REPORT Cell Cycle 14:24, 3897--3907; December 15, 2015; © 2015 Taylor & Francis Group, LLC

Deregulated expression of Cdc6 in the skin facilitates papilloma formation and affects the hair growth cycle
a1,y, Peggy Sotiropoulou2, Cecilia Sgarlata1,z, Luis R Borlado1,yy, Manuel Eguren3,zz, Orlando Domínguez4, Sabela Bu Sagrario Ortega5, Marcos Malumbres3, Cedric Blanpain2, and Juan M
endez1,* 1 DNA Replication Group; Molecular Oncology Program; Spanish National Cancer Reserch Center (CNIO); Madrid, Spain; 2Interdisciplinary Research Institute; Universit
e Libre de Bruxelles; Bruxelles, Belgium; 3Cell Division and Cancer Group; Molecular Oncology Program; Spanish National Cancer Research Center (CNIO); Madrid, Spain; 4Genomics Unit, Biotechnology Program; Spanish National Cancer Research Center (CNIO); Madrid, Spain; 5Transgenic Mice Unit; Biotechnology Program; Spanish National Cancer Research Center (CNIO); Madrid, Spain y Current address: Institut Pasteur; Paris, France Current address: Roche Farma SA; Madrid, Spain yy Current address: Capricor Therapeutics; San Francisco, CA, USA zz Current address: European Molecular Biology Laboratory (EMBL); Heidelberg, Germany z

Keywords: Cdc6, DNA replication, hair follicle, mouse model, papilloma

Cdc6 encodes a key protein for DNA replication, responsible for the recruitment of the MCM helicase to replication origins during the G1 phase of the cell division cycle. The oncogenic potential of deregulated Cdc6 expression has been inferred from cellular studies, but no mouse models have been described to study its effects in mammalian tissues. Here we report the generation of K5-Cdc6, a transgenic mouse strain in which Cdc6 expression is deregulated in tissues with stratified epithelia. Higher levels of CDC6 protein enhanced the loading of MCM complexes to DNA in epidermal keratinocytes, without affecting their proliferation rate or inducing DNA damage. While Cdc6 overexpression did not promote skin tumors, it facilitated the formation of papillomas in cooperation with mutagenic agents such as DMBA. In addition, the elevated levels of CDC6 protein in the skin extended the resting stage of the hair growth cycle, leading to better fur preservation in older mice.

Introduction Proper control over DNA replication is essential for the accurate transmission of genetic information between cell generations. In mammalian cells, genome duplication starts at thousands of replication origins, which serve as the assembly points of “pre-replication complexes” (pre-RCs) in the G1 phase of the cell division cycle. At each individual origin, CDC6 protein cooperates with the origin recognition complex (ORC) to recruit MCM, a hexameric DNA helicase that is activated upon entry into S-phase. The engagement of the ring-shaped MCM helicase with the DNA, also referred to as origin licensing, requires ATPase activity provided by ORC and CDC6 and is facilitated by another protein called CDT1 (reviewed in refs.1-2). Most of the genes required for origin licensing are under the control of the Rb-E2F pathway and the corresponding proteins are regulated by CDK activity. These regulatory elements are almost universally altered after malignant transformation (reviewed in refs.3-4). For instance, premature expression of Cyclin E1 interferes with MCM loading onto DNA.5 In turn, deficient MCM function impairs the functionality of stem cells6-8 and makes mice prone to

different cancer types.7-12 Conversely, aberrant overexpression of MCM-loading factors also promotes genomic instability and cell transformation.13 The oncogenic potential of Cdc6 had been inferred from its capacity to induce DNA replication in quiescent cells, in cooperation with cycE-CDK214 as well as its ability to repress the expression of Ink4/Arf15-16 and E-cadherin.17 Cdc6 is overexpressed in subsets of brain tumors, mantle cell lymphomas and non-small cell lung carcinomas (reviewed in ref.18). Besides cancer, mutations that affect the activity of ORC, CDC6 and CDT1 have been linked to Meier-Gorlin syndrome, an autosomal recessive form of dwarfism.19-22 Despite these antecedents, no models have been described to monitor the effects of Cdc6 deregulation in a mammalian organism. Here, we have generated a transgenic mouse strain that expresses Cdc6 in stratified epithelia. In this model, CDC6 protein is overexpressed in the skin, an organ extensively used to study cell proliferation, differentiation, aging and tumorigenesis (reviewed in ref.23). We report that CDC6 protein enhances the loading of MCM complexes onto DNA in keratinocytes without affecting the overall proliferation rate in the tissue. While Cdc6 overexpression was not

*Correspondence to: Juan M
endez; Email: [email protected] Submitted: 06/08/2015; Revised: 10/22/2015; Accepted: 11/12/2015 http://dx.doi.org/10.1080/15384101.2015.1120919

www.tandfonline.com

Cell Cycle

3897

amino acid N-terminal extension. The cDNA corresponding to the shorter isoform, mCdc6-a, closer in size to human Cdc6, was cloned in a delivery vector under the control of the K5 promoter, which is active in the basal layer of the epidermis, the outer root sheath of hair follicles and other organs with stratified squamous epithelia.24-25 Upon pronuclear injection of the construct into fertilized eggs and implantation into stimulated females, a K5Cdc6 transgenic strain was established. Southern blot analysis indicated tandem integration of K5-Cdc6 copies, a common event in microinjection-mediated transgenesis26 (Fig. S1A). The integration site was mapped by PCR-based gene walking to an intronic region in the gene coding for vesicle-trafficking protein SEC22a in chromosome 16 (Fig. S1B). K5-Cdc6 embryos developed normally and mice were born at Mendelian rates. In young adult individuals, strongest mRNA overexpression was detected in the skin, as expected (Fig. 1A). Overexpression was also observed, albeit at lower levels, in other tissues including esophagus, stomach, kidney, lung, salivary gland and brain. At the protein level, CDC6 total levels increased approximately 8-fold in keratinocytes isolated from the skin basal layer (Fig. 1B).

Figure 1. Efficient Cdc6 overexpression in K5-Cdc6 mice. (A) Top, schematic of K5-Cdc6 mice generation. A linearized vector containing the promoter of bovine keratin 5 gene (K5 prom), followed by the cDNA corresponding to the short isoform of murine Cdc6 (mCdc6-a) and the SV40 early polyadenylation signal (SV40 pA) was injected into fertilized eggs and implanted in recipient foster mothers. Chimeric mice that transmitted the K5-Cdc6 transgene to the progeny (founder lines) were selected. Histograms show average Cdc6 mRNA levels in different tissues, determined by RT-PCR (n D 2 wild type and n D 2 K5-Cdc6 mice). (B) Immunoblot analysis of CDC6 protein in extracts prepared from keratinocytes derived from the back skin of 4 2 month-old wild type (#1-4) and K5Cdc6 (#5-8) mice. a-tubulin is shown as loading control. The histogram shows the quantification of CDC6 protein abundance, averaged from the 4 mice of each genotype. In each case, CDC6 signal was normalized to its corresponding a-tubulin signal.

sufficient to induce skin tumors, it enhanced the formation of carcinogen-induced papillomas. Unexpectedly, Cdc6 overexpression extended the resting telogen stage of the hair growth cycle, which correlated with better fur preservation in old K5-Cdc6 transgenic animals.

