Diagnostic Microbiology and Infectious Disease 79 (2014) 240–241
Contents lists available at ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Description of a new Mycobacterium intracellulare pattern of PCR restriction enzyme analysis of hsp65 gene Paulo Cesar de Souza Caldas, Carlos Eduardo Dias Campos, Lusiano Motta dos Reis, Nicole Victor Ferreira, Luciana Distásio de Carvalho, Mariza Villas Boas da Silva, Reginalda Ferreira de Melo Medeiros, Fátima Cristina Onofre Fandinho Montes, Jesus Pais Ramos ⁎ National Reference Laboratory for Tuberculosis, Centro de Referência Professor Hélio Fraga, Escola Nacional de Saúde Pública, Fiocruz, RJ, Brazil
a r t i c l e
i n f o
Article history: Received 8 November 2013 Received in revised form 29 January 2014 Accepted 30 January 2014 Available online 20 February 2014
a b s t r a c t This work comprises 9 pulmonary nontuberculous mycobateria isolates obtained from sputum of 4 different patients from Brazil. The sequencing and phylogenetic analysis allowed their accurate identification as Mycobacterium intracellulare. We report a mutation at position 453 creating a new HaeIII cutting site and, therefore, a new PRA-hsp65 M. intracellulare profile. © 2014 Elsevier Inc. All rights reserved.
Keywords: Mycobacterium intracellulare Nontuberculous mycobacteria PRA-hsp65
Nontuberculous mycobateria (NTM) are increasingly recognized as significant human pathogens, and its causative agent, more diverse. Thus, the accurate identification at the species level is important to determine the appropriate treatment (Griffith et al., 2007; Lee et al., 2009). PCR restriction fragment length polymorphism analysis of hsp65 gene (PRA-hsp65) is a nonexpensive method developed by Telenti et al. (1993) for the rapid identification of mycobacteria. This molecular tool is carried out by PCR amplification of a 441 bp fragment of the hsp65 gene followed by restriction of the amplified product with the enzymes BstEII and HaeIII. The PRA-hsp65 methodology is an important diagnostic tool used in many countries worldwide (Esparcia et al., 2011; Kim et al., 2008; Ong et al., 2010; Senna et al., 2011). Mycobacterium intracellulare is a frequently identified pathogen causing lung disease. During the period of 2009–2012 in the National Reference Laboratory for Tuberculosis, Centro de Referência Professor Hélio Fraga/ENSP/FIOCRUZ, 126 samples of this species were identified by PRA-hsp65 as 1 of 4 already reported profiles in the PRAsite (http://app.chuv.ch/prasite/index.html). These 4 M. intracellulare types presented the following fragment patterns: type 1 (BstEII 235/120/100 and HaeIII 145/130/60), type 2 (BstEII 235/210 and HaeIII 140/105/80), type 3 (BstEII 235/210 and HaeIII 145/130), and type 4 (BstEII 235/210 and HaeIII 120/115/110). The aim of this work is to report a 5th M. intracellulare PRA-hsp65 type to improve the mycobacteria diagnostic and to perform its molecular characterization. ⁎ Corresponding author. Tel.: +55-21-24414740; fax: +55-21-34174017. E-mail address: jepramos@ensp.fiocruz.br (J.P. Ramos). http://dx.doi.org/10.1016/j.diagmicrobio.2014.01.028 0732-8893/© 2014 Elsevier Inc. All rights reserved.
