main focus is now given to its prevention and control which ultimately requires specific and sensitive diagnostic tools. Previous studies have shown the presence of T. gallinae, T. gallinarum, Blastocystis sp., Simplici-

∗ Corresponding author. Fax: +43 664 60257 6826. E-mail address: [email protected] (I. Bilic).

monas sp., P. wenrichi, Tritrichomonas sp. and Dientamoebidae sp. in the poultry gut besides H. meleagridis, which may hinder its specific detection with conventional diagnostic techniques (Bilic et al., 2014; Kemp and Reid, 1965; Lollis et al., 2011; Nguyen et al., 2015; Stenzel and Boreham, 1996). Earlier, the disease was diagnosed based on gross lesions and in vitro isolation of the parasite which proved to be a time consuming method (McDougald, 2005). After the re-emergence of the disease, more sophisticated and rapid techniques were developed. This included in situ hybridization (ISH) (Liebhart et al., 2006), immunohistochemistry (IHC) (Singh et al., 2008) and enzyme linked immunosorbent assays (ELISA) (van der Heijden et al., 2010; Windisch and Hess, 2009). Parallel to these methods, a palette of PCR protocols was developed to detect histomonad-DNA in various samples (Bleyen et al., 2007; Grabensteiner and Hess, 2006; Hafez et al., 2005; Huber et al., 2005; Xu et al., 2014). All these PCRs were based on the 18S rRNA locus, which, due to the high conservation among other protozoa, is prone to compromise the specificity of the method. Recently, a realtime PCR method based on the 5.8S rRNA locus was developed to

http://dx.doi.org/10.1016/j.vetpar.2015.08.011 0304-4017/© 2015 Published by Elsevier B.V.

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model VETPAR-7740; No. of Pages 7

ARTICLE IN PRESS I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

2

quantify the amount of histomonads in a given sample (Landman et al., 2015). However, the specificity of this method was not extensively tested. Here we report the development of highly-specific real-time PCR assays based on two protein coding loci, FeHYD and rpb1 genes. Demonstration of the single-copy nature of both genes by Southern blotting and absolute quantification using real-time PCRs on samples containing known amounts of the parasite, enables the application of these methods for successful quantification. 2. Materials and methods 2.1. Samples 2.1.1. In vitro cultures All protozoal in vitro cultures used in the present study were of clonal origin (Table 1). All cultures were established at our clinic by micromanipulation technique and in vitro propagation as previously described (Hess et al., 2006; Ganas et al., 2012). 2.1.2. Fecal and tissue samples Fecal samples (25 mg) from uninfected specific pathogen free chickens were spiked with 107 , 106 , 105 , 104 , 103 , 102 and 101 H. meleagridis/turkey/Austria/2922-C6/04-290x/DH5␣ 22x. The complete fecal sample was taken for DNA extraction. Liver and caeca samples used for the detection of H. meleagridis originated from experimental animal trials previously performed at our clinic (Sulejmanovic et al., 2015 Avian Pathology, accepted for publication). In addition, H. meleagridis genotype 2, Simplicimonas sp., Tritrichomonas sp. Dientamoebidae sp. and P. wenrichi samples were available as part of routine diagnostics performed at our clinic (Table 1). 2.2. DNA extraction Parasitic cells from in vitro cultures were counted by a Neubauer hemocytometer (Sigma–Aldrich, Vienna, Austria) and the number of cells/ml was determined. For DNA extraction 100 ␮l of culture was pelleted by centrifugation at 300 × g for 5 min and used with DNeasy® Blood and Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions for DNA extraction of cultured animal cells. For all tissue samples, including livers and caeca from animal trials and routine diagnostic samples, 25 mg of tissue was taken for DNA extraction applying the DNeasy® Blood and Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions for DNA extraction from tissue samples. DNA extraction from faecal samples spiked with H. meleagridis was done with QIAamp® DNA Stool Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. At the end of all extractions the DNA was eluted in 200 ␮l elution buffer and stored at −20 ◦ C. 2.3. Primers and probes Primers and probes used in the present study are listed in Table 2. Primer pairs HmRpb1-F/HmRpb1-R (Bilic et al., 2014) and HmFeHyd-F/HmFeHyd-R were used in conventional PCR for amplification of partial rpb1 and FeHYD genes, respectively. For real-time PCR based on the rpb1 gene primers, HmRpb1-rt-F/HmRpb1-rtR and probe HmRpb1-rt-P were used, whereas the real-time PCR based on the FeHYD gene was performed with primer pair HmFeHyd-rt-F/HmFeHyd-rt-R and probe HmFeHyd-rt-P. Both sets of primers and probes were newly designed for the present study. Specificity of all primers and probes was tested in a BLAST search.