Results Generation of K5-Cdc6 transgenic mice Two isoforms of mouse CDC6 protein are encoded by the same chromosome 11 gene, which are identical except for a 27

3898

Enhanced chromatin association of MCM complexes Biochemical fractionation of K5-Cdc6 skin keratinocytes showed that the majority of overexpressed CDC6 protein was bound to chromatin (Fig. 2A). Consistent with its function as a helicase loader, higher amounts of MCM proteins were detected on chromatin in these keratinocytes (Fig. 2A). Enhanced MCM loading was observed in the skin of K5-Cdc6 mice of different ages, from newborns to 24-month old (Fig. S2). Cdc6 overexpression did not affect the mRNA levels of Mcm3 (Fig. 2B). Neither the rate of DNA synthesis nor the distribution between cell cycle stages was significantly affected in K5-Cdc6 keratinocytes (Fig. 2C-D). The latter observation rules out the possibility that the effect on MCM loading is indirect (in cycling cells, MCM proteins are most abundant on chromatin in G1 and early S phase). Therefore, the 3- to 10-fold enrichment of MCM concentration on chromatin likely reflects a situation of Cdc6 gain of function. We considered that the amount of CDC6 protein could be further increased in the absence of CDH1, the APC/C cofactor that targets CDC6 for proteolysis.27 To test this possibility in keratinocytes, K5-Cdc6 mice were crossbred with a Cdh1 conditional KO strain28 in which the K5-Cre transgene was used to excise the Cdh1 allele specifically in the skin. DCdh1 keratinocytes displayed higher levels of endogenous CDC6 than control keratinocytes (Fig. 2E, compare lanes 1-2 and 8-9) and in combination with the K5-Cdc6 transgene, accumulated large amounts of CDC6 protein (Fig. 2E, compare lanes 3-4 and 10-11). Surprisingly, the higher concentration of CDC6 did not further increase the amount of chromatin-bound MCM complexes (Fig. 2F, lanes 6 and 8), indicating that CDC6 accumulation becomes ineffective after a certain MCM concentration on DNA has been reached. Since the K5-Cdc6: DCdh1 allele combination did not result in additional MCM loading, the rest of the study was focused on the K5-Cdc6 strain.

Cell Cycle

Volume 14 Issue 24

Normal interfollicular epidermis and efficient wound healing in K5-Cdc6 skin Histological analysis of skin sections showed normal epidermal and dermal architecture in K5-Cdc6 mice (Fig. 3, top panels). In line with the biochemical data described above, the basal layer of K5-Cdc6 interfollicular epidermis displayed an increased percentage of MCM-positive cells, as observed with 2 independent antibodies directed to MCM subunits Mcm4 and Mcm6 (Fig. 3). The proliferation index and the percentage of cells undergoing DNA replication, monitored by Ki67 and BrdU incorporation, were not affected. The percentage of cells expressing DNA damage marker gH2AX was similarly low in both genotypes (Fig. 3, bottom panels). We next tested the ability of K5Cdc6 skin to heal after injury, a complex process that involves an initial coagulation and inflammatory response, followed by a proliferation phase to form granulation tissue and deposit collagen, and a final stage of wound-closing mediated by the contraction of myofibroblasts (reviewed in ref.29). Similar kinetics of wound healing were observed in wild type and K5-Cdc6 mice, indicating that the higher levels of CDC6 protein were compatible with inflammation, fibroblast mobilization and wound-closing responses (Fig. 4). We conclude from these experiments that high levels of Cdc6 expression stabilize the binding of MCM proteins to DNA without interfering with the proliferation rate and homeostasis of the interfollicular epidermis.

Figure 2. K5-Cdc6 is a gain-of-function model for MCM loading. (A) Immunoblots show the relative amounts of MCM2, MCM4, MCM6 and CDC6 proteins in soluble and chromatin-enriched fractions, following biochemical fractionation of keratinocytes derived from the back skin of 4 wild type (#1–4) and 4 K5-Cdc6 mice (#5–8). The last 3 lanes in each set of gels correspond to serial dilutions (1:2, 1:4, 1:8) of sample #8, for quantification purposes. MEK2 and SA1 are shown as markers of soluble and chromatin-bound proteins, respectively. (B) Quantification of relative MCM3 mRNA abundance in keratinocytes isolated from 24 month old mice (n D 4 wild type; n D 4 K5-Cdc6). (C) Representative flow cytometry profiles of BrdU incorporation in primary keratinocytes kept in culture for 24 h, after a 2 h pulse-label with 10 mM BrdU. (D) Representative cell cycle profiles of the same keratinocytes as in B, derived from flow cytometry analyses of DNA content. (E) Immunoblots showing total levels of CDC6 and CDH1 proteins in whole keratinocyte extracts derived from the back skin of 2 wild type mice (#1–2), 2 K5-Cdc6 mice (#3–4), 2 DCdh1 mice (#8–9), and 2 K5-Cdc6: DCdh1 mice (#10–11). Lanes 5–7 and 12–14 correspond to serial dilutions (1:2, 1:4, 1:8) of samples #4 and #11, respectively. MEK2 is shown as loading control. (F) Immunoblots following biochemical fractionation of keratinocytes show the relative amounts of the indicated proteins in soluble and chromatin-enriched fractions. Samples are derived from keratinocytes of the following genotypes: wild type (lanes 1 and 5), K5-Cdc6 (lanes 2 and 6), DCdh1 (lanes 3 and 7) and K5-Cdc6: DCdh1 (lanes 4 and 8). MEK2 and H3 are shown as markers of soluble and chromatin-bound proteins, respectively.