This study includes 9 pulmonary isolates obtained from sputum of 4 different patients of the National Reference Laboratory for Tuberculosis, CRPHF/ENSP/FIOCRUZ, between 2009 and 2012, whose PRA-hsp65 pattern was not found in the PRAsite database. As later analysis revealed that all isolates obtained from the same patient were identical, we referred to 4 strains, HF6805, HF12240, HF14368, and HF3646 (the oldest isolate originating from each patient). The amplification and digestion of hsp65 fragments were performed as described by Telenti et al. (1993), and the resulting restriction digest pattern was compared to the PRAsite database. The partial 16s rDNA and ITS fragments were amplified respectively as described by Hall et al. (2003) and Roth et al. (2000). The sequences obtained were compared on similarity with those in the GeneBank using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The partial 16S rDNA, hsp65 gene, and ITS sequences were used to construct a concatenated neighbor-joining tree (Devulder et al., 2005) with MEGA version 5 (Tamura et al., 2011). The hsp65 PCR product obtained from strains HF6805, HF12240, HF14368, and HF3646 cleaved with BstEII produced fragments of about 235, 120, and 100 bp, and with HaeIII resulted in fragments of about 130, 100, 60, and 55 bp. The closest match in the PRAsite was the patterns of Mycobacterium kansasii type 3 (BstEII: 235/130/85, and HaeIII: 130/95/70), Mycobacterium kansasii type 6, and Mycobacterium gastri type 1 (BstEII: 235/130/85, and HaeIII: 130/105/70), all with a high and inconclusive score. The sequences of the strains studied were obtained to perform a more accurate identification. The GenBank accession numbers for the 16S rRNA sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030698, KF186678, KF186677, and
P.C.d.S. Caldas et al. / Diagnostic Microbiology and Infectious Disease 79 (2014) 240–241
241
Fig. 1. Phylogenetic concatenated tree computed from partial 16S rDNA, hsp65 gene, and ITS sequences by the neighbor-joining method and Kimura's 2-parameter as the substitution model. The significance of branches is indicated by bootstrap values calculated on 1000 replicates. Mycobacterium tuberculosis H37Rv sequence was used as outgroup. The strains represented in this study are indicated by *.
Table 1 SNP in strains studied in comparison with M. intracellulare ATCC 13950 type strain. Strains HF6805 HF12240 HF14368 HF3646 M. intracellulare
CCGCCGCGATTTCGGCC⁎GGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCGGGCGACCAGTCGATCG
⁎ Nucleotide in 543 position on the complete hsp65 gene, creating a new HaeIII, cutting site.
KF186676; the hsp65 sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030699, KF186675, KF186673, and KF186674; and ITS sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030700, KF186680, KF186679, and KF186681. The sequences of hsp65 gene were identical in HF12240, HF14368, and HF3646 strains, presenting 99.25% (3 mismatches) of identity with M. intracellulare type strain (ATCC13950), and strain HF6805 has 1 more mismatch (99% identity). The sequences of partial 16S rDNA gene were identical in HF12240, HF14368, and HF3646 strains, presenting 100% identity with M. intracellulare type strain, and strain HF6805 presented 1 more mismatch with 99.58% identity. The ITS sequences of strains HF12240, HF14368, and HF3646 were also identical, presenting 99.28% identity with M. intracellulare type strain (2 mismatches), and again, strain HF6805 presented 1 more mismatch (98.92% identity). The concatenated tree showed M. intracellulare type strain and all strains studied in a separate branch (with a bootstrap value of 98), clearly distinct from related mycobacteria species used. The topology of the tree also reflected the differences between the strain HF6805 and the other tree strains (Fig. 1). Turenne et al. (2006) describes 4 hsp65 M. intracellulare sequevars and 11 mutations in this gene, in positions 93–1467. We found 5 mutations in the hsp65 gene (none of reported by Turenne), 4 of them present in all strains, in positions: 336 (G→C), 453 (G→C), 477 (C→G), 570 (C→T). The mutation occurring at position 441 (G→C) was found only in the strain HF6805. The mutation at position 453