All primers and probes were synthesized by Eurofins MWG Operon (Ebersberg, Germany). 2.4. Preparation of standards FeHYD and rpb1 were amplified using conventional PCR. Amplifications were carried out in 25 ␮l reaction mixtures employing the HotStarTaq Master Mix Kit (Qiagen, Hilden, Germany) with 1 ␮M of each primer and 2.5 ␮l of DNA template. Thermal profile of reactions was as follows: one cycle of initial denaturation step was done at 95 ◦ C for 15 min, followed by 40 cycles of denaturation at 94 ◦ C for 30 s, annealing of primers at 50 ◦ C for 30 s and DNA extension at 72 ◦ C for 3 min; and one cycle of the final extension step at 72 ◦ C for 10 min. The PCR products were visualized using agarose gel electrophoresis and amplified fragments of correct sizes (849 bp for FeHYD and 2.93 kb for rpb1) were extracted from the gel using QIAquick® gel extraction kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. For generating the real-time PCR standard, extracted PCR products were cloned into pRC4® TOPO® vector using TOPO TA Cloning® Kit (Invitrogen, Carlsbad, CA, USA). The vectors were linearized using PstI restriction enzyme (Invitrogen, Carlsbad, CA, USA) and run on 1% agarose gel for confirmation and purification. Bands of correct sizes were excised from the gel and purified using the QIAquick® gel extraction kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. Both vectors were sequenced to verify their accuracy. Sequencing was performed by LGC Genomics, Berlin, Germany. Linearized and purified plasmids were used as standards after determining the DNA concentration by NanoDrop (Thermo Fisher Scientific Inc., Carlsbad, CA, USA) and calculating the number of copies/␮l using the following calculations (Whelan et al., 2003): Weight in daltons (g/mol) = (bp size of ds product) × (330 Da × 2nt/bp) Hence: (g/mol)/Avogadro’s number = g/molecule = copy number (where: bp = base pairs, ds = double-stranded, nt = nucleotides). 2.5. Real-time PCR Real-time PCR was performed in 20 ␮l reaction mixture on the Agilent Mx3000P (Agilent Technologies, Santa Clara, CA, USA) using TaqMan chemistry, Brilliant III UltraFast QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA) with 30 nM ROX as reference dye, 0.3 ␮M (FeHYD-based assay) or 0.2 ␮M (rpb1-based assay) primers and 0.3 ␮M TaqMan probe (both assays). For all reactions 2 ␮l DNA template were used. Thermal profile for both assays was as follows: initial denaturation at 95 ◦ C for 3 min, followed by 40 cycles of 2-step cycling with 95 ◦ C for 3 s and 60 ◦ C for 20 s. Fluorescence was detected and reported at each cycle during the 60 ◦ C step. 2.6. Standard curves For generating standard curves 10-fold dilution series of linearized plasmids containing either FeHYD or rpb1 genes were prepared starting with 6.08 × 108 copies for FeHYD vector and 4.2 × 108 copies for rpb1 vector per reaction mixture. All standard curves consisted of 8 different concentrations and each of them was run in triplicate. 2.7. Real-time PCR sensitivity and specificity Hemocytometer was used to calculate the number of H. meleagridis cells in an in vitro culture. Counting was repeated 3 times and the mean value was used for later analyses. In order to determine the sensitivity of each qPCR assay, DNA extracted from cultures was further tested in 10-fold dilutions. To test the specificity of real-time

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model

ARTICLE IN PRESS

VETPAR-7740; No. of Pages 7

I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

3

Table 1 Detail of samples used in this study Name

Origin

H. meleagridis genotype

H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xa H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 32xa H. meleagridis/Turkey/Austria/2922-C6/04- 10x/DH5␣ 22xa H. meleagridis/Turkey/Austria/2922-C6/04- 39xa H. meleagridis/Turkey/Austria/2922-C6/04- 312xa H. meleagridis/Turkey/Austria/2922-C6/04- 26xa H. meleagridis/Turkey/Austria/6742-C10/12- 380xa T. gallinae/budgerigar/Austria/5895-C2/06a T. gallinarum/Turkey/Austria/2721-C7/03a Blastocystis sp./Turkey/Austria/2721-C5/03a 3-6-403c , 62-3907c , PA11/4178c , DN10d , PY18d , KH1d , KH2d KH5d , KH10d , PY2d , PY3d DN9d , DN11d , KH7d , 11/116224 , 11/105374 9-5-32c , 11/11632e , 11/11992e , 11/10021e , 14/19802e , 13/18665e , 13/6834e 40f , 44f