K5-Cdc6 mice are hypersensitive to chemical carcinogens To monitor the impact of Cdc6 overexpression on tumorigenesis, cohorts of mice (44 wild type, 61 K5Cdc6) were assigned to a longevity study in the absence of any treatment. The lifespan of K5-Cdc6 mice was similar to that of wild type mice (Fig. 5A). K5-Cdc6 mice did not develop skin tumors, and other skin conditions such as dermatitis were observed with similar frequency as in the control group. The most frequent causes of death in both cohorts were age-associated tumors such as lymphomas and

www.tandfonline.com

histiocytic sarcomas (Table 1). To check whether the oncogenic potential of Cdc6 deregulated expression was restrained by p53mediated tumor suppression, K5-Cdc6 mice were crossbred with a p53-null strain to obtain K5-Cdc6; p53+/- and K5-Cdc6;

Cell Cycle

3899

p53¡/¡ animals. Loss of p53 reduced lifespan due to a higher frequency of lymphomas, as described,30 but Cdc6 overexpression from the K5 promoter did not have any impact on life expectancy of p53 heterozygous or p53-null mice (Fig. 5B-C), and no skin tumors were detected in any of these mice cohorts. We conclude that the presence of high levels of CDC6 protein in stratified epithelia is not sufficient to trigger tumor formation and is compatible with normal lifespan in the C57BL/6 genetic background. To check whether Cdc6 deregulation could cooperate with other tumorpromoting events, we used the DMBA/ TPA assay in which a single application of DMBA induces oncogenic mutations (with high frequency in H-Ras), and subsequent treatment with TPA promotes the clonal expansion of mutated cells to form non-malignant papillomas.31 To study the influence of Cdc6 overexpression in this context, groups of age-matched wild type and K5-Cdc6 mice were subject to DMBA-TPA treatment (Fig. 5D). By the end of the study (35 weeks), K5-Cdc6 mice had developed on average 2.5-fold more papillomas than their wild type littermates (Fig. 5E). No differences in papilloma structure were observed at the histopathology level, and lesions did not progFigure 3. Histological analyses of K5-Cdc6 skin. Images show fields of skin tissue after Hematoxyress to squamous cell carcinomas lin-Eosin staining (H&E) and IHC detection of MCM4, MCM6, Ki-67, BrdU and gH2AX. An intraperitoneal injection of BrdU (5 mg in 300 ml of 0.9% NaCl) was administered to mice 2h before (SCC), probably due to the inherent sacrifice. Histograms show quantifications of the average percentage and standard variation of resistance of the C57BL/6 genetic backcells scored as positive for each staining (n D 4 wild type and 4 K5-Cdc6 mice; 500 cells/ tissue). ground.32 This experiment suggests Scale bar, 12.5 mm. that Cdc6 overexpression sensitizes normal epithelium to the treatment with DMBA-TPA, probably conferring a proliferative advantage that favors the clonal outgrowth of H-Ras mutated cells. The advantage proTable 1. Causes of death of mice included in the survival curve (Fig. 5A). Sample size: 44 wild type mice (32M/12F), 61 K5-Cdc6 mice (43M/18F). 1The vided by Cdc6 required the initial DMBA-driven mutagenic majority of tumors were hematological neoplasias (lymphomas and histioevent, as the skin hyperplasia normally induced by TPA treatcytic sarcomas). No skin tumors of any type were observed in any individual. ment alone was not enhanced in K5-Cdc6 mice (Fig. S3). Asterisk indicates severe symptoms that forced humane end-point sacrifice. # Cause of death was not immediately clear from necropsy. In these rare cases, anomalies included intestinal obstruction or liver hemorrhage. Cause of death/sacrifice Tumors1 Dermatitis* Seminal gland hyperplasia* Ovarian cysts* Others#

3900

wild type (n D 44)

K5-Cdc6 (n D 61)

32 (73%) 3 (6.8%) 5 (11%) 1 (2.3%) 3 (6.8%)

42 (69%) 6 (9.8%) 8 (13%) 2 (3.3%) 3 (4.9%)

Better fur preservation in old K5-Cdc6 mice In the groups of mice kept under observation for aging studies, we noticed a remarkable preservation of hair density and dark color in some of the older K5-Cdc6 individuals compared to age-matched wild type mice. To monitor the extent of this phenotype, all >105 week-old mice in the colony were assigned at one point to one of 3 categories according to their fur aspect:

Cell Cycle

Volume 14 Issue 24

of the HF (reviewed in ref.23). These stem cells could be visualized in the HF bulge of 24 month-old mice of both genotypes (Fig. 6C). Their capacity to migrate and regenerate new hair was not affected after dorsal hair plucking, a method that induces stem cell mobilization and new hair growth in the depilated area (Fig. 6D). We then monitored hair growth in a natural setting, taking advantage of the fact that the 2 initial hair cycles are highly synchronic in the back skin of post-natal mice (Fig. 7A, top). The percentage of HFs in each stage was monitored in cohorts of wild type and K5-Cdc6 mice between 3 and 10 weeks of age (see Fig. 7A for a schematic of the scoring method). At the initial time point (3 weeks), 80% of wild type HFs were in early anagen and by 4 weeks, virtually 100% of HFs had reached full anagen (Fig. 7B). In contrast, the majority of K5-Cdc6 HFs remained in telogen or early anagen by 4 weeks (Fig. 7C). Similarly, by 6 weeks, most of wild type follicles had reached catagen and telogen, whereas approximately 50% of transgenic HFs were still in anagen. This apparent delay in hair cycle progression was observed through the duration of the experiment. By week 9, when almost 100% of wild type HFs had completed a full cycle and reached early anagen again, over 50% of K5-Cdc6 HFs remained in telogen. These results indicate that Cdc6 overexpression extends the resting, telogen stage of the HF growth cycle.

Discussion

Figure 4. Wound healing in wild type and K5-Cdc6 mice. (A) Representative image of the back skin of a K5-Cdc6 mice showing progressive wound healing at day 0 (start), and days 3, 6, 8 and 12 post-wound. (B) Histograms showing the percentage of wound area (median and standard deviation) remaining at each time point, relative to the initial wound surface (n D 3 wild type and 3 K5-Cdc6 mice).

‘aged’ (generalized hair loss and abundant gray hair), ‘intermediate’ (localized patches of hair loss or hair graying) and ‘fit’ (black hair and no hair loss; Fig. 6A). The percentage of individuals in the fit category was 2.8-fold higher in old K5-Cdc6 mice (59% vs. 21% of wild type). Conversely, the percentage of wild type mice included in the ‘aged’ group was 3.4-fold higher (34% vs. 10% of K5-Cdc6 animals). Of note, when keratinocytes were isolated from older K5-Cdc6 individuals with marked differences in fur phenotype, the expression levels of aging biomarkers p16Ink4a and p19Arf remained low in K5-Cdc6 compared to wild type mice (Fig. 6B). Cdc6 deregulation extends the resting stage of the hair follicle (HF) cycle The fur preservation observed in older K5-Cdc6 mice suggests that Cdc6 expression levels could affect the hair growth cycle. HFs undergo cyclic rounds of growth (anagen), regression (catagen) and rest (telogen), fueled by a reservoir of stem cells located at the ‘bulge’ structure that are periodically mobilized to the base