creates a new cutting site (GG′CC) for the activity of enzyme HaeIII (Table 1). As the result of molecular and phylogenetic analysis confirms the identification of our 4 isolates as M. intracellulare, we report a new site of HaeIII present in this species and thus a new PRA-hsp65 profile. References Devulder G, Pérouse-de-Montclos M, Flandrois JP. A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model. Int J Syst Evol Microbiol 2005;55:293–302. Esparcia Ó, Español M, Garrigó M, Moreno C, Montemayor M, Navarro F, et al. Use of different PCR-based techniques integrated into a non-tuberculous identification algorithm. Enferm Infecc Microbiol Clin 2011;30:3–10. Griffith DE, Aksamit T, Brown-Elliott BA, Catanzaro A, Daley C, Gordin F, et al. ATS Mycobacterial Diseases Subcommittee; American Thoracic Society; Infectious Disease Society of America. An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007;175:367–416. Hall L, Doerr KA, Wohlfiel SL, Roberts GD. Evaluation of the MicroSeq system for identification of mycobacteria by 16S ribosomal DNA sequencing and its integration into a routine clinical mycobacteriology laboratory. J Clin Microbiol 2003;41:1447–53. Kim S, Park EM, Kwon OJ, Lee JH, Ki CS, Lee NY, et al. Direct application of the PCR restriction analysis method for identifying NTM species in AFB smear-positive respiratory specimens. Int J Tuberc Lung Dis 2008;12:1344–6. Lee AS, Jelfs P, Sintchenko V, Gilbert GL. Identification of non-tuberculous mycobacteria: utility of the GenoType Mycobacterium CM/AS assay compared with HPLC and 16S rRNA gene sequencing. J Med Microbiol 2009;58:900–4. Ong CS, Ngeow YF, Yap SF, Tay ST. Evaluation of PCR-RFLP analysis targeting hsp65 and rpoB genes for the typing of mycobacterial isolates in Malaysia. J Med Microbiol 2010;59:1311–6. Roth A, Reischl U, Streubel A, Naumann L, Kroppenstedt RM, Habicht M, et al. Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J Clin Microbiol 2000;38:1094–104. Senna SG, Marsico AG, Vieira GB, Sobral LF, Suffys PN, Fonseca LS. Identification of nontuberculous mycobacteria isolated from clinical sterile sites in patients at a university hospital in the city of Rio de Janeiro, Brazil. J Bras Pneumol 2011;37: 521–6. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731–9. Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 1993;31:175–8. Turenne CY, Semret M, Cousins DV, Collins DM, Behr MA. Sequencing of hsp65 distinguishes among subsets of the Mycobacterium avium complex. J Clin Microbiol 2006;44:433–40.
Contents lists available at ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Description of a new Mycobacterium intracellulare pattern of PCR restriction enzyme analysis of hsp65 gene Paulo Cesar de Souza Caldas, Carlos Eduardo Dias Campos, Lusiano Motta dos Reis, Nicole Victor Ferreira, Luciana Distásio de Carvalho, Mariza Villas Boas da Silva, Reginalda Ferreira de Melo Medeiros, Fátima Cristina Onofre Fandinho Montes, Jesus Pais Ramos ⁎ National Reference Laboratory for Tuberculosis, Centro de Referência Professor Hélio Fraga, Escola Nacional de Saúde Pública, Fiocruz, RJ, Brazil
a r t i c l e
i n f o
Article history: Received 8 November 2013 Received in revised form 29 January 2014 Accepted 30 January 2014 Available online 20 February 2014
a b s t r a c t This work comprises 9 pulmonary nontuberculous mycobateria isolates obtained from sputum of 4 different patients from Brazil. The sequencing and phylogenetic analysis allowed their accurate identification as Mycobacterium intracellulare. We report a mutation at position 453 creating a new HaeIII cutting site and, therefore, a new PRA-hsp65 M. intracellulare profile. © 2014 Elsevier Inc. All rights reserved.