H.meleagridis (monoxenic in vitro culture) H.meleagridis (monoxenic in vitro culture) H.meleagridis (monoxenic in vitro culture) H.meleagridis (xenic in vitro culture) H.meleagridis (xenic in vitro culture) H.meleagridis (xenic in vitro culture) H.meleagridis (xenic in vitro culture) T. gallinae (axenic in vitro culture) T. gallinarum (axenic in vitro culture) Blastocystis sp. (xenic in vitro culture) Simplicimonas sp. (field samples) Tritrichomonas sp. (field samples) P. wenrichi (field samples) Dientamoebidae sp. (field samples) liver and caecum of turkey infected with H. meleagridis/Turkey/Austria/5642-C4/05- 29xa liver and caecum of turkey infected with H. meleagridis/chicken/Austria/8175-C7/06- 10xa liver and caecum of turkey infected with H. meleagridis/Turkey/Germany/4114-C18/05- 5xa liver and caecum of turkey infected with H. meleagridis/Turkey/France/14913-C9/13- 5xa H. meleagridis (field sample)

I I I I I I I n.a.b n.a.b n.a.b n.a.b n.a.b n.a.b n.a.b I

51f , 52f 61f , 62f 71f , 72f e

e

c

c

14/9911 , 14/9912 , 10/12765 , 13/12607

I I I II

a

Mono-eukaryotic culture named according to following rule: parasite/bird species/country of origin/protocol number-clone number/year of isolation-passage number as xenic culture/passage number as monoxenic culture (co-cultivation with E. coli DH5 ␣). b n.a. = not applicable. c Numbering according to Bilic et al., (2014). d Numbering according to Nguyen et al., (2015). e Internal protocol number. f Numbering according to Sulejmanovic et al. Avian Pathology, in press.

assays, DNA samples from in vitro cultures of Tetratrichomonas gallinarum, Trichomonas gallinae, and field samples of Simplicimonas sp., Tritrichomonas sp., Parahistomonas wenrichi, Dientamoebide sp. and Blastocystis sp. were investigated. 2.8. Southern blotting Genomic DNA from H. meleagridis/Turkey/Austria/2922-C6/04 was extracted by DNeasy Blood and Tissue Kit and 20 ␮g DNA was digested with the following restriction enzymes: EcoRI for FeHYD and EcoRV for rpb1. Digested DNA was separated on an 0.8% agarose gel for 3hr (5 V/1 cm), documented and capillary transferred to a nylon membrane (Hybond-N; GE Healthcare Europe GmbH, Freiburg, Germany) (Sambrook and Russell, 2001). Probes were generated by PCR using HotStar Taq MasterMix (Qiagen, Hilden, Germany) and the following primer pairs: HmFeHYD-sonde-F (5 CAGGTCCACTTCCAATGTTC  3 )/ HmFeHYD-sonde-R (5 TTGCAACCTTGATTCCATCC-3 ) and HmRpb1-SprobeF1 (5 -ACAAAAGGATCACTTACACGAC-3 )/ HmRpb1-SprobeR1 (5 - CGATACGAATTGATGGATCAGG-3 ) for FeHYD and rpb1, respectively. Thermal profile of PCRs was one cycle of initial denaturation at 95 ◦ C for 15 min, 40 cycles of 3-step cycling at 95 ◦ C for 30 s, 53.9 ◦ C (FeHYD) or 50 ◦ C (rpb1) for 30 s, 72 ◦ C for 1 min; followed by one cycle of final elongation at 72 ◦ C for 10 min. The PCR products were visualized using agarose gel electrophoresis and amplified fragments of correct sizes (503 bp for FeHYD and 508 bp for rpb1) were extracted from the gel using GeneJET Gel Extraction Kit (Thermo Scientific, Waltham, Massachusetts, USA) according to manufacturer’s instructions. Both probes were labeled with Alkaline Phosphatase using Amersham Gene Images AlkPhos Direct Labeling and Detection System (GE Healthcare Europe GmbH, Freiburg, Germany). Hybridization, hybridization washes and chemiluminescent detection of probes were performed according to manufacturer’s instructions of Amersham Gene Images AlkPhos Direct Labelling and Detection System (GE Healthcare Europe GmbH, Freiburg, Germany).