www.tandfonline.com

We have generated a new mouse model with high levels of Cdc6 expression in stratified epithelia that provides, to our knowledge, the first tool to evaluate the effects of Cdc6 deregulation in a mammalian tissue. The characterization of K5-Cdc6 mice provides insights into the role of Cdc6 in DNA replication and also constitutes a new tool to investigate Cdc6 proto-oncogenic activity. In addition it has revealed an unanticipated link between Cdc6 levels and the hair growth cycle. Our results show that the concentration of CDC6 protein is a limiting factor for MCM helicase loading in epidermal keratinocytes, as confirmed by the biochemical detection of MCM complexes on chromatin. In addition, the percentage of interfollicular cells positive for MCM staining was higher in the skin of K5-CDC6 mice, a result that could be interpreted in several ways. A direct effect of Cdc6 on MCM transcription is unlikely as similar levels of Mcm3 mRNA were detected in wild type and K5-CDC6 keratinocytes. It is conceivable that cells with high CDC6 content are less prone to enter quiescence, maximizing the time in which MCM proteins are abundant. An alternative, non-exclusive interpretation would be that chromatin association stabilizes MCM complexes, facilitating their immunodetection. The role of CDC6 protein in the recruitment of MCM to DNA was established in numerous studies in yeast and Xenopus (reviewed in ref. 18). An early study showed that Cdc6 acts as a multicopy suppressor of a defective ORC mutant strain,33 suggesting that CDC6 protein could stabilize ORC and possibly facilitate origin selection.34 The ATPase activity provided by both ORC and

Cell Cycle

3901

Figure 5. Higher susceptibility to DMBA-TPA-induced carcinogenesis. (A) Kaplan-Meier survival curves show similar life expectancy for wild type (n D 44) and K5-Cdc6 (n D 61) mice. (B) Kaplan-Meier survival curves for wild type (n D 27) and K5-Cdc6 (n D 35) mice in a p53-hemizygous background. (C) Kaplan-Meier survival curves for wild type (n D 17) and K5-Cdc6 (n D 18) mice in a p53-null (¡/¡) background. (D) Left, outline of the DMBA/TPA application protocol. Right, representative images of mice in the study, taken at week 35. (E) Average number and size distribution of papillomas per mouse in function of time (7-35 weeks) in wild type (n D 12) and K5-Cdc6 (n D 14) mice.

CDC6 is required to engage MCM at origins35-36 and in addition, CDC6 uses its ATPase to disengage itself from the pre-RC after MCM loading, facilitating initiation of DNA replication.37 Our data with K5-Cdc6 mice support the important role of CDC6 protein in MCM loading in the context of a mammalian tissue. As APC/C-CDH1 ubiquitin ligase mediates the proteolysis of CDC6, its ablation in K5-Cdc6 mice led to even larger levels of CDC6 accumulation. Intriguingly, this effect did not further enhance the extent of MCM loading. It could be argued that loss of CDH1 would stabilize geminin, a canonical inhibitor of MCM loading during S and G2. However, the stabilization of geminin in Cdh1-null MEFs was not sufficient to influence the kinetics of MCM loading.28 It should be noted that geminin protects Cdt1 from degradation in mitosis to promote origin licensing at the right time.38 We favor the idea that the large accumulation of CDC6 protein in Cdh1-null cells is not functional because another MCM-loading factor, possibly

3902

CDT1, becomes limiting. It is also conceivable that transcriptional activity and other chromatin contexts impose a limit to the total amount of MCM helicases that can be engaged with DNA before the initiation of DNA replication. In this regard, a recent study has shown that Drosophila MCM complexes are rapidly displaced from all genomic sites undergoing transcription.39 Another conclusion from our study is that the excess of MCM complexes on chromatin did not affect the rate of DNA replication or cell proliferation in the basal layer of the epidermis of K5-Cdc6 mice. The exact number and position of replication origins in mammalian cells is still a matter of research and debate (reviewed in refs.40-41), but normal cells are adapted to replicate and proliferate with an excess of MCM complexes relative to the number of active origins in S phase. The ‘extra’ MCM complexes serve a protective function by allowing the activation of back-up origins in situations of stress.42-43 Therefore, we hypothesize that the ‘extra’ MCM complexes engaged with DNA in K5-Cdc6

Cell Cycle

Volume 14 Issue 24

Figure 6. Preservation of hair density and color in old K5-Cdc6 mice. (A) Three phenotypic categories were defined according to the fur aspect. Aged: prevalence of gray hair and extensive areas of hair loss. Intermediate: localized patches of gray hair or hair loss. Fit: Prevalence of black hair and no hair loss. The plot shows the distribution of old (105 weeks-old) wild type and K5-Cdc6 mice in each category, according to the age of each individual (n D 33 wild type and 22 K5-Cdc6 mice). (B) Mcm3 mRNA expression levels in back skin keratinocytes, determined by RT-PCR (n D 4 wild type and n D 5 K5Cdc6 mice). (C) Immunodetection of bulge stem cells in the HF of wild type and K5-Cdc6 mice with a CD34 antibody (purple). Samples were also stained with Keratin 14 antibody, a marker of the basal layer cells (green), and DNA was counterstained with DAPI (blue). (D) Representative images of hair regrowth in wild type and K5-CDC6 individuals. Photographs were taken at the indicated days after 3 rounds of hair plucking in the dorsal area. Macroscopic analyses did not reveal any difference between genotypes (n D 4 wild type and n D 4 K5-CDC6 mice).

keratinocytes are distributed between the large number of potential origins (active or dormant), and do not interfere with DNA replication. Cdc6 deregulation also had an unanticipated effect in the HF cycle, counteracting age-induced alopecia. CDC6 protein levels could influence epidermal stem cell proliferation, mobilization or differentiation, adding a new element to the complex regulation of HF growth cycle (reviewed in ref.44). Our experiments suggest that HF stem cell mobilization was not affected in K5-Cdc6 mice, at least when induced by hair plucking. On the other hand, analyses of the initial post-natal hair cycles of K5-Cdc6 mice

www.tandfonline.com

revealed an accumulation of HFs in the telogen stage. This is interesting because telogen follicles can retain hair shafts for longer periods of time, reducing the need for continuous regeneration (reviewed in ref.45). The preservation of dark color could be due to the coupling of HF cycling and follicular melanogenesis, which controls the color of the hair shaft.46 The molecular mechanism(s) by which Cdc6 expression makes HF more refractory to anagen-activating signals are not known and will require further investigation. They could involve the role of CDC6 in licensing replication origins,18 its capacity to repress transcription,15-17 or a combination of both.