Keywords: Mycobacterium intracellulare Nontuberculous mycobacteria PRA-hsp65
Nontuberculous mycobateria (NTM) are increasingly recognized as significant human pathogens, and its causative agent, more diverse. Thus, the accurate identification at the species level is important to determine the appropriate treatment (Griffith et al., 2007; Lee et al., 2009). PCR restriction fragment length polymorphism analysis of hsp65 gene (PRA-hsp65) is a nonexpensive method developed by Telenti et al. (1993) for the rapid identification of mycobacteria. This molecular tool is carried out by PCR amplification of a 441 bp fragment of the hsp65 gene followed by restriction of the amplified product with the enzymes BstEII and HaeIII. The PRA-hsp65 methodology is an important diagnostic tool used in many countries worldwide (Esparcia et al., 2011; Kim et al., 2008; Ong et al., 2010; Senna et al., 2011). Mycobacterium intracellulare is a frequently identified pathogen causing lung disease. During the period of 2009–2012 in the National Reference Laboratory for Tuberculosis, Centro de Referência Professor Hélio Fraga/ENSP/FIOCRUZ, 126 samples of this species were identified by PRA-hsp65 as 1 of 4 already reported profiles in the PRAsite (http://app.chuv.ch/prasite/index.html). These 4 M. intracellulare types presented the following fragment patterns: type 1 (BstEII 235/120/100 and HaeIII 145/130/60), type 2 (BstEII 235/210 and HaeIII 140/105/80), type 3 (BstEII 235/210 and HaeIII 145/130), and type 4 (BstEII 235/210 and HaeIII 120/115/110). The aim of this work is to report a 5th M. intracellulare PRA-hsp65 type to improve the mycobacteria diagnostic and to perform its molecular characterization. ⁎ Corresponding author. Tel.: +55-21-24414740; fax: +55-21-34174017. E-mail address: jepramos@ensp.fiocruz.br (J.P. Ramos). http://dx.doi.org/10.1016/j.diagmicrobio.2014.01.028 0732-8893/© 2014 Elsevier Inc. All rights reserved.
This study includes 9 pulmonary isolates obtained from sputum of 4 different patients of the National Reference Laboratory for Tuberculosis, CRPHF/ENSP/FIOCRUZ, between 2009 and 2012, whose PRA-hsp65 pattern was not found in the PRAsite database. As later analysis revealed that all isolates obtained from the same patient were identical, we referred to 4 strains, HF6805, HF12240, HF14368, and HF3646 (the oldest isolate originating from each patient). The amplification and digestion of hsp65 fragments were performed as described by Telenti et al. (1993), and the resulting restriction digest pattern was compared to the PRAsite database. The partial 16s rDNA and ITS fragments were amplified respectively as described by Hall et al. (2003) and Roth et al. (2000). The sequences obtained were compared on similarity with those in the GeneBank using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The partial 16S rDNA, hsp65 gene, and ITS sequences were used to construct a concatenated neighbor-joining tree (Devulder et al., 2005) with MEGA version 5 (Tamura et al., 2011). The hsp65 PCR product obtained from strains HF6805, HF12240, HF14368, and HF3646 cleaved with BstEII produced fragments of about 235, 120, and 100 bp, and with HaeIII resulted in fragments of about 130, 100, 60, and 55 bp. The closest match in the PRAsite was the patterns of Mycobacterium kansasii type 3 (BstEII: 235/130/85, and HaeIII: 130/95/70), Mycobacterium kansasii type 6, and Mycobacterium gastri type 1 (BstEII: 235/130/85, and HaeIII: 130/105/70), all with a high and inconclusive score. The sequences of the strains studied were obtained to perform a more accurate identification. The GenBank accession numbers for the 16S rRNA sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030698, KF186678, KF186677, and
P.C.d.S. Caldas et al. / Diagnostic Microbiology and Infectious Disease 79 (2014) 240–241
241
Fig. 1. Phylogenetic concatenated tree computed from partial 16S rDNA, hsp65 gene, and ITS sequences by the neighbor-joining method and Kimura's 2-parameter as the substitution model. The significance of branches is indicated by bootstrap values calculated on 1000 replicates. Mycobacterium tuberculosis H37Rv sequence was used as outgroup. The strains represented in this study are indicated by *.
Table 1 SNP in strains studied in comparison with M. intracellulare ATCC 13950 type strain. Strains HF6805 HF12240 HF14368 HF3646 M. intracellulare
CCGCCGCGATTTCGGCC⁎GGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCCGGCGACCAGTCGATCG CCGCGGCGATTTCGGCGGGCGACCAGTCGATCG
⁎ Nucleotide in 543 position on the complete hsp65 gene, creating a new HaeIII, cutting site.