3. Results 3.1. Development and optimization of real-time PCR assays Different primer and probe concentrations were tested. Based on the standard curve and efficiency of the assay, the optimal working concentrations were selected. For the FeHYD qPCR, 0.3 ␮M concentration of each primer and the probe were selected for further use, whereas the rpb1 qPCR employed 0.2 ␮M concentration of each primer and 0.3 ␮M concentration of the probe. Thermal profile was chosen according to the manufacturer’s instructions for Brilliant III UltraFast QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA). Both real-time PCR assays showed a detection range over 8 orders of magnitude, from 6.08 × 108 to 6.08 × 101 copies for FeHYD and 4.2 × 108 to 4.2 × 101 copies for rpb1; with an efficiency of 98.8% for FeHYD and 97.9% for rpb1; and regression squared value (RSq) of 0.996 for FeHYD and 0.999 for rpb1 (Fig. 1). 3.2. Sensitivity and specificity of real-time qPCRs Ten-fold serial dilutions of DNA extracted from H. meleagridis in vitro cultures with known cell number were tested to determine the sensitivity of each qPCR assay. Samples ranged over 5 orders of magnitude (1 × 104 to 1 × 10−1 cells per reaction mixture). In both, FeHYD and rpb1, assays, the lowest dilution (10−1 cells/reaction) gave Ct values only in some replicates. Therefore, the lowest reliably detected dilution was 1 cell per reaction, in which all three replicates gave a Ct value (Table 3). In addition, FeHYD and rpb1 real-time PCR assays were used with DNA obtained from different H. meleagridis in vitro culture strains, of which the number of cells was previously determined by hemocytometer. Samples included different passages of monoxenic culture H. meleagridis/Turkey/Austria/2922-C6/04 and following xenic cultures H. meleagridis/Turkey/Austria/2922-C6/04 and H. meleagridis/Turkey/Austria/6742-C10/12. Quantification of cells applying newly developed qPCR assays on these DNA samples

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model VETPAR-7740; No. of Pages 7

ARTICLE IN PRESS I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

4 Table 2 Primers and probes used in present study. Primer

Sequences (5 -3 )

Reference

HmRpb1-F HmRpb1-R HmRpb1-rt-F HmRpb1-rt-R HmRpb1-rt-P HmFeHyd-F HmFeHyd-R HmFeHyd-rt-F HmFeHyd-rt-R HmFeHyd-rt-P HmFeHYD-sonde-F HmFeHYD-sonde-R HmRpb1-SprobeF1 HmRpb1-SprobeR1

GGATCACTTACACGACAAGAC TCGTTGTTCGACTTCTTGC TTTCATCAACGACAAACCGT TCGAATATGCCCTTCTTTCC FAM-CGATCCAACGAGCGGTTACTCG-BHQ1 ACTGCACCAGCTATCCGTATC TCCGCCACATACACATCCAC GCACAGCCAAGAAAGATGAA CGTCGAACTCTGAATCTGGA FAM-CAACCAAAGGCTTCAAGGAAACCG-BHQ1 CAGGTCCACTTCCAATGTTC TTGCAACCTTGATTCCATCC ACAAAAGGATCACTTACACGAC CGATACGAATTGATGGATCAGG

Bilic et al., (2014) Bilic et al., (2014) This study This study This study This study This study This study This study This study This study This study This study This study

Table 3 Sensitivity and specificity of qPCR targeting FeHYD and rpb1 genes tested with different samples. Cell numbers and Ct values are expressed as mean values from three independent qPCRs or three counts using hemocytometer. Samples

e

H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12x H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xe H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xe H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xe H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xe H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 12xe Spikedb fecal material Spikedb fecal material Spikedb fecal material Spikedb fecal material Spikedb fecal material Spikedb fecal material Spikedb fecal material 14/9911d 14/9912d 14/9912d 10/12765d 13/12607d 10/12765-1d

Haemocytometer

FeHYD qPCR

No. of cells/PCR reaction

No. of cells/PCR reaction

1 × 10 1 × 103 1 × 102 10 1 0.1 1 × 105 1 × 104 1 × 103 1 × 102 10 1 0.1 n.a.a n.a. n.a. n.a. n.a. n.a.

1.85 × 10 2.21 × 103 3.71 × 102 7.33 × 101 4.50 × 100 1.22 × 100 c 3.36 × 105 3.14 × 104 2.14 × 103 1.42 × 102 7.74 × 101 2.65 × 101 1.45 × 101 c 1.87 × 102 5.10 × 100 2.59 × 101 4.29 × 102 4.52 × 101 5.89 × 101

4

4

rpb1qPCR Ct value

No. of cells/PCR reaction

Ct value

28.92 32.08 34.97 36.53 37.25 37.00c 25.74 29.27 33.27 37.39 36.40 37.32 38.26c 35.73 39.41 37.99 34.48 25.36 37.36

1.62 × 10 1.67 × 103 1.65 × 102 1.17 × 101 1.59 × 100 9.20 × 10−1 c 3.17 × 105 3.29 × 104 1.62 × 103 1.07×102 4.14 × 101 1.71 × 101 1.40 × 101 c 1.05 × 103 1.35 × 101 2.82 × 101 8.15 × 103 2.22 × 102 1.07 × 103

28.29 29.20 30.23 31.82 35.06 36.83c 25.26 28.71 33.34 37.54 37.75 38.69 38.89c 31.74 38.87 37.53 28.45 34.18 31.66