Cell Cycle

3903

positively boost tumor development in cooperation with oncogenic mutations, probably by promoting the clonal outgrowth of pre-cancerous cells. These observations imply that CDC6 and MCM proteins could be exploited as targets for novel cytotoxic drugs.

Materials and Methods

Figure 7. Extended resting phase in the hair growth cycle of K5-Cdc6 mice. (A) Top, time scale for the hair cycle in the mouse epidermis (small differences may appear depending on strain and sex). The first 2 hair cycles, until postnatal day 84, are synchronized. Bottom left, schematic of the increasing and decreasing length of HFs during the hair cycle. Anagen (A), growth phase; catagen (C), regression phase; telogen (T), resting phase. Bottom right, representative photographs of a HF at each of the indicated stages. EA, early anagen. LA, late anagen. Scale bar, 50 mm. (B, C) Average distribution and standard variation of HF growth cycle stage in wild type (B) or K5-Cdc6 mice (C) analyzed at the indicated ages (n D 19 wild type, distributed as follows: 3 £ 3 week-old (wo), 2 £ 4 wo, 2 £ 6 wo, 5 £ 7 wo, 2 £ 8 wo, 2 £ 9 wo, 3 £ 10 wo; n D 22 K5-Cdc6; age distribution: 3 £ 3 wo, 4 £ 4 wo, 4 £ 6 wo, 4 for 7 wo, 2 £ 8 wo, 2 £ 9 wo, 3 £ 10 wo). Average count, 600 HF per mouse.

Finally, we conclude that Cdc6 overexpression by itself is not sufficient to promote skin tumors, at least in C57BL/6 mice, but its proto-oncogenic potential is unveiled in cooperation with DMBA-induced mutations. It is worth noting that a transgenic mouse strain overexpressing MCM7 protein in the basal layer of the epidermis (K14-Mcm7) also displayed faster rates of papilloma formation in response to DMBATPA.47 Thus, high levels of origin-activating proteins

3904

CNIO-ISCIII Ethics fare (CEIyBA).

Generation of K5-Cdc6 transgenic mice A NheI fragment containing fulllength mCdc6-a cDNA was cloned downstream of the bovine keratin 5 (K5) promoter in p368, a pBluescript II KS+-based vector containing a rabbit b-globin intron and SV40 polyadenilation signal.24-25 A linear 8.5 kb DNA fragment containing all these elements was generated with NotI digestion, purified and microinjected into the pronuclei of C57BL/6J X CBA/J zygotes. Transgene insertion was screened in the progeny by Southern blot from genomic DNA isolated from tail clips, using a specific Cdc6 probe that allows the detection of endogenous and transgenic Cdc6 DNA after NheI digestion. Two founder lines were obtained that displayed germline transmission of K5Cdc6. One of the lines was dropped from the study as K5-Cdc6 was integrated in the Y chromosome and overexpression was not detected. K5-Cdc6 mice derived from the other founder line were maintained in heterozygosity by crossbreeding K5-Cdc6 mice with C57BL/6J wild type individuals. For specific ablation of the APC/C cofactor Cdh1 in the skin, Cdh1(lox/lox) mice28 were intercrossed with K5-Cre transgenic mice. Mice were housed at the specific pathogen-free (SPF) area at the Spanish National Cancer Research Center (CNIO) animal facility. All animal procedures were approved by the Committee for Research and Animal Wel-

Gene walking by unpredictably primed (UP) PCR Genomic DNA from a K5-Cdc6 transgenic sample was assayed by unpredictably primed PCR48 using a panel of walking primers and transgene-specific reverse primers 11E11 (50 CTCTGCACGCATTCTCAGC) and 11E12 (50 ACA-CCGTGTCAAGATACT).

Cell Cycle

Volume 14 Issue 24

A first PCR reaction (annealing T, 64 C) was carried out with primer 11E11 and a panel of walking primers, with each combination in a different reaction tube, followed by a semi-nested reaction (annealing T, 55 C) with primers 11E12 and 26C9 (50 TTTTTTTGTTTGTTGTGGG). The use of 2D7 walking primer (50 TTTTTTTTTTTGTT-TGTTGTGGGGGTCT) in the first PCR reaction yielded a homogeneous 360 bp product and sequence analysis revealed a putative insertion site in intron 4 of gene SEC22a in chromosome 11, coding for vesicle-trafficking protein Sec22a. Integration of K5-Cdc6 at this site was confirmed by a specific PCR reaction using SEC22a-specific oligonucleotide F6204 (50 ATTTCCAGTACACAGGACTCAC), and transgene-specific oligonucleotide 11E11. Keratinocyte isolation and culture Back skin was excised from euthanized mice, cut into 3- to4 cm2 pieces and incubated in 0.25 g/mL trypsin (SigmaAldrich) overnight at 4 C. The epidermis was separated from the dermal tissue, minced and filtered through a 0.7 mm nylon gauze (Falcon). Keratinocytes were collected by centrifugation (8 min/ 500 g). For culture, cells were resuspended in serum-free Cnt-07 medium (CELLnTEC) supplemented with antibiotic/antimycotic solution (Invitrogen) and seeded in dishes with Coating Matrix Kit (Cascade Biologics). Flow cytometry analysis of DNA content was performed after propidium iodide staining, according to standard procedures. When indicated, 10 mM BrdU was added to the medium for 2 h, before cell fixation and incubation with FITC-conjugated anti-BrdU antibody (BD Biosciences, BD556028). Flow cytometry was performed in a FACS Canto II cytometer (Becton Dickinson) and data were analyzed using FlowJo software (version 9.3.1). RNA isolation and quantitative PCR Tissues were disrupted and homogenized in Trizol (Invitrogen) using a bead-beating system (Precellys). Total RNA was isolated and cDNA was obtained with Maxima First Strand cDNA kit (Thermo). Expression levels were determined by qRT-PCR (Applied Biosystems 7900HT) using the following primers: Cdc6 (F: 50 -ACACAC TGTTTGAGTGGCCGT; R: 50 -GCTTCAAGTCTCGGCAGAATTC); Mcm3 (F: 50 -TTCCTCAGCTGTGTGGTCTG; R: 50 -TCACCACCCTAGTGGCTTTC); Ink4a (F: 50 - TACCCCGATTCAGGTGAT; R: 50 TTGAGCAGAAGAGCTGCTACGT); Arf (F: 50 - GCCGCACCGGAATCCT; R: 50 -TTGAGCAGAAGAGCTGCTACGT); Gapdh expression levels were used as reference (F: 50 -TGAAGCAGGCATCTGAGGG; R: 50 -CGAAGGTGGAAGAGTGGGAG). Protein extracts, biochemical fractionation and immunobloting To prepare whole cell extracts, keratinocytes were resuspended in RIPA lysis buffer supplemented with protease inhibitors (Complete Mini EDTA, Roche) for 20 min on ice and sonicated for 30 seconds, followed by high-speed centrifugation (15 min/ 16,000 g/ 4  C). Protein concentration was determined using BCA (Pierce). Biochemical fractionation to separate soluble and chromatin-bound proteins was performed as described.49