KF186676; the hsp65 sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030699, KF186675, KF186673, and KF186674; and ITS sequences of strains HF6805, HF12240, HF14368, and HF3646 are, respectively, KF030700, KF186680, KF186679, and KF186681. The sequences of hsp65 gene were identical in HF12240, HF14368, and HF3646 strains, presenting 99.25% (3 mismatches) of identity with M. intracellulare type strain (ATCC13950), and strain HF6805 has 1 more mismatch (99% identity). The sequences of partial 16S rDNA gene were identical in HF12240, HF14368, and HF3646 strains, presenting 100% identity with M. intracellulare type strain, and strain HF6805 presented 1 more mismatch with 99.58% identity. The ITS sequences of strains HF12240, HF14368, and HF3646 were also identical, presenting 99.28% identity with M. intracellulare type strain (2 mismatches), and again, strain HF6805 presented 1 more mismatch (98.92% identity). The concatenated tree showed M. intracellulare type strain and all strains studied in a separate branch (with a bootstrap value of 98), clearly distinct from related mycobacteria species used. The topology of the tree also reflected the differences between the strain HF6805 and the other tree strains (Fig. 1). Turenne et al. (2006) describes 4 hsp65 M. intracellulare sequevars and 11 mutations in this gene, in positions 93–1467. We found 5 mutations in the hsp65 gene (none of reported by Turenne), 4 of them present in all strains, in positions: 336 (G→C), 453 (G→C), 477 (C→G), 570 (C→T). The mutation occurring at position 441 (G→C) was found only in the strain HF6805. The mutation at position 453
creates a new cutting site (GG′CC) for the activity of enzyme HaeIII (Table 1). As the result of molecular and phylogenetic analysis confirms the identification of our 4 isolates as M. intracellulare, we report a new site of HaeIII present in this species and thus a new PRA-hsp65 profile. References Devulder G, Pérouse-de-Montclos M, Flandrois JP. A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model. Int J Syst Evol Microbiol 2005;55:293–302. Esparcia Ó, Español M, Garrigó M, Moreno C, Montemayor M, Navarro F, et al. Use of different PCR-based techniques integrated into a non-tuberculous identification algorithm. Enferm Infecc Microbiol Clin 2011;30:3–10. Griffith DE, Aksamit T, Brown-Elliott BA, Catanzaro A, Daley C, Gordin F, et al. ATS Mycobacterial Diseases Subcommittee; American Thoracic Society; Infectious Disease Society of America. An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007;175:367–416. Hall L, Doerr KA, Wohlfiel SL, Roberts GD. Evaluation of the MicroSeq system for identification of mycobacteria by 16S ribosomal DNA sequencing and its integration into a routine clinical mycobacteriology laboratory. J Clin Microbiol 2003;41:1447–53. Kim S, Park EM, Kwon OJ, Lee JH, Ki CS, Lee NY, et al. Direct application of the PCR restriction analysis method for identifying NTM species in AFB smear-positive respiratory specimens. Int J Tuberc Lung Dis 2008;12:1344–6. Lee AS, Jelfs P, Sintchenko V, Gilbert GL. Identification of non-tuberculous mycobacteria: utility of the GenoType Mycobacterium CM/AS assay compared with HPLC and 16S rRNA gene sequencing. J Med Microbiol 2009;58:900–4. Ong CS, Ngeow YF, Yap SF, Tay ST. Evaluation of PCR-RFLP analysis targeting hsp65 and rpoB genes for the typing of mycobacterial isolates in Malaysia. J Med Microbiol 2010;59:1311–6. Roth A, Reischl U, Streubel A, Naumann L, Kroppenstedt RM, Habicht M, et al. Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J Clin Microbiol 2000;38:1094–104. Senna SG, Marsico AG, Vieira GB, Sobral LF, Suffys PN, Fonseca LS. Identification of nontuberculous mycobacteria isolated from clinical sterile sites in patients at a university hospital in the city of Rio de Janeiro, Brazil. J Bras Pneumol 2011;37: 521–6. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731–9. Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 1993;31:175–8. Turenne CY, Semret M, Cousins DV, Collins DM, Behr MA. Sequencing of hsp65 distinguishes among subsets of the Mycobacterium avium complex. J Clin Microbiol 2006;44:433–40.