4

a

n.a. = not applicable. Spiked with H. meleagridis/turkey/Austria/2922-C6/04-passage 290x/DH5␣ 12x. Value based on less than 3 replicates. d Internal protocol number, H. meleagridis genotype II. e Mono-eukaryotic culture named according to following rule: parasite/bird species/country of origin/protocol number-clone number/year of isolation-passage number as xenic culture/passage number as monoxenic culture (co-cultivation with E. coli DH5 ␣). b c

Table 4 Detection and quantification of H.meleagridis in xenic and monoxenic in vitro cultures using FeHYD and rpb1qPCRs. Cell numbers and Ct values are expressed as mean values from three independent qPCRs or three counts using hemocytometer. in vitro cultures

H. meleagridis/Turkey/Austria/2922-C6/04- 290x/DH5␣ 32xa H. meleagridis/Turkey/Austria/2922-C6/04- 10x/DH5␣ 22xa H. meleagridis/Turkey/Austria/2922-C6/04- C6 39xa H. meleagridis/Turkey/Austria/2922-C6/04- 312xa H. meleagridis/Turkey/Austria/2922-C6/04- 26xa H. meleagridis/Turkey/Austria/6742-C10/12- 380xa

Haemocytometer

FeHYD qPCR

No. of cells/PCR reaction

No. of cells/qPCR

Ct value

rpb1qPCR No. of cells/qPCR

Ct value

1.00 × 104 1.00 × 103 1.00 × 102 7.00 × 103 7.00 × 102 2.50 × 102

4.55 × 104 4.18 × 103 3.30 × 102 2.35 × 104 2.64 × 103 3.41 × 102

29.37 32.99 36.81 30.37 33.68 36.19

4.75 × 104 1.35 × 103 1.48 × 102 4.27 × 103 3.80 × 102 2.51 × 102

25.12 29.58 32.80 29.27 32.73 32.77

a Mono-eukaryotic culture named according to following rule: parasite/bird species/country of origin/protocol number-clone number/year of isolation-passage number as xenic culture/passage number as monoxenic culture (co-cultivation with E. coli DH5 ␣).

was comparable to the values calculated by the hemocytometer (Table 4). In order to test whether the matrix background has an impact on the sensitivity of qPCR, DNA extracted from fecal samples spiked with 105 , 104 , 103 , 102 , 10, 1 and 0.1 histomonads/ qPCR was performed. Similar to results with in vitro culture samples, the low-

est reliably detected dilution was 1 histomonad/reaction for both qPCRs (Table 3). Since all H. meleagridis samples from in vitro cultures belong to genotype 1, it was essential to show that the newly developed qPCR assays are also able to detect samples of H. meleagridis genotype 2. For this purpose, several routine diagnostic samples previously classified as genotype 2 were used. Both qPCRs suc-

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model VETPAR-7740; No. of Pages 7

ARTICLE IN PRESS I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

5

the locus would have been present in the genome, bands of different sizes were likely to be expected. Together with the single band for either FeHYD or rpb1 noticed by southern blotting the fact that fairly high amount of genomic DNA was needed to obtain any result supports the single copy nature of each gene.

4. Discussion

Fig. 1. Standard curves from (A) FeHYD qPCR with the efficiency of 98.9% and regression squared value of 0.996. and (B) from rpb1 qPCR with efficiency of 97.9% and regression squared value of 0.999.

cessfully detected the genotype 2 of H. meleagridis in all tested samples (Table 3). The specificity of the FeHYD and rpb1 based PCR for H. meleagridis was tested on samples containing T. gallinarum, T. gallinae, Simplicimonas sp., Tritrichomonas sp., P. wenrichi, Dientamoebidae sp. and Blastocystis sp. All tested samples were negative in both qPCR assays; i.e. no ct was measured in any of the samples. 3.3. Detection of H. meleagridis in tissues of infected birds Newly developed qPCR assays were tested on tissue samples from infected birds using liver and caeca from turkeys infected with different clonal cultures of virulent H.meleagridis (Table 5). In addition, caeca and liver samples from two uninfected control birds were used (Table 5). Tested tissue samples originated from a recently performed animal trial. All samples from infected birds were scored with lesion score 4 and tested positive for H. meleagridis by immunohistochemistry (Sulejmanovic et al., 2015 Avian Pathology, in press). Both qPCR assays were able to detect H. meleagridis in all samples from infected birds, whilst samples from two uninfected control turkeys remained negative (Table 5). In some infected birds, caeca samples demonstrated much lower Ct values when compared to liver samples of the same bird (Table 5). The absolute qPCR quantification in these samples indicated 10-fold higher amount of parasites in caeca than in liver of the same bird (Table 5). 3.4. Southern blotting to demonstrate FeHYD and rpb1 genes in H. meleagridis In order to clarify the copy number of FeHYD and rpb1 loci in the genome of H. meleagridis, southern blotting assays were performed. In both assays, detecting either FeHYD or rpb1, only a single band was revealed (Fig. 2). Restriction enzymes, used for digestion of genomic DNA as a part of sample preparation for southern blotting, were selected to cut the locus only once. Hence, if several copies of