www.tandfonline.com

Primary antibodies used for immunobloting: CDC6 (Millipore, #05-550), a-tubulin (Sigma-Aldrich, #T9026); CDH1 (Neomarkers, #MS-1116-P), MEK2 (BD Transduction, #610235); H3 (Abcam, #AB1791); SA1 (a gift of A. Losada, CNIO); AntiMcm2 (described in ref. 5). Rabbit polyclonal sera against mouse Mcm4 and Mcm6 proteins were generated using the following synthetic peptides as immunogens: Mcm4 (SLRSEESRSSPNRRC), Mcm6 (AGSQHPEVRDEVAEKC). Secondary horseradish peroxidase-linked anti-IgG antibodies were from GE Healthcare (UK). For protein quantification, immunoblot signal intensity was measured with Odyssey software (LI-COR Biosciences). Histological analysis and immunohistochemistry (IHC) Tissues were fixed overnight in 10% formalin, embedded in paraffine and sectioned (3 mm). Tissue sections were incubated for 30 min at 55 C before deparaffinization in xylene and rehydrated in a descending series of ethanol solutions. For IHC, antigen retrieval was carried out in a PTLink instrument (Dako) or in the DiscoveryXT (Ventana). Antibodies: Ki-67 (Master diagnostica, #0003110QD), BrdU (GE Healthcare, #RPN202), gH2AX (Millipore, #07-164), CD34 (BD, #560233), Keratin 14 (Covance). Immunoreactive cells were visualized using 3,30 diaminobenzidine tetrahydrochloride plus (DAB+) as a chromogen. Sections were counterstained with hematoxylin. DMBA-TPA skin papillomagenesis assay Young (2 to 4 month-old) mice were partially shaved and treated topically once with 20 mg of dimethylbenz[a]anthracene (DMBA; 0.1 g/L in acetone; Sigma-Aldrich). Starting one week later, mice were treated twice a week with 12.5 mg 12-ortho-tetradecanoylphrbol-13-acetate (TPA; 0.0625 g/L in acetone; Sigma-Aldrich) for 24 weeks. Two mice per genotype were treated with acetone as controls. The number and size of papillomas were monitored weekly, starting at week 7. Mice were kept in the study for a total of 35 weeks. TPA-induced tail skin hyperplasia 12-O-tetradecanoylphorbol 13-acetate (TPA, Sigma Aldrich) was applied topically (12.5 mg/ 200 ml acetone) in the tail skin of 2 month-old mice, 4 times at 48 h intervals. One animal of each genotype was treated with acetone alone. At the end of the experiment, mice were sacrificed and the tail skin subjected to histology examination after hematoxylin-eosin staining. The degree of hyperplasia was measured as epidermal thickness using ImageJ software. Wound healing assays Five skin punch biopsies (4 mm in diameter) were performed under isoflurane anesthesia in the back skin of 24 month-old mice and monitored at times 0 (start), 3, 6, 8 and 12 days. Wound healing was calculated as the percentage of remaining wound surface at each time point, relative to time 0.

Cell Cycle

3905

Hair plucking assays Dorsal hair was removed by application of depilatory cream in the back skin of 2 month-old mice placed under isoflurane anesthesia. The procedure was repeated 2 more times in the same area, allowing 2 weeks for hair regrowth between each procedure. After the third depilation round, photographs were taken every 2 days to macroscopically monitor the extent of hair regrowth in each individual. Hair follicle growth cycle analyses Tissue sections were deparaffinized and rehydrated as described above, and incubated with Mayer’s hematoxylin for 4 min, fixed in 70% ethanol and 0.1% HCl and incubated in eosin for 20 s. Slides were monitored under a Zeiss Axio Imager. M1 microscope with a Zeiss Axiocam MRC5 camera, using Axiovision release 4.6 software. The stage of the hair cycle of an average of 600 HF per mouse was assessed using the guide of M€ uller-Rover.50

histopathology evaluation of papilloma samples, Marcos D
ıaz for assistance with statistical analyses, Sergio Mu~ noz and Sara Rodriguez-Acebes for comments on the manuscript and all members of the DNA Replication Group for helpful discussions. PS is a Chercheur Qualifi
e FNRS; CB is a Welbio investigator. Funding

Supported by Ministerio de Econom
ıa y Competitividad, Spain (BFU2013-49153-P and Consolider-Ingenio CSD2007-00015 to JM, SAF2012-38215 and SAF2014-57791-REDC to MM, and a PhD fellowship to SB). Supplemental material

Supplemental data for this article can be accessed on the pub lisher’s website. Author contributions

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed. Acknowledgments

We are grateful to Soraya Ruiz and Isabel Blanco for excellent assistance with mouse work at CNIO, Alba de Martino for References 1. O’Shea VL, Berger JM. Loading strategies of ringshaped nucleic acid translocases and helicases. Curr Opin Struct Biol 2014; 25:16-24; PMID:24878340; http://dx.doi.org/10.1016/j.sbi.2013.11.006 2. Riera A, Tognetti S, Speck C. Helicase loading: how to build a MCM2-7 double-hexamer. Semin Cell Dev Biol 2014; 30:104-9; PMID:24637008; http://dx.doi. org/10.1016/j.semcdb.2014.03.008 3. Malumbres M, Barbacid M. Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer 2007; 9:153-66; http://dx.doi.org/10.1038/nrc2602 4. Blow JJ, Gillespie PJ. Replication licensing and cancer-a fatal entanglement? Nat Rev Cancer 2008; 8:799-806; PMID:18756287; http://dx.doi.org/10.1038/nrc2500 5. Ekholm-Reed S, Mendez J, Tedesco D, Zetterberg A, Stillman B, Reed SI. Deregulation of cyclin E in human cells interferes with prereplication complex assembly. J Cell Biol 2004; 165:789-800; PMID:15197178; http://dx.doi.org/10.1083/jcb.200404092 6. Flach J, Bakker ST, Mohrin M, Conroy PC, Pietras EM, Reynaud D, Alvarez S, Diolaiti ME, Ugarte F, Forsberg EC, et al. Replication stress is a potent driver of functional decline in aging hematopoietic stem cells. Nature 2014; 512:198-202; PMID:25079315; http:// dx.doi.org/10.1038/nature13619 7. Alvarez S, D
ıaz M, Flach J, Rodr
ıguez-Acebes S, L
opezContreras A, Mart
ınez D, Ca~ namero M, Fern
andezCapetillo O, Isern J, Passegu
e E, et al. Replication stress caused by low MCM expression limits fetal erythropoiesis and hematopoietic stem cell functionality. Nat Commun 2015; 6:8548; PMID:26456157; http:// dx.doi.org/10.1038/ncomms9548 8. Pruitt SC, Bailey KJ, Freeland A. Reduced Mcm2 expression results in severe stem/progenitor cell deficiency and cancer. Stem Cells 2007; 25:3121-32; PMID:17717065; http://dx.doi.org/10.1634/stemcells.2007-0483 9. Shima N, Alcaraz A, Liachko I, Buske TR, Andrews CA, Munroe RJ, Hartford SA, Tye BK, Schimenti JC.