The present study reports the development of two qPCR assays, established to efficiently and specifically detect and quantify H. meleagridis in various samples. The lack of efficient prevention strategies against H. meleagridis emphasizes the importance of diagnostic tools as part of a control strategy. Initially, the diagnosis of a H. meleagridis infection was based on the clinical picture, characterized by high mortality in turkeys and decreased performance in chickens with variable degree of lesions in caeca and liver, eventually supported by histopathology, cultivation and re-isolation of histomonads (McDougald, 2005). Since re-isolation of the parasite requires presence of viable cells in the sample, this kind of detection may not be possible in birds that died some time ago. In the last ten years, re-emergence of histomonosis led to the development of several sophisticated and fast methods that do not rely on viable parasite, such as in-situ hybridization, immunohistochemistry, ELISA and PCR (reviewed in Hess et al., 2015), of which each method found its place in a diagnostic cascade. In particular, a panel of various PCR assays, which enabled fast detection of parasites’ DNA, were developed (Bleyen et al., 2007; Grabensteiner and Hess, 2006; Hafez et al., 2005; Huber et al., 2005; Xu et al., 2014). All these methods were designed to target the small subunit of ribosomal RNA that has hampered the specificity of some assays due to strong homology of this region with other closely related protozoa (Bilic et al., 2014). Only recently, a quantitative real-time PCR method based on the 5.8S rRNA locus was developed to quantify the amount of histomonads in a sample (Landman et al., 2015). However, as this assay was developed for the quantification of H. meleagridis in animal infection experiments only few isolates belonging to the genotype 1 and a T. gallinarum strain were used to test the specificity of the method. In the present study, qPCR assays targeting FeHYD and rpb1 genes were designed to increase the specificity of the test, and to enable the quantification of the parasite. Both, FeHYD and rpb1, loci are protein coding genes that were previously postulated to be in a single copy in genomes of closely related protozoa (Lawson et al., 2011; Malik et al., 2011). Therefore the intention was to use both loci for development of the qPCR assay and test which of them gives better performance. The advantage of either newly developed qPCR assays could not be seen, as both demonstrated the same range of sensitivity and specificity for H. meleagridis. Results from southern blotting indicated that in the H. meleagrids genome both genes might indeed be present in a single copy, which would enable the application of both realtime PCR assays for quantification purposes. These findings were furthermore supported by applying newly developed qPCR assays on various H. meleagridis samples with previously determined cell numbers. The quantification obtained in this experiment was comparable to the values calculated by the hemocytometer, confirming the findings of the southern blotting analyses. Sensitivity and specificity of an assay are important aspects when considering its application for diagnostic purposes. Assays reported here demonstrate high sensitivity with detection limit of one H. meleagridis cell/ PCR. Previously reported PCR assays for detecting H. meleagridis varied in their sensitivity (Bleyen et al., 2007; Grabensteiner and Hess, 2006; Hafez et al., 2005; Huber et al., 2005; Xu et al., 2014; Landman et al., 2015), which was often difficult to compare due to the variety in reported parameters. The fact that all PCR assays were based on the 18S rRNA or 5.8S rRNA

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model

ARTICLE IN PRESS

VETPAR-7740; No. of Pages 7

I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

6

Table 5 Detection and quantification of H.meleagridis in liver and caecum samples of infected birds by using FeHYD and rpb1qPCRs. Cell numbers and Ct values are expressed as mean values from three independent qPCRs. Sample no.

Liver (number of histomonads/qPCR) FeHYD qPCR

a

40 44a 51a 52a 61a 62a 71a 72a Negative control bird 1 Negative control bird 2 a b

1.21 × 10 5.23 × 103 5.55 × 102 3.25 × 103 1.21 × 102 2.38 × 104 8.73 × 102 4.21 × 104 n.d.b n.d.b 3

Caeca (number of histomonads/qPCR)

Ct value

rpb1qPCR

33.53 31.42 34.69 32.10 36.98 29.21 34.00 28.38 no Ct no Ct

4.16 × 10 1.21 × 103 1.45 × 102 5.01 × 102 2.56×101 5.08 × 103 1.32 × 102 8.14 × 103 n.d.b n.d.b 2

Ct value

FeHYD qPCR

32.14 30.55 33.67 31.84 36.27 28.42 33.81 27.73 no Ct no Ct

2.69 × 10 6.69 × 103 2.31 × 105 4.43 × 103 1.27×103 5.02 × 104 2.72 × 104 5.96 × 104 n.d.b n.d.b 4

Ct value

rpb1qPCR

Ct value

31.30 31.06 25.92 28.31 33.47 28.14 29.02 27.88 no Ct no Ct

5.32 × 10 1.81 × 103 4.96 × 104 9.45 × 103 2.66 × 102 1.12 × 104 6.03 × 103 1.55 × 104 n.d.b n.d.b

29.06 29.97 25.07 27.51 32.78 27.28 28.17 26.78 no Ct no Ct

3

Numbering according to Sulejmanovic et al. Avian Pathology, in press. n.d. = not determined.

Fig. 2. Southern blotting demonstrating FeHYD and rpb1 genes in H. meleagridis. (A) Schematic representation of the Southern blotting analysis. H. meleagridis sequence available in the database is shown as rectangular; the estimated missing sequence is shown as a line. The estimation was performed by using an alignment with deduced amino acid sequences: for rpb1 with H. meleagridis rpb1 sequences (HG009109, HG009110, HG009111, HG009112) and T. vaginalis rpb1 complete coding sequence (XM 001580000), and for FeHYD with H. meleagridis FeHYD (GAAM01000591) and T. vaginalis FeHYD complete coding sequence (XM 001330739). (B) Southern blotting analysis.

loci, both known to be present in numerous copies in all eukaryots, contributed to the very good sensitivity. However, the same fact bears the possibility of false positives, as detection of related protozoa, which are often present in birds, might occur due to conserved sequence of the 18S rRNA locus. By targeting two protein coding genes; FeHYD and rbp1, we also aimed at high specificity of qPCR assays. This was demonstrated when both tests applied to samples positive for T. gallinarum, T. gallinae, Simplicimonas sp., Tritrichomonas sp., P. wenrichi, Dientamoebidae sp. and Blastocystis sp. exclusively gave negative results. Reported literature and our own experience showed that these parasites are often detected in chicken and turkey samples suspicious for H. meleagridis, and

the presence of all, except Blastocystis sp., can cause false positive results in PCR assays based on the 18S rRNA or ITS1-5.8S rRNA-ITS2 regions (Lollis et al., 2011; Bilic et al., 2014; Nguyen et al., 2015). Recently, the separation of H. meleagridis isolates into two genotypes was reported (Bilic et al., 2014). Therefore, several genetically different H. meleagridis isolates from both genotypes were tested with both qPCR assays. All samples were successfully detected, which proved that both qPCR protocols can be used to detect both genotypes of the parasite. To our knowledge, none of the protocols reported so far was tested on genotype 2 samples, which gives an additional novelty to the assays reported here.

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011

G Model VETPAR-7740; No. of Pages 7

ARTICLE IN PRESS I. Hussain et al. / Veterinary Parasitology xxx (2015) xxx–xxx

Taken together, real-time PCR assays developed in the present study are fast, sensitive and highly specific techniques which can (i) detect and (ii) quantify H.meleagridis in various sample backgrounds. Both, FeHYD or rpb1 based qPCR demonstrate same range of sensitivity and specificity for H. meleagridis. The application of either assay can be in different context; from diagnostic and monitoring purposes to their implementation as tool for studying the pathophysiology of histomonosis. Acknowledgements The authors thank Dieter Liebhart and Tarik Sulejmanovic for providing tissue material from infected birds. Imtiaz Hussain was financed by the Higher Education Commission of Pakistan. References Bilic, I., Jaskulska, B., Souillard, R., Liebhart, D., Hess, M., 2014. Multi-locus typing of Histomonas meleagridis isolates demonstrates the existence of two different genotypes. PLoS One 9, e92438. Bleyen, N., De, G.K., De, G.J., Goddeeris, B.M., 2007. Specific detection of Histomonas meleagridis in turkeys by a PCR assay with an internal amplification control. Vet. Parasitol. 143, 206–213. Commission Regulation (EC) No 2205/2001 of November 14, 2001 amending Council Directive 70/524/EEC concerning additives in feedingstuffs as regards withdrawal of the authorisation of certain additives. Off. J., 3-4. Ganas, P., Liebhart, D., Glösmann, M., Hess, C., Hess, M., 2012. E. coli strongly supports the growth of Histomonas meleagridis, in a monoxenic culture, without influence on ist pathogenicity. Int. J. Parasitol. 42, 893–901. Grabensteiner, E., Hess, M., 2006. PCR for the identification and differentiation of Histomonas meleagridis, Tetratrichomonas gallinarum and Blastocystis sp. Vet. Parasitol. 142, 223–230. Hafez, H.M., Hauck, R., Luschow, D., McDougald, L., 2005. Comparison of the specificity and sensitivity of PCR nested PCR, and real-time PCR for the diagnosis of histomoniasis. Avian Dis. 49, 366–370. Hess, M., Kolbe, T., Grabensteiner, E., Prosl, H., 2006. Clonal cultures of Histomonas meleagridis, Tetratrichomonas gallinarum and a Blastocystis sp. established through micromanipulation. Parasitology 133, 547–554. Hess, M., Liebhart, D., Bilic, I., Ganas, P., 2015. Histomonas meleagridis—new insights into an old pathogen. Vet. Parasitol. 208, 67–76. Huber, K., Chauve, C., Zenner, L., 2005. Detection of Histomonas meleagridis in turkeys cecal droppings by PCR amplification of the small subunit ribosomal DNA sequence. Vet. Parasitol. 131, 311–316. Kemp, R.L., Reid, W.M., 1965. Pathogenicity studies on Trichomonas gallinarum in domestic poultry. Poult. Sci. 44, 215–221. Landman, W.J.M., ter Veen, C., Van der Heijden, H.M.J.F., Klinkenberg, D., 2015. Quantification of parasite shedding and horizontal transmission parameters in Histomonas meleagridis infected turkeys determined by real-time quantitative PCR. Avian Pathol. 4, 1–30, http://dx.doi.org/10.1080/3,079,457.2015, 1,058,483.