3906

10.

11.

12.

13.

14.

15.

SB performed most of the experiments, with help from CS and LRB. CS and SO generated the K5-CDC6 transgenic strain. OD mapped the transgene integration site. ME and MM generated and provided the K5-DCdh1 strain. PS and CB analyzed the presence of stem cells in the hair follicles and analyzed the hair growth cycle. SB and JM designed the study and wrote the manuscript.

A viable allele of Mcm4 causes chromosome instability and mammary adenocarcinomas in mice. Nat Genet 2007; 39:93-8; PMID:17143284; http://dx.doi.org/ 10.1038/ng1936 Kunnev D, Rusiniak ME, Kudla A, Freeland A, Cady GK, Pruitt SC. DNA damage response and tumorigenesis in Mcm2-deficient mice. Oncogene 2010; 29:3630-8; PMID:20440269; http://dx.doi.org/ 10.1038/onc.2010.125 Chuang CH, Wallace MD, Abratte C, Southard T, Schimenti JC. Incremental genetic perturbations to MCM2-7 expression and subcellular distribution reveal exquisite sensitivity of mice to DNA replication stress. PLoS Genet 2010; 6 (9):e1001110; PMID:20838603; http://dx.doi.org/10.1371/ journal.pgen.1001110 Kawabata T, Luebben SW, Yamaguchi S, Ilves I, Matise I, Buske T, Botchan MR, Shima N. Stalled fork rescue via dormant replication origins in unchallenged S phase promotes proper chromosome segregation and tumor suppression. Mol Cell 2011; 41:543-53; PMID:21362550; http://dx.doi.org/10.1016/j. molcel.2011.02.006 Liontos M, Koutsami M, Sideridou M, Evangelou K, Kletsas D, Levy B, Kotsinas A, Nahum O, Zoumpourlis V, Kouloukoussa M. Deregulated overexpression of hCdt1 and hCdc6 promotes malignant behavior. Cancer Res 2007; 67:10899909; PMID:18006835; http://dx.doi.org/10.1158/ 0008-5472.CAN-07-2837 Cook JG, Park CH, Burke TW, Leone G, DeGregori J, Engel A, Nevins JR. Analysis of Cdc6 function in the assembly of mammalian prereplication complexes. Proc Natl Acad Sci USA 2002; 99:1347-52; PMID:11805305; http://dx.doi.org/ 10.1073/pnas.032677499 Gonzalez S, Klatt P, Delgado S, Conde E, Lopez-Rios F, Sanchez-Cespedes M, Mendez J, Antequera F, Serrano M. Oncogenic activity of Cdc6 through repression of the

Cell Cycle

16.

17.

18.

19.

20.

21.

22.

INK4/ARF locus. Nature 2006; 440:702-6; PMID:16572177; http://dx.doi.org/10.1038/nature04585 Gonzalez S, Serrano M. A new mechanism of inactivation of the INK4/ARF locus. Cell Cycle 2006; 5:13824; PMID:16855387; http://dx.doi.org/10.4161/ cc.5.13.2901 Sideridou M, Zakopoulou R, Evangelou K, Liontos M, Kotsinas A, Rampakakis E, Gagos S, Kahata K, Grabusic K, Gkouskou K, et al. Cdc6 expression represses Ecadherin transcription and activates adjacent replication origins. J Cell Biol 2011; 195:1123-40; PMID:22201124; http://dx.doi.org/10.1083/ jcb.201108121 Borlado LR, Mendez J. CDC6: from DNA replication to cell cycle checkpoints and oncogenesis. Carcinogenesis 2008; 29:237-43; PMID:18048387; http://dx.doi. org/10.1093/carcin/bgm268 Bicknell LS, Walker S, Klingseisen A, Stiff T, Leitch A, Kerzendorfer C, Martin CA, Yeyati P, Al Sanna N, Bober M, et al. Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling MeierGorlin syndrome. Nat Genet 2011; 43:350-5; PMID:21358633; http://dx.doi.org/10.1038/ng.776 Bicknell LS, Bongers EM, Leitch A, Brown S, Schoots J, Harley ME, Aftimos S, Al-Aama JY, Bober M, Brown PA, et al. Mutations in the pre-replication complex cause Meier-Gorlin syndrome. Nat Genet 2011; 43:356-9; PMID:21358632; http://dx.doi.org/ 10.1038/ng.775 Guernsey DL, Matsuoka M, Jiang H, Evans S, Macgillivray C, Nightingale M, Perry S, Ferguson M, LeBlanc M, Paquette J, et al. Mutations in origin recognition complex gene ORC4 cause Meier-Gorlin syndrome. Nat Genet 2011; 43:360-4; PMID:21358631; http:// dx.doi.org/10.1038/ng.777 Hossain M, Stillman B. Meier-Gorlin syndrome mutations disrupt an Orc1 CDK inhibitory domain and cause centrosome reduplication. Genes Dev 2012;

Volume 14 Issue 24

23.

24.

25.

26.

27.

28.

29.

30.

31.