7

Lawson, B., Cunningham, A.A., Chantrey, J., Hughes, L.A., John, S.K., Bunbury, N., Bell, D.J., Tyler, K.M., 2011. A clonal strain of Trichomonas gallinae is the aetiologic agent of an emerging avian epidemic disease. Infect. Genet. Evol. 11, 1638–1645. Liebhart, D., Weissenbock, H., Hess, M., 2006. In-situ hybridization for the detection and identification of Histomonas meleagridis in tissues. J. Comp. Pathol. 135, 237–242. Lollis, L., Gerhold, R., McDougald, L., Beckstead, R., 2011. Molecular characterization of Histomonas meleagridis and other parabasalids in the United States using the 5. 8S, ITS-1, and ITS-2 rRNA regions. J. Parasitol. 97, 610–615. Malik, S.B., Brochu, C.D., Bilic, I., Yuan, J., Hess, M., Logsdon, J.M., Carlton Jr., J.M., 2011. Phylogeny of parasitic parabasalia and free-living relatives inferred from conventional markers vs. Rpb1, a single-copy gene. PLoS One 6, e20774. McDougald, L.R., 2005. Blackhead disease (histomoniasis) in poultry: a critical review. Avian Dis. 49, 462–476. Nguyen, D.T., Bilic, I., Jaskulska, B., Hess, M., Le, D.Q., Hua, N.L.L., Huynh, V.V., Nguyen, S.T., Vu-Khac, H., 2015. Prevalence and genetic chracterization of Histomonas meleagridis in chickens in Vietnam. Avian Dis. (in press). Sambrook, J., Russell, D.W., 2001. Introduction to southern hybridization. In: In: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 6. 33-6.36. Singh, A., Weissenbock, H., Hess, M., 2008. Histomonas meleagridis: immunohistochemical localization of parasitic cells in formalin-fixed, paraffin-embedded tissue sections of experimentally infected turkeys demonstrates the wide spread of the parasite in its host. Exp. Parasitol. 118, 505–513. Stenzel, D.J., Boreham, P.F., 1996. Blastocystis hominis revisited. Clin. Microbiol. Rev. 9, 563–584. Sulejmanovic, T., Bilic, I., Hess, M., Liebhart, D., 2015. An in-vitro attenuated strain of Histomonas meleagridis provides cross-protective immunity in turkeys against heterologous virulent isolates. Avian Pathol, in press. Tyzzer, E.E., 1920. The flagellate character and reclassification of the parasite producing Blackhead in turkeys: Histomonas (Gen.nov.) meleagridis (Smith). J. Parasitol., 124–131. van der Heijden, H.M., Stegeman, A., Landman, W.J., 2010. Development of a blocking-ELISA for the detection of antibodies against Histomonas meleagridis in chickens and turkeys. Vet. Parasitol. 171, 216–222. Whelan, J.A., Russell, N.B., Whelan, M.A., 2003. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 278, 261–269. Windisch, M., Hess, M., 2009. Establishing an indirect sandwich enzyme-linked-immunosorbent-assay (ELISA) for the detection of antibodies against Histomonas meleagridis from experimentally infected specific pathogen-free chickens and turkeys. Vet. Parasitol. 161, 25–30. Xu, J., Qu, C., Tao, J., 2014. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences. Avian Pathol. 43, 62–67.

Please cite this article in press as: Hussain, I., et al., Detection and quantification of Histomonas meleagridis by real-time PCR targeting single copy genes. Vet. Parasitol. (2015), http://dx.doi.org/10.1016/j.vetpar.2015.08.011