26:1797-810; PMID:22855792; http://dx.doi.org/ 10.1101/gad.197178.112 Blanpain C, Fuchs E. Epidermal homeostasis: a balancing act of stem cells in the skin. Nat Rev Mol Cell Biol 2009; 10:207-17; PMID:19209183; http://dx.doi.org/ 10.1038/nrm2636 Ramirez A, Bravo A, Jorcano JL, Vidal M. Sequences 50 of the bovine keratin 5 gene direct tissue- and cell-typespecific expression of a lacZ gene in the adult and during development. Differentiation 1994; 58:53-64; PMID:7532601 Murillas R, Larcher F, Conti CJ, Santos M, Ullrich A, Jorcano JL. Expression of a dominant negative mutant of epidermal growth factor receptor in the epidermis of transgenic mice elicits striking alterations in hair follicle development and skin structure. EMBO J 1995; 14:5216-23; PMID:7489711 Ohtsuka M, Miura H, Sato M, Kimura M, Inoko H, Gurumurthy CB. PITT: pronuclear injection-based targeted transgenesis, a reliable transgene expression method in mice. Exp Anim 2012; 61:489-502; PMID:23095812; http://dx.doi.org/10.1538/ expanim.61.489 Petersen BO, Wagener C, Marinoni F, Kramer ER, Melixetian M, Lazzerini Denchi E, Gieffers C, Matteucci C, Peters JM, Helin K. Cell cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on APC-CDH1. Genes Dev 2000; 14:2330-43; PMID:10995389; http://dx.doi.org/ 10.1101/gad.832500 Garcia-Higuera I, Manchado E, Dubus P, Ca~ namero M, M
endez J, Moreno S, Malumbres M. Genomic stability and tumour suppression by the APC/C cofactor Cdh1. Nat Cell Biol 2008; 10:802-11; PMID:18552834; http://dx.doi.org/ 10.1038/ncb1742 Demaria M, Desprez PY, Campisi J, Velarde MC. Cell autonomous and non-autonomous effects of senescent cells in the skin. J Invest Dermatol 2015; 135(7):17226; PMID:25855157; http://dx.doi.org/10.1038/ jid.2015.108 Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Jr, Butel JS, Bradley A. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 1992; 356:21521; PMID:1552940; http://dx.doi.org/10.1038/ 356215a0 Balmain A, Ramsden M, Bowden GT, Smith J. Activation of the mouse cellular Harvey-ras gene in chemically induced benign skin papillomas. Nature 1984;

www.tandfonline.com

32.

33.

34.

35.

36.

37.

38.

39.

40.

307:658-60; PMID:6694757; http://dx.doi.org/ 10.1038/307658a0 Woodworth CD, Michael E, Smith L, Vijayachandra K, Glick A, Hennings H, Yuspa SH. Strain-dependent differences in malignant conversion of mouse skin tumors is an inherent property of the epidermal keratinocyte. Carcinogenesis 2004; 25:1771-8; PMID:15105299; http://dx.doi. org/10.1093/carcin/bgh170 Liang C, Weinreich M, Stillman B. ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell 1995; 81:667-76; PMID:7774008; http://dx.doi.org/10.1016/00928674(95)90528-6 Speck C, Stillman B. Cdc6 ATPase activity regulates ORC x Cdc6 stability and the selection of specific DNA sequences as origins of DNA replication. J Biol Chem 2007; 282:11705-14; PMID:17314092; http:// dx.doi.org/10.1074/jbc.M700399200 Randell JC, Bowers JL, Rodriguez HK, Bell SP. Sequential ATP hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase. Mol Cell 2006; 21:29-39; PMID:16387651; http://dx.doi.org/ 10.1016/j.molcel.2005.11.023 Fernandez-Cid A, Riera A, Tognetti S, Herrera MC, Samel S, Evrin C, Winkler C, Gardenal E, Uhle S, Speck C. An ORC/Cdc6/MCM2-7 Complex Is Formed in a Multistep Reaction to Serve as a Platform for MCM Double-Hexamer Assembly. Mol Cell 2013; 50:577-88; PMID:23603117; http://dx.doi.org/ 10.1016/j.molcel.2013.03.026 Chang F, Riera A, Evrin C, Sun J, Li H, Speck C, Weinreich M. Cdc6 ATPase activity disengages Cdc6 from the pre-replicative complex to promote DNA replication. eLife 2015; 4:e05795; http://dx.doi.org/ 10.7554/eLife.05795 Ballabeni A, Melixetian M, Zamponi R, Masiero L, Marinoni F, Helin K. Human geminin promotes preRC formation and DNA replication by stabilizing CDT1 in mitosis. EMBO J 2004; 23:3122-32; PMID:15257290; http://dx.doi.org/10.1038/sj. emboj.7600314 Powell SK, MacAlpine HK, Prinz JA, Li Y, Belsky JA, MacAlpine DM. Dynamic loading and redistribution of the Mcm2-7 helicase complex through the cell cycle. EMBO J 2015; 34:531-43; PMID:25555795; http:// dx.doi.org/10.15252/embj.201488307 Mechali M, Yoshida K, Coulombe P, Pasero P. Genetic and epigenetic determinants of DNA replication origins, position and activation. Curr Opin Genet Dev 2013; 23:124-31; PMID:23541525; http://dx.doi.org/ 10.1016/j.gde.2013.02.010

Cell Cycle

41. Bielinsky AK. Replication origins. Why do we need so many? Cell Cycle 2003; 2:307-9; PMID:12851480; http://dx.doi.org/10.4161/cc.2.4.435 42. Ge XQ, Jackson DA, Blow JJ. Dormant origins licensed by excess Mcm2-7 are required for human cells to survive replicative stress. Genes Dev 2007; 21:3331-41; PMID:18079179; http://dx.doi.org/10.1101/gad.457807 43. Ibarra A, Schwob E, Mendez J. Excess MCM proteins protect human cells from replicative stress by licensing backup origins of replication. Proc Natl Acad Sci USA 2008; 105:8956-61; PMID:18579778; http://dx.doi. org/10.1073/pnas.0803978105 44. Beck B, Blanpain C. Mechanisms regulating epidermal stem cells. EMBO J 2012; 31:2067-75; PMID:22433839; http://dx.doi.org/10.1038/ emboj.2012.67 45. Plikus MV. New activators and inhibitors in the hair cycle clock: targeting stem cells0 state of competence. J Invest Dermatol 2012; 132:1321-4; PMID:22499035; http://dx.doi.org/10.1038/jid.2012.38 46. Slominski A, Paus R. Melanogenesis is coupled to murine anagen: toward new concepts for the role of melanocytes and the regulation of melanogenesis in hair growth. J Invest Dermatol 1993; 101:90S-7S; PMID:8326158; http://dx.doi.org/10.1111/15231747.ep12362991 47. Honeycutt KA, Chen Z, Koster MI, Miers M, Nuchtern J, Hicks J, Roop DR, Shohet JM. Deregulated minichromosomal maintenance protein MCM7 contributes to oncogene driven tumorigenesis. Oncogene 2006; 25:4027-32; PMID:16518415; http://dx.doi. org/10.1038/sj.onc.1209435 48. Dominguez O, Lopez-Larrea C. Gene walking by unpredictably primed PCR. Nucleic Acids Res 1994; 22:3247-8; PMID:8065944; http://dx.doi.org/ 10.1093/nar/22.15.3247 49. Mendez J, Stillman B. Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol Cell Biol 2000; 20:8602-12; PMID:11046155; http://dx.doi.org/10.1128/ MCB.20.22.8602-8612.2000 50. Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, McKay IA, Stenn KS, Paus R. A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 2001; 117:3-15; PMID:11442744; http://dx.doi.org/10.1046/j.0022202x.2001.01377.x

3